Starting /dee2/code/volunteer_pipeline.sh SRR5423584 current disk space = 3089193873408 free memory = 1432473700 SRR5423584 SRAfilesize 1b69a743e9729122b03db69f62c821b9 SRR5423584.sra SRR5423584.sra file validated SRR5423584 is single end SRR5423584 is conventional basespace SRR5423584 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4865 31.0 31.0 34.0 30.0 34.0 2 31.78625 33.0 31.0 34.0 30.0 34.0 3 31.96925 34.0 31.0 34.0 30.0 34.0 4 33.24575 37.0 33.0 37.0 25.0 37.0 5 34.8495 37.0 35.0 37.0 32.0 37.0 6 35.27725 37.0 35.0 37.0 32.0 37.0 7 35.46275 37.0 35.0 37.0 33.0 37.0 8 35.678 37.0 35.0 37.0 33.0 37.0 9 37.4505 39.0 37.0 39.0 34.0 39.0 10 37.12925 39.0 37.0 39.0 33.0 39.0 11 37.2185 39.0 37.0 39.0 33.0 39.0 12 37.2305 39.0 37.0 39.0 34.0 39.0 13 37.2805 39.0 37.0 39.0 34.0 39.0 14 38.60275 40.0 38.0 41.0 34.0 41.0 15 38.29575 40.0 38.0 41.0 33.0 41.0 16 38.339 40.0 38.0 41.0 33.0 41.0 17 38.45575 40.0 38.0 41.0 34.0 41.0 18 38.51375 40.0 38.0 41.0 34.0 41.0 19 38.291 40.0 38.0 41.0 33.0 41.0 20 38.40975 40.0 38.0 41.0 34.0 41.0 21 38.44975 40.0 38.0 41.0 34.0 41.0 22 38.47175 40.0 38.0 41.0 34.0 41.0 23 38.4815 40.0 38.0 41.0 34.0 41.0 24 38.48175 40.0 38.0 41.0 34.0 41.0 25 38.53425 40.0 38.0 41.0 34.0 41.0 26 38.19575 40.0 38.0 41.0 33.0 41.0 27 38.3545 40.0 38.0 41.0 34.0 41.0 28 38.349 40.0 38.0 41.0 34.0 41.0 29 38.28425 40.0 38.0 41.0 34.0 41.0 30 38.39175 40.0 38.0 41.0 34.0 41.0 31 38.229 40.0 38.0 41.0 34.0 41.0 32 38.20475 40.0 38.0 41.0 33.0 41.0 33 38.085 40.0 38.0 41.0 33.0 41.0 34 38.1905 40.0 38.0 41.0 33.0 41.0 35 38.135 40.0 38.0 41.0 33.0 41.0 36 38.1765 40.0 38.0 41.0 34.0 41.0 37 38.14525 40.0 38.0 41.0 33.0 41.0 38 38.05875 40.0 38.0 41.0 33.0 41.0 39 37.9145 40.0 37.0 41.0 33.0 41.0 40 37.8605 40.0 37.0 41.0 32.0 41.0 41 37.88625 40.0 37.0 41.0 33.0 41.0 42 37.97925 40.0 37.0 41.0 33.0 41.0 43 37.85975 40.0 37.0 41.0 33.0 41.0 44 37.824 40.0 37.0 41.0 33.0 41.0 45 37.612 40.0 37.0 41.0 32.0 41.0 46 37.556 40.0 37.0 41.0 32.0 41.0 47 37.554 40.0 37.0 41.0 32.0 41.0 48 37.553 40.0 37.0 41.0 32.0 41.0 49 37.41175 40.0 36.0 41.0 32.0 41.0 50 37.40025 39.0 36.0 41.0 31.0 41.0 51 37.58275 40.0 36.0 41.0 32.0 41.0 52 36.7095 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1115 1 0.0 1115 2 0.0 1115 3 0.0 1115 4 0.0 1115 5 0.0 1115 6 0.0 1115 7 0.0 1115 8 0.0 1115 9 0.0 1115 10 0.0 1115 11 0.0 1115 12 0.0 1115 13 0.0 1115 14 0.0 1115 15 0.0 1115 16 0.0 1115 17 0.0 1115 18 0.0 1115 19 0.0 1115 20 0.0 1115 21 0.0 1115 22 0.0 1115 23 0.0 1115 24 0.0 1115 25 0.0 1115 26 0.0 1115 27 0.0 1115 28 0.0 1115 29 0.0 1115 30 0.0 1115 31 0.0 1115 32 0.0 1115 33 0.0 1115 34 0.0 1115 35 0.0 1115 36 0.0 1115 37 0.0 1115 38 0.0 1115 39 0.0 1115 40 0.0 1115 41 0.0 1115 42 0.0 1115 43 0.0 1115 44 0.0 1115 45 0.0 1115 46 0.0 1115 47 0.0 1115 48 0.0 1115 49 0.0 1115 50 0.0 1115 51 0.0 1115 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 4.0 23 3.0 24 6.0 25 10.0 26 15.0 27 15.0 28 37.0 29 32.0 30 57.0 31 90.0 32 121.0 33 135.0 34 160.0 35 224.0 36 332.0 37 472.0 38 785.0 39 1491.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.08794788273616 10.699072914056627 7.541969431220245 42.671009771986974 2 21.725 14.549999999999999 35.5 28.225 3 20.75 18.05 25.124999999999996 36.075 4 23.925 26.200000000000003 23.425 26.450000000000003 5 23.75 31.175000000000004 24.224999999999998 20.849999999999998 6 19.675 32.725 24.125 23.474999999999998 7 15.5 23.375 41.675000000000004 19.45 8 17.0 22.875 32.275 27.85 9 17.325 21.075 34.449999999999996 27.150000000000002 10 19.375 36.225 24.075 20.325 11 22.975 25.775 23.375 27.875 12 21.349999999999998 24.025 27.450000000000003 27.175 13 19.275000000000002 26.85 28.749999999999996 25.124999999999996 14 19.825 26.325 28.175 25.674999999999997 15 21.15 25.15 27.500000000000004 26.200000000000003 16 21.275 26.525 26.700000000000003 25.5 17 21.25 26.0 26.924999999999997 25.825 18 20.549999999999997 25.874999999999996 26.75 26.825 19 20.9 26.5 27.200000000000003 25.4 20 21.075 26.75 26.1 26.075 21 20.349999999999998 26.85 27.400000000000002 25.4 22 22.45 25.074999999999996 26.974999999999998 25.5 23 20.075000000000003 26.0 27.750000000000004 26.174999999999997 24 20.525 25.35 27.05 27.075 25 20.275000000000002 25.8 26.974999999999998 26.950000000000003 26 20.575 25.525 27.55 26.35 27 20.225 25.75 26.875 27.150000000000002 28 21.075 26.05 26.5 26.375 29 21.025 24.65 26.075 28.249999999999996 30 19.75 25.4 27.55 27.3 31 21.05 27.875 27.05 24.025 32 21.5 24.55 28.799999999999997 25.15 33 20.625 25.224999999999998 26.625 27.525 34 21.525 25.174999999999997 27.700000000000003 25.6 35 20.75 25.15 28.025 26.075 36 20.45 24.85 27.875 26.825 37 20.974999999999998 26.8 26.25 25.974999999999998 38 20.3 25.5 27.700000000000003 26.5 39 20.575 24.95 26.424999999999997 28.050000000000004 40 20.025000000000002 26.450000000000003 26.55 26.974999999999998 41 21.6 24.525 27.725 26.150000000000002 42 20.3 24.95 27.525 27.224999999999998 43 21.125 25.7 25.724999999999998 27.450000000000003 44 21.099999999999998 25.074999999999996 27.950000000000003 25.874999999999996 45 20.575 25.174999999999997 26.325 27.925 46 21.25 24.975 26.3 27.474999999999998 47 21.275 25.05 27.325 26.35 48 21.05 24.125 27.0 27.825 49 20.674999999999997 25.6 26.650000000000002 27.075 50 20.9 23.849999999999998 27.275 27.975 51 20.375 24.675 26.700000000000003 28.249999999999996 52 19.425 27.325 26.674999999999997 26.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 4.5 21 7.0 22 9.0 23 11.0 24 8.5 25 6.0 26 10.5 27 15.0 28 18.5 29 22.0 30 33.0 31 44.0 32 58.5 33 73.0 34 85.0 35 97.0 36 116.5 37 136.0 38 163.0 39 226.0 40 262.0 41 270.5 42 279.0 43 314.0 44 349.0 45 352.5 46 356.0 47 364.5 48 373.0 49 389.0 50 405.0 51 372.0 52 339.0 53 320.5 54 302.0 55 252.5 56 203.0 57 182.0 58 161.0 59 149.0 60 137.0 61 117.0 62 97.0 63 72.0 64 39.5 65 32.0 66 26.0 67 20.0 68 20.0 69 20.0 70 12.5 71 5.0 72 5.0 73 5.0 74 3.0 75 1.0 76 1.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09067946451124 98.075 2 0.8082849204344532 1.6 3 0.07577671129072998 0.22499999999999998 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.025 0.0 0.0 0.0 24 0.0 0.025 0.0 0.0 0.0 25 0.0 0.025 0.0 0.0 0.0 26 0.0 0.025 0.0 0.0 0.0 27 0.0 0.025 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra Read 200000 spots for SRR5423584.sra Written 200000 spots for SRR5423584.sra SRR ids: ['SRR5423584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__06nrfry SRR5423584.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423584 file size 703975 SRR5423584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423584 SRR5423584_1.fastq Input file: SRR5423584_1.fastq trimmed: SRR5423584-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:04:50 2025 >> started Thu Feb 13 15:04:52 2025 >> done (1.840s) 4000000 reads processed; of these: 208 ( 0.01%) short reads filtered out after trimming by size control 740 ( 0.02%) empty reads filtered out after trimming by size control 3999052 (99.98%) reads available; of these: 57521 ( 1.44%) trimmed reads available after processing 3941531 (98.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 11 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 7 0.00% 28 1 0.00% 29 12 0.00% 30 10 0.00% 31 18 0.00% 32 27 0.00% 33 32 0.00% 34 30 0.00% 35 29 0.00% 36 25 0.00% 37 51 0.00% 38 63 0.00% 39 66 0.00% 40 77 0.00% 41 93 0.00% 42 118 0.00% 43 183 0.00% 44 237 0.01% 45 332 0.01% 46 462 0.01% 47 783 0.02% 48 1139 0.03% 49 2329 0.06% 50 6603 0.17% 51 44754 1.12% 52 3941531 98.56% 3999052 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=1.0 sequence=TACCCACCTTGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=53.09 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=8.7 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:05:04 Started mapping on | Feb 13 15:05:05 Finished on | Feb 13 15:05:09 Mapping speed, Million of reads per hour | 3599.15 Number of input reads | 3999052 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650475 Uniquely mapped reads % | 91.28% Average mapped length | 51.81 Number of splices: Total | 463283 Number of splices: Annotated (sjdb) | 453435 Number of splices: GT/AG | 455801 Number of splices: GC/AG | 6453 Number of splices: AT/AC | 430 Number of splices: Non-canonical | 599 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243924 % of reads mapped to multiple loci | 6.10% Number of reads mapped to too many loci | 75259 % of reads mapped to too many loci | 1.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104653 104653 104653 N_multimapping 243924 243924 243924 N_noFeature 143063 3620806 159289 N_ambiguous 24419 53 10947 UnstrandedReadsAssigned:3482993 PositiveStrandReadsAssigned:29616 NegativeStrandReadsAssigned:3480239 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423584 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423584-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,052 reads, 3,648,367 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR5423584.ke.tsv 34699 SRR5423584.se.tsv 87100 total ==> SRR5423584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 286.659 47.0638 Potri.005G024800.1.v4.1 1035 936 78 26.2552 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.2184 6.33873 Potri.016G087400.1.v4.1 270 171 110 202.672 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22.5171 4.23792 Potri.012G127500.1.v4.1 977 878 2689 964.923 ==> SRR5423584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 95 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR5423584 completed mapping pipeline successfully