Starting /dee2/code/volunteer_pipeline.sh SRR5423581 current disk space = 3051353456640 free memory = 1580195256 SRR5423581 SRAfilesize dd68f6aba40d1567fc9e1409f1ce03ce SRR5423581.sra SRR5423581.sra file validated SRR5423581 is single end SRR5423581 is conventional basespace SRR5423581 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34375 34.0 31.0 34.0 30.0 34.0 2 32.477 34.0 31.0 34.0 30.0 34.0 3 32.508 34.0 31.0 34.0 30.0 34.0 4 35.90525 37.0 35.0 37.0 35.0 37.0 5 35.86725 37.0 35.0 37.0 35.0 37.0 6 35.951 37.0 35.0 37.0 35.0 37.0 7 35.9325 37.0 35.0 37.0 35.0 37.0 8 35.955 37.0 35.0 37.0 35.0 37.0 9 37.60725 39.0 37.0 39.0 35.0 39.0 10 37.602 39.0 37.0 39.0 35.0 39.0 11 37.63925 39.0 37.0 39.0 35.0 39.0 12 37.62275 39.0 37.0 39.0 35.0 39.0 13 37.616 39.0 37.0 39.0 35.0 39.0 14 39.04575 40.0 38.0 41.0 36.0 41.0 15 38.96975 40.0 38.0 41.0 36.0 41.0 16 38.79075 40.0 38.0 41.0 35.0 41.0 17 38.875 40.0 38.0 41.0 35.0 41.0 18 38.8745 40.0 38.0 41.0 35.0 41.0 19 38.93375 40.0 38.0 41.0 36.0 41.0 20 38.90175 40.0 38.0 41.0 35.0 41.0 21 38.7675 40.0 38.0 41.0 34.0 41.0 22 38.281 40.0 38.0 41.0 33.0 41.0 23 38.7885 40.0 38.0 41.0 35.0 41.0 24 38.89275 40.0 38.0 41.0 35.0 41.0 25 38.8555 40.0 38.0 41.0 35.0 41.0 26 38.75875 40.0 38.0 41.0 35.0 41.0 27 38.66325 40.0 38.0 41.0 34.0 41.0 28 38.73875 40.0 38.0 41.0 34.0 41.0 29 38.79025 40.0 38.0 41.0 35.0 41.0 30 38.64975 40.0 38.0 41.0 34.0 41.0 31 38.64425 40.0 38.0 41.0 34.0 41.0 32 38.47875 40.0 38.0 41.0 34.0 41.0 33 38.53875 40.0 38.0 41.0 34.0 41.0 34 38.46175 40.0 38.0 41.0 34.0 41.0 35 38.3725 40.0 38.0 41.0 34.0 41.0 36 38.332 40.0 38.0 41.0 33.0 41.0 37 38.19925 40.0 38.0 41.0 34.0 41.0 38 38.16425 40.0 38.0 41.0 33.0 41.0 39 38.265 40.0 38.0 41.0 33.0 41.0 40 38.215 40.0 38.0 41.0 33.0 41.0 41 38.20475 40.0 38.0 41.0 33.0 41.0 42 38.056 40.0 38.0 41.0 33.0 41.0 43 38.009 40.0 38.0 41.0 33.0 41.0 44 37.986 40.0 37.0 41.0 33.0 41.0 45 38.014 40.0 38.0 41.0 33.0 41.0 46 37.98275 40.0 38.0 41.0 33.0 41.0 47 37.91025 40.0 37.0 41.0 33.0 41.0 48 37.96975 40.0 37.0 41.0 33.0 41.0 49 37.87625 40.0 37.0 41.0 33.0 41.0 50 37.734 40.0 37.0 41.0 32.0 41.0 51 37.763 40.0 37.0 41.0 33.0 41.0 52 36.84375 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2212 1 0.0 2212 2 0.0 2212 3 0.0 2212 4 0.0 2212 5 0.0 2212 6 0.0 2212 7 0.0 2212 8 0.0 2212 9 0.0 2212 10 0.0 2212 11 0.0 2212 12 0.0 2212 13 0.0 2212 14 0.0 2212 15 0.0 2212 16 0.0 2212 17 0.0 2212 18 0.0 2212 19 0.0 2212 20 0.0 2212 21 0.0 2212 22 0.0 2212 23 0.0 2212 24 0.0 2212 25 0.0 2212 26 0.0 2212 27 0.0 2212 28 0.0 2212 29 0.0 2212 30 0.0 2212 31 0.0 2212 32 0.0 2212 33 0.0 2212 34 0.0 2212 35 0.0 2212 36 0.0 2212 37 0.0 2212 38 0.0 2212 39 0.0 2212 40 0.0 2212 41 0.0 2212 42 0.0 2212 43 0.0 2212 44 0.0 2212 45 0.0 2212 46 0.0 2212 47 0.0 2212 48 0.0 2212 49 0.0 2212 50 0.0 2212 51 0.0 2212 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 3.0 23 3.0 24 7.0 25 6.0 26 19.0 27 15.0 28 14.0 29 39.0 30 37.0 31 66.0 32 85.0 33 96.0 34 144.0 35 203.0 36 251.0 37 377.0 38 709.0 39 1914.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.64580725907384 11.163954943679599 6.858573216520651 45.331664580725906 2 20.575 15.225 36.875 27.325 3 21.25 17.375 24.4 36.975 4 23.75 25.900000000000002 23.200000000000003 27.150000000000002 5 23.65 30.225 24.725 21.4 6 18.175 34.150000000000006 25.15 22.525000000000002 7 14.899999999999999 22.775000000000002 42.225 20.1 8 16.7 22.325 31.474999999999998 29.5 9 18.55 21.0 33.975 26.474999999999998 10 18.75 35.4 25.55 20.3 11 22.85 26.6 22.475 28.075 12 21.025 23.025000000000002 27.35 28.599999999999998 13 20.225 26.150000000000002 27.250000000000004 26.375 14 20.225 26.0 28.749999999999996 25.025 15 20.4 25.650000000000002 26.325 27.625 16 20.1 25.825 26.700000000000003 27.375 17 22.05 24.175 27.150000000000002 26.625 18 19.725 26.224999999999998 27.425 26.625 19 20.125 25.650000000000002 29.15 25.074999999999996 20 20.200000000000003 25.624999999999996 27.950000000000003 26.224999999999998 21 20.630157539384847 26.206551637909474 27.406851712928233 25.756439109777446 22 20.8 25.775 27.0 26.424999999999997 23 21.025 24.75 27.3 26.924999999999997 24 20.05 25.8 26.924999999999997 27.224999999999998 25 20.825 25.674999999999997 28.050000000000004 25.45 26 20.25 26.224999999999998 27.800000000000004 25.724999999999998 27 19.175 25.0 27.400000000000002 28.425 28 20.849999999999998 25.974999999999998 27.125 26.05 29 20.775 24.8 27.950000000000003 26.474999999999998 30 20.925 25.35 27.450000000000003 26.275 31 20.3 26.05 26.200000000000003 27.450000000000003 32 20.95 26.575 26.674999999999997 25.8 33 19.475 26.674999999999997 26.974999999999998 26.875 34 21.099999999999998 25.124999999999996 26.55 27.224999999999998 35 22.05 24.5 27.200000000000003 26.25 36 20.9 25.424999999999997 25.85 27.825 37 21.6 27.025 25.074999999999996 26.3 38 20.849999999999998 26.275 27.025 25.85 39 20.075000000000003 26.6 26.5 26.825 40 20.75 25.2 28.749999999999996 25.3 41 22.125 24.525 28.249999999999996 25.1 42 21.775 24.375 27.05 26.8 43 21.275 26.325 25.2 27.200000000000003 44 21.675 25.15 26.674999999999997 26.5 45 20.9 25.474999999999998 26.125 27.500000000000004 46 21.525 24.5 27.025 26.950000000000003 47 20.330082520630157 24.85621405351338 27.806951737934483 27.00675168792198 48 20.130032508127034 24.55613903475869 26.30657664416104 29.00725181295324 49 20.349999999999998 25.525 26.025 28.1 50 21.030257564391096 24.63115778944736 27.106776694173547 27.231807951987996 51 21.25 24.075 26.724999999999998 27.950000000000003 52 20.549999999999997 25.6 27.425 26.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 3.5 23 3.0 24 6.5 25 10.0 26 13.0 27 16.0 28 28.0 29 40.0 30 46.5 31 53.0 32 59.0 33 65.0 34 91.0 35 117.0 36 118.5 37 120.0 38 156.5 39 218.5 40 244.0 41 263.5 42 283.0 43 304.0 44 325.0 45 337.5 46 350.0 47 358.5 48 367.0 49 370.5 50 374.0 51 356.0 52 338.0 53 335.5 54 333.0 55 290.0 56 247.0 57 202.0 58 157.0 59 140.5 60 124.0 61 99.5 62 75.0 63 69.0 64 50.5 65 38.0 66 31.0 67 24.0 68 18.0 69 12.0 70 10.0 71 8.0 72 7.5 73 7.0 74 4.0 75 1.0 76 2.0 77 3.0 78 2.5 79 2.0 80 1.0 81 0.0 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra Read 200000 spots for SRR5423581.sra Written 200000 spots for SRR5423581.sra SRR ids: ['SRR5423581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nv2dtv3k SRR5423581.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423581 file size 703978 SRR5423581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423581 SRR5423581_1.fastq Input file: SRR5423581_1.fastq trimmed: SRR5423581-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 18:00:39 2025 >> started Wed Feb 12 18:00:41 2025 >> done (1.561s) 4000000 reads processed; of these: 269 ( 0.01%) short reads filtered out after trimming by size control 364 ( 0.01%) empty reads filtered out after trimming by size control 3999367 (99.98%) reads available; of these: 54933 ( 1.37%) trimmed reads available after processing 3944434 (98.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 7 0.00% 20 7 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 10 0.00% 27 6 0.00% 28 8 0.00% 29 11 0.00% 30 7 0.00% 31 22 0.00% 32 20 0.00% 33 39 0.00% 34 32 0.00% 35 53 0.00% 36 59 0.00% 37 58 0.00% 38 61 0.00% 39 72 0.00% 40 111 0.00% 41 125 0.00% 42 121 0.00% 43 174 0.00% 44 241 0.01% 45 374 0.01% 46 500 0.01% 47 808 0.02% 48 1211 0.03% 49 2437 0.06% 50 6512 0.16% 51 41821 1.05% 52 3944434 98.63% 3999367 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=9 prefix-density=0.24 prefix-fanout=3.3 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=73.07 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.2 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTT Started job on | Feb 12 18:00:54 Started mapping on | Feb 12 18:00:55 Finished on | Feb 12 18:00:59 Mapping speed, Million of reads per hour | 3599.43 Number of input reads | 3999367 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3618845 Uniquely mapped reads % | 90.49% Average mapped length | 51.82 Number of splices: Total | 459576 Number of splices: Annotated (sjdb) | 450419 Number of splices: GT/AG | 452132 Number of splices: GC/AG | 6393 Number of splices: AT/AC | 417 Number of splices: Non-canonical | 634 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275741 % of reads mapped to multiple loci | 6.89% Number of reads mapped to too many loci | 67201 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104781 104781 104781 N_multimapping 275741 275741 275741 N_noFeature 132368 3587743 149171 N_ambiguous 25169 41 10848 UnstrandedReadsAssigned:3461308 PositiveStrandReadsAssigned:31061 NegativeStrandReadsAssigned:3458826 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423581 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423581-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,367 reads, 3,644,809 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR5423581.ke.tsv 34699 SRR5423581.se.tsv 87100 total ==> SRR5423581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 301 48.2973 Potri.005G024800.1.v4.1 1035 936 120.046 39.4915 Potri.004G059700.1.v4.1 961 862 1 0.357211 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 53.5214 5.79468 Potri.016G087400.1.v4.1 270 171 159 286.307 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16 2.94304 Potri.012G127500.1.v4.1 977 878 2524 885.169 ==> SRR5423581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 103 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR5423581 completed mapping pipeline successfully