Starting /dee2/code/volunteer_pipeline.sh SRR5423583 current disk space = 3051331493888 free memory = 1579624704 SRR5423583 SRAfilesize 03976259d12e37b306fbd6a8399d71b4 SRR5423583.sra SRR5423583.sra file validated SRR5423583 is single end SRR5423583 is conventional basespace SRR5423583 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.581 34.0 31.0 34.0 28.0 34.0 2 31.729 34.0 31.0 34.0 28.0 34.0 3 32.6505 34.0 31.0 34.0 30.0 34.0 4 36.1555 37.0 35.0 37.0 35.0 37.0 5 36.102 37.0 35.0 37.0 35.0 37.0 6 36.255 37.0 37.0 37.0 35.0 37.0 7 36.267 37.0 37.0 37.0 35.0 37.0 8 36.17475 37.0 37.0 37.0 35.0 37.0 9 37.9525 39.0 38.0 39.0 35.0 39.0 10 37.9935 39.0 38.0 39.0 35.0 39.0 11 38.12125 39.0 38.0 39.0 37.0 39.0 12 38.07375 39.0 39.0 39.0 35.0 39.0 13 37.956 39.0 38.0 39.0 35.0 39.0 14 39.4315 41.0 39.0 41.0 36.0 41.0 15 39.46 41.0 39.0 41.0 36.0 41.0 16 39.4345 41.0 39.0 41.0 36.0 41.0 17 39.34925 41.0 39.0 41.0 36.0 41.0 18 39.43675 41.0 39.0 41.0 36.0 41.0 19 39.41325 41.0 39.0 41.0 36.0 41.0 20 39.3845 41.0 39.0 41.0 36.0 41.0 21 39.2575 41.0 39.0 41.0 36.0 41.0 22 39.40175 41.0 39.0 41.0 36.0 41.0 23 39.29425 41.0 39.0 41.0 36.0 41.0 24 39.28025 41.0 39.0 41.0 36.0 41.0 25 39.19125 41.0 39.0 41.0 36.0 41.0 26 39.18725 41.0 39.0 41.0 36.0 41.0 27 39.185 41.0 39.0 41.0 36.0 41.0 28 39.0825 40.0 39.0 41.0 36.0 41.0 29 39.05075 40.0 39.0 41.0 36.0 41.0 30 38.9965 40.0 39.0 41.0 36.0 41.0 31 39.044 40.0 39.0 41.0 36.0 41.0 32 38.92225 40.0 39.0 41.0 35.0 41.0 33 38.9685 40.0 39.0 41.0 35.0 41.0 34 38.7875 40.0 39.0 41.0 35.0 41.0 35 38.821 40.0 39.0 41.0 35.0 41.0 36 38.663 40.0 38.0 41.0 35.0 41.0 37 38.628 40.0 38.0 41.0 35.0 41.0 38 38.68975 40.0 38.0 41.0 35.0 41.0 39 38.581 40.0 38.0 41.0 34.0 41.0 40 38.417 40.0 38.0 41.0 34.0 41.0 41 38.36 40.0 38.0 41.0 34.0 41.0 42 38.3215 40.0 38.0 41.0 34.0 41.0 43 38.2055 40.0 38.0 41.0 34.0 41.0 44 38.15225 40.0 38.0 41.0 33.0 41.0 45 37.987 40.0 38.0 41.0 33.0 41.0 46 37.93975 40.0 38.0 41.0 33.0 41.0 47 37.90425 40.0 38.0 41.0 33.0 41.0 48 37.99225 40.0 38.0 41.0 33.0 41.0 49 37.864 40.0 38.0 41.0 33.0 41.0 50 37.80125 40.0 37.0 41.0 33.0 41.0 51 37.65925 40.0 37.0 41.0 32.0 41.0 52 36.11525 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 1.0 22 2.0 23 2.0 24 7.0 25 14.0 26 10.0 27 15.0 28 18.0 29 27.0 30 40.0 31 47.0 32 66.0 33 87.0 34 115.0 35 137.0 36 222.0 37 361.0 38 758.0 39 2054.0 40 12.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.84698275862069 10.183189655172415 7.650862068965517 43.31896551724138 2 21.75 15.75 35.15 27.35 3 22.475 18.575 22.75 36.199999999999996 4 23.549999999999997 25.224999999999998 21.525 29.7 5 23.849999999999998 31.775 23.799999999999997 20.575 6 19.175 32.15 25.224999999999998 23.45 7 15.299999999999999 23.825 41.199999999999996 19.675 8 16.900000000000002 22.775000000000002 31.6 28.725 9 18.6 20.875 33.725 26.8 10 18.3 36.0 24.95 20.75 11 23.375 27.35 22.15 27.125 12 22.725 23.549999999999997 25.95 27.775 13 20.275000000000002 26.650000000000002 28.749999999999996 24.325 14 20.25 26.474999999999998 28.275 25.0 15 21.3 24.55 27.474999999999998 26.674999999999997 16 21.45 26.05 26.650000000000002 25.85 17 19.900000000000002 25.724999999999998 28.1 26.275 18 19.400000000000002 25.874999999999996 28.175 26.55 19 21.0 25.75 27.474999999999998 25.775 20 20.65 26.200000000000003 27.525 25.624999999999996 21 22.35 26.150000000000002 25.05 26.450000000000003 22 21.175 25.624999999999996 27.425 25.775 23 20.3 25.775 27.500000000000004 26.424999999999997 24 20.075000000000003 25.525 27.675 26.724999999999998 25 20.775 25.575 26.75 26.900000000000002 26 20.549999999999997 26.0 26.6 26.85 27 20.474999999999998 24.375 27.224999999999998 27.925 28 20.65 27.025 26.575 25.75 29 20.025000000000002 26.224999999999998 27.450000000000003 26.3 30 20.1 25.424999999999997 28.15 26.325 31 21.825 26.400000000000002 25.5 26.275 32 21.5 25.85 27.025 25.624999999999996 33 21.15 24.75 26.450000000000003 27.650000000000002 34 20.45 26.900000000000002 26.724999999999998 25.924999999999997 35 21.075 24.85 27.224999999999998 26.85 36 22.05 26.150000000000002 25.35 26.450000000000003 37 21.125 25.624999999999996 26.625 26.625 38 20.9 26.8 26.450000000000003 25.85 39 22.05 25.2 26.1 26.650000000000002 40 21.85 26.05 25.7 26.400000000000002 41 20.849999999999998 25.924999999999997 27.35 25.874999999999996 42 22.25 25.0 26.35 26.400000000000002 43 20.125 27.425 26.5 25.95 44 21.45 25.5 26.575 26.474999999999998 45 20.599999999999998 25.624999999999996 27.125 26.650000000000002 46 21.175 26.150000000000002 27.250000000000004 25.424999999999997 47 21.075 24.75 27.3 26.875 48 20.925 25.05 26.450000000000003 27.575 49 21.0 25.474999999999998 26.150000000000002 27.375 50 21.55 24.425 27.200000000000003 26.825 51 21.375 24.099999999999998 26.625 27.900000000000002 52 21.55 26.5 25.650000000000002 26.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 1.5 19 0.0 20 1.5 21 3.0 22 4.0 23 5.0 24 10.5 25 16.0 26 15.0 27 14.0 28 21.5 29 29.0 30 32.5 31 36.0 32 52.0 33 68.0 34 85.0 35 102.0 36 126.0 37 150.0 38 162.0 39 204.5 40 235.0 41 267.0 42 299.0 43 329.5 44 360.0 45 358.5 46 357.0 47 366.5 48 376.0 49 381.5 50 387.0 51 369.5 52 352.0 53 314.0 54 276.0 55 262.0 56 248.0 57 204.0 58 160.0 59 138.0 60 116.0 61 99.5 62 83.0 63 69.5 64 47.5 65 39.0 66 27.0 67 15.0 68 15.0 69 15.0 70 11.0 71 7.0 72 6.5 73 6.0 74 5.0 75 4.0 76 3.5 77 3.0 78 2.0 79 1.0 80 1.5 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.199999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra Read 200000 spots for SRR5423583.sra Written 200000 spots for SRR5423583.sra SRR ids: ['SRR5423583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_caccz2gb SRR5423583.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423583 file size 703979 SRR5423583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423583 SRR5423583_1.fastq Input file: SRR5423583_1.fastq trimmed: SRR5423583-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 18:14:13 2025 >> started Wed Feb 12 18:14:15 2025 >> done (1.975s) 4000000 reads processed; of these: 188 ( 0.00%) short reads filtered out after trimming by size control 601 ( 0.02%) empty reads filtered out after trimming by size control 3999211 (99.98%) reads available; of these: 56425 ( 1.41%) trimmed reads available after processing 3942786 (98.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 7 0.00% 26 6 0.00% 27 5 0.00% 28 7 0.00% 29 6 0.00% 30 12 0.00% 31 14 0.00% 32 16 0.00% 33 29 0.00% 34 28 0.00% 35 18 0.00% 36 39 0.00% 37 28 0.00% 38 59 0.00% 39 66 0.00% 40 64 0.00% 41 104 0.00% 42 103 0.00% 43 169 0.00% 44 206 0.01% 45 311 0.01% 46 430 0.01% 47 663 0.02% 48 1084 0.03% 49 2197 0.05% 50 6128 0.15% 51 44601 1.12% 52 3942786 98.59% 3999211 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=22 prefix-density=0.21 prefix-fanout=1.9 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=56.02 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=8.8 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 12 18:14:29 Started mapping on | Feb 12 18:14:30 Finished on | Feb 12 18:14:34 Mapping speed, Million of reads per hour | 3599.29 Number of input reads | 3999211 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3649350 Uniquely mapped reads % | 91.25% Average mapped length | 51.81 Number of splices: Total | 463705 Number of splices: Annotated (sjdb) | 453917 Number of splices: GT/AG | 456253 Number of splices: GC/AG | 6367 Number of splices: AT/AC | 435 Number of splices: Non-canonical | 650 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244299 % of reads mapped to multiple loci | 6.11% Number of reads mapped to too many loci | 76415 % of reads mapped to too many loci | 1.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105562 105562 105562 N_multimapping 244299 244299 244299 N_noFeature 142604 3619623 158737 N_ambiguous 24510 38 10899 UnstrandedReadsAssigned:3482236 PositiveStrandReadsAssigned:29689 NegativeStrandReadsAssigned:3479714 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423583 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423583-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,211 reads, 3,648,183 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR5423583.ke.tsv 34699 SRR5423583.se.tsv 87100 total ==> SRR5423583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 298 48.926 Potri.005G024800.1.v4.1 1035 936 89 29.958 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.4485 7.69364 Potri.016G087400.1.v4.1 270 171 108 198.988 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14 2.63494 Potri.012G127500.1.v4.1 977 878 2769 993.636 ==> SRR5423583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR5423583 completed mapping pipeline successfully