Starting /dee2/code/volunteer_pipeline.sh SRR5423582 current disk space = 3051817848832 free memory = 1504813136 SRR5423582 SRAfilesize 322048cb1bfacd41430ea29137fb50d7 SRR5423582.sra SRR5423582.sra file validated SRR5423582 is single end SRR5423582 is conventional basespace SRR5423582 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4975 34.0 31.0 34.0 31.0 34.0 2 32.50975 34.0 31.0 34.0 31.0 34.0 3 32.64975 34.0 31.0 34.0 31.0 34.0 4 36.02725 37.0 35.0 37.0 35.0 37.0 5 36.00725 37.0 35.0 37.0 35.0 37.0 6 36.0245 37.0 35.0 37.0 35.0 37.0 7 36.039 37.0 35.0 37.0 35.0 37.0 8 36.0125 37.0 35.0 37.0 35.0 37.0 9 37.85425 39.0 38.0 39.0 35.0 39.0 10 37.77575 39.0 38.0 39.0 35.0 39.0 11 37.67125 39.0 38.0 39.0 35.0 39.0 12 37.688 39.0 37.0 39.0 35.0 39.0 13 37.73275 39.0 38.0 39.0 35.0 39.0 14 39.2185 40.0 39.0 41.0 36.0 41.0 15 39.0875 40.0 38.0 41.0 36.0 41.0 16 39.008 40.0 38.0 41.0 36.0 41.0 17 38.97925 40.0 38.0 41.0 36.0 41.0 18 38.989 40.0 38.0 41.0 35.0 41.0 19 39.01125 40.0 39.0 41.0 36.0 41.0 20 38.9495 40.0 39.0 41.0 35.0 41.0 21 38.875 40.0 38.0 41.0 35.0 41.0 22 38.9895 40.0 39.0 41.0 36.0 41.0 23 38.99775 40.0 38.0 41.0 35.0 41.0 24 38.96375 40.0 38.0 41.0 35.0 41.0 25 38.77475 40.0 38.0 41.0 34.0 41.0 26 38.97525 40.0 39.0 41.0 35.0 41.0 27 38.858 40.0 38.0 41.0 35.0 41.0 28 38.94575 40.0 39.0 41.0 35.0 41.0 29 38.83275 40.0 38.0 41.0 35.0 41.0 30 38.9275 40.0 38.0 41.0 35.0 41.0 31 38.932 40.0 38.0 41.0 35.0 41.0 32 38.876 40.0 38.0 41.0 35.0 41.0 33 38.855 40.0 38.0 41.0 35.0 41.0 34 38.72 40.0 38.0 41.0 35.0 41.0 35 38.5885 40.0 38.0 41.0 34.0 41.0 36 38.71025 40.0 38.0 41.0 35.0 41.0 37 38.4725 40.0 38.0 41.0 34.0 41.0 38 38.55025 40.0 38.0 41.0 34.0 41.0 39 38.383 40.0 38.0 41.0 34.0 41.0 40 38.40075 40.0 38.0 41.0 34.0 41.0 41 38.248 40.0 38.0 41.0 33.0 41.0 42 38.221 40.0 38.0 41.0 33.0 41.0 43 38.177 40.0 38.0 41.0 33.0 41.0 44 38.109 40.0 38.0 41.0 33.0 41.0 45 37.90725 40.0 37.0 41.0 33.0 41.0 46 37.8645 40.0 37.0 41.0 33.0 41.0 47 38.0405 40.0 38.0 41.0 33.0 41.0 48 37.9545 40.0 37.0 41.0 33.0 41.0 49 38.02925 40.0 37.0 41.0 33.0 41.0 50 37.851 40.0 37.0 41.0 33.0 41.0 51 37.855 40.0 37.0 41.0 33.0 41.0 52 36.9195 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2307 1 0.0 2307 2 0.0 2307 3 0.0 2307 4 0.0 2307 5 0.0 2307 6 0.0 2307 7 0.0 2307 8 0.0 2307 9 0.0 2307 10 0.0 2307 11 0.0 2307 12 0.0 2307 13 0.0 2307 14 0.0 2307 15 0.0 2307 16 0.0 2307 17 0.0 2307 18 0.0 2307 19 0.0 2307 20 0.0 2307 21 0.0 2307 22 0.0 2307 23 0.0 2307 24 0.0 2307 25 0.0 2307 26 0.0 2307 27 0.0 2307 28 0.0 2307 29 0.0 2307 30 0.0 2307 31 0.0 2307 32 0.0 2307 33 0.0 2307 34 0.0 2307 35 0.0 2307 36 0.0 2307 37 0.0 2307 38 0.0 2307 39 0.0 2307 40 0.0 2307 41 0.0 2307 42 0.0 2307 43 0.0 2307 44 0.0 2307 45 0.0 2307 46 0.0 2307 47 0.0 2307 48 0.0 2307 49 0.0 2307 50 0.0 2307 51 0.0 2307 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 4.0 26 10.0 27 11.0 28 27.0 29 31.0 30 42.0 31 64.0 32 65.0 33 95.0 34 118.0 35 183.0 36 251.0 37 375.0 38 714.0 39 1992.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.22717037778334 11.783837878408807 6.855141356017012 45.133850387790844 2 21.55 14.35 37.85 26.25 3 20.849999999999998 16.975 24.5 37.675 4 24.8 26.325 21.2 27.675 5 22.875 29.9 25.374999999999996 21.85 6 17.45 31.825 25.7 25.025 7 14.6 23.025000000000002 42.5 19.875 8 17.125 22.15 32.45 28.275 9 17.5 21.349999999999998 33.725 27.425 10 18.2 34.625 26.75 20.424999999999997 11 22.575 26.25 23.375 27.800000000000004 12 21.6 23.025000000000002 27.150000000000002 28.225 13 20.7 25.6 28.175 25.525 14 20.0 26.0 28.625 25.374999999999996 15 20.575 25.6 27.325 26.5 16 21.825 25.924999999999997 26.375 25.874999999999996 17 20.825 24.55 27.250000000000004 27.375 18 21.15 23.799999999999997 27.0 28.050000000000004 19 22.225 26.900000000000002 26.0 24.875 20 21.525 25.15 27.975 25.35 21 20.625 25.7 27.150000000000002 26.525 22 22.45 24.975 26.75 25.825 23 21.325 25.575 27.250000000000004 25.85 24 21.55 25.5 25.7 27.250000000000004 25 20.3 27.650000000000002 25.45 26.6 26 19.975 26.474999999999998 27.125 26.424999999999997 27 20.974999999999998 25.650000000000002 26.0 27.375 28 19.775000000000002 26.35 27.525 26.35 29 20.7 25.900000000000002 27.375 26.025 30 20.075000000000003 25.275 27.325 27.325 31 20.474999999999998 26.424999999999997 26.674999999999997 26.424999999999997 32 21.65 25.4 26.825 26.125 33 21.725 23.75 27.325 27.200000000000003 34 21.3 25.4 27.224999999999998 26.075 35 20.9 25.874999999999996 27.375 25.85 36 20.875 24.675 27.55 26.900000000000002 37 21.625 25.624999999999996 25.224999999999998 27.525 38 21.125 25.75 27.224999999999998 25.900000000000002 39 20.424999999999997 25.25 28.075 26.25 40 21.5 25.424999999999997 26.400000000000002 26.674999999999997 41 21.125 26.224999999999998 26.325 26.325 42 20.9 23.775 27.275 28.050000000000004 43 20.925 26.125 27.275 25.674999999999997 44 21.825 25.324999999999996 27.575 25.275 45 20.95 25.174999999999997 26.424999999999997 27.450000000000003 46 21.55 25.724999999999998 26.375 26.35 47 21.625 25.674999999999997 26.3 26.400000000000002 48 20.724999999999998 25.0 27.425 26.85 49 20.95 24.65 26.125 28.275 50 21.775 25.174999999999997 26.674999999999997 26.375 51 19.475 24.55 27.35 28.625 52 21.475 26.025 26.525 25.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 8.0 25 11.0 26 16.0 27 21.0 28 22.0 29 23.0 30 32.0 31 41.0 32 52.0 33 63.0 34 81.0 35 99.0 36 116.0 37 133.0 38 168.5 39 215.0 40 226.0 41 260.0 42 294.0 43 308.5 44 323.0 45 339.0 46 355.0 47 359.0 48 363.0 49 370.5 50 378.0 51 374.0 52 370.0 53 342.0 54 314.0 55 264.0 56 214.0 57 200.0 58 186.0 59 162.5 60 139.0 61 114.0 62 89.0 63 70.0 64 45.0 65 39.0 66 32.0 67 25.0 68 16.0 69 7.0 70 8.0 71 9.0 72 7.0 73 5.0 74 4.5 75 4.0 76 2.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78357830714648 97.45 2 1.1150532184490625 2.1999999999999997 3 0.07602635580334516 0.22499999999999998 4 0.0 0.0 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195572 spots for SRR5423582.sra Written 195572 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra Read 195571 spots for SRR5423582.sra Written 195571 spots for SRR5423582.sra SRR ids: ['SRR5423582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85ya88na SRR5423582.sra spots: 3911421 blocks: [[1, 195571], [195572, 391142], [391143, 586713], [586714, 782284], [782285, 977855], [977856, 1173426], [1173427, 1368997], [1368998, 1564568], [1564569, 1760139], [1760140, 1955710], [1955711, 2151281], [2151282, 2346852], [2346853, 2542423], [2542424, 2737994], [2737995, 2933565], [2933566, 3129136], [3129137, 3324707], [3324708, 3520278], [3520279, 3715849], [3715850, 3911421]] SRR5423582 file size 688375 SRR5423582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423582 SRR5423582_1.fastq Input file: SRR5423582_1.fastq trimmed: SRR5423582-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:13:43 2025 >> started Wed Feb 12 17:13:45 2025 >> done (1.965s) 3911421 reads processed; of these: 218 ( 0.01%) short reads filtered out after trimming by size control 356 ( 0.01%) empty reads filtered out after trimming by size control 3910847 (99.99%) reads available; of these: 46400 ( 1.19%) trimmed reads available after processing 3864447 (98.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 10 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 1 0.00% 26 4 0.00% 27 8 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 9 0.00% 32 16 0.00% 33 22 0.00% 34 17 0.00% 35 29 0.00% 36 28 0.00% 37 30 0.00% 38 35 0.00% 39 39 0.00% 40 37 0.00% 41 64 0.00% 42 79 0.00% 43 122 0.00% 44 150 0.00% 45 227 0.01% 46 319 0.01% 47 500 0.01% 48 840 0.02% 49 1711 0.04% 50 5310 0.14% 51 36754 0.94% 52 3864447 98.81% 3910847 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=16 prefix-density=0.22 prefix-fanout=1.9 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=72.77 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.1 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 12 17:14:00 Started mapping on | Feb 12 17:14:00 Finished on | Feb 12 17:14:06 Mapping speed, Million of reads per hour | 2346.51 Number of input reads | 3910847 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3538073 Uniquely mapped reads % | 90.47% Average mapped length | 51.82 Number of splices: Total | 449355 Number of splices: Annotated (sjdb) | 440429 Number of splices: GT/AG | 442142 Number of splices: GC/AG | 6206 Number of splices: AT/AC | 395 Number of splices: Non-canonical | 612 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269827 % of reads mapped to multiple loci | 6.90% Number of reads mapped to too many loci | 66669 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 102947 102947 102947 N_multimapping 269827 269827 269827 N_noFeature 129338 3507523 145736 N_ambiguous 24772 49 10595 UnstrandedReadsAssigned:3383963 PositiveStrandReadsAssigned:30501 NegativeStrandReadsAssigned:3381742 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423582 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423582-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,910,847 reads, 3,566,127 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR5423582.ke.tsv 34699 SRR5423582.se.tsv 87100 total ==> SRR5423582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 273 44.8274 Potri.005G024800.1.v4.1 1035 936 143 48.1411 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 48.8012 5.407 Potri.016G087400.1.v4.1 270 171 149 274.565 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.8264 3.73203 Potri.012G127500.1.v4.1 977 878 2503 898.301 ==> SRR5423582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR5423582 completed mapping pipeline successfully