Starting /dee2/code/volunteer_pipeline.sh SRR5423585 current disk space = 3089111744512 free memory = 1448028428 SRR5423585 SRAfilesize 642cf72283ef65b62f18009abbaec033 SRR5423585.sra SRR5423585.sra file validated SRR5423585 is single end SRR5423585 is conventional basespace SRR5423585 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4445 31.0 31.0 34.0 28.0 34.0 2 31.88225 33.0 31.0 34.0 30.0 34.0 3 32.09675 33.0 31.0 34.0 30.0 34.0 4 32.0025 35.0 30.0 37.0 19.0 37.0 5 34.4375 35.0 35.0 37.0 28.0 37.0 6 35.18075 37.0 35.0 37.0 32.0 37.0 7 35.493 37.0 35.0 37.0 33.0 37.0 8 35.66475 37.0 35.0 37.0 33.0 37.0 9 37.52125 39.0 37.0 39.0 35.0 39.0 10 37.29425 39.0 37.0 39.0 34.0 39.0 11 37.4595 39.0 37.0 39.0 34.0 39.0 12 37.37325 39.0 37.0 39.0 34.0 39.0 13 37.30275 39.0 37.0 39.0 34.0 39.0 14 38.49175 40.0 38.0 41.0 34.0 41.0 15 38.60625 40.0 38.0 41.0 34.0 41.0 16 38.63175 40.0 38.0 41.0 34.0 41.0 17 38.68175 40.0 38.0 41.0 34.0 41.0 18 38.599 40.0 38.0 41.0 34.0 41.0 19 38.73125 40.0 38.0 41.0 34.0 41.0 20 38.657 40.0 38.0 41.0 34.0 41.0 21 38.70775 40.0 38.0 41.0 34.0 41.0 22 38.584 40.0 38.0 41.0 34.0 41.0 23 38.4955 40.0 38.0 41.0 34.0 41.0 24 38.56375 40.0 38.0 41.0 34.0 41.0 25 38.6645 40.0 38.0 41.0 34.0 41.0 26 38.4295 40.0 38.0 41.0 34.0 41.0 27 38.53675 40.0 38.0 41.0 34.0 41.0 28 38.55625 40.0 38.0 41.0 34.0 41.0 29 38.4105 40.0 38.0 41.0 34.0 41.0 30 38.504 40.0 38.0 41.0 34.0 41.0 31 38.56225 40.0 38.0 41.0 34.0 41.0 32 38.4395 40.0 38.0 41.0 34.0 41.0 33 38.44325 40.0 38.0 41.0 34.0 41.0 34 38.41475 40.0 38.0 41.0 34.0 41.0 35 38.332 40.0 38.0 41.0 34.0 41.0 36 38.429 40.0 38.0 41.0 34.0 41.0 37 38.15525 40.0 38.0 41.0 33.0 41.0 38 37.99825 40.0 37.0 41.0 33.0 41.0 39 37.98425 40.0 37.0 41.0 33.0 41.0 40 38.01075 40.0 37.0 41.0 33.0 41.0 41 37.89425 40.0 37.0 41.0 33.0 41.0 42 37.8855 40.0 37.0 41.0 33.0 41.0 43 37.96975 40.0 37.0 41.0 33.0 41.0 44 37.83 40.0 37.0 41.0 32.0 41.0 45 37.68425 40.0 37.0 41.0 33.0 41.0 46 37.873 40.0 37.0 41.0 33.0 41.0 47 37.545 40.0 37.0 41.0 32.0 41.0 48 37.411 40.0 37.0 41.0 31.0 41.0 49 37.56225 40.0 37.0 41.0 31.0 41.0 50 37.47975 40.0 36.0 41.0 32.0 41.0 51 37.50675 40.0 36.0 41.0 32.0 41.0 52 36.694 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1213 1 0.0 1213 2 0.0 1213 3 0.0 1213 4 0.0 1213 5 0.0 1213 6 0.0 1213 7 0.0 1213 8 0.0 1213 9 0.0 1213 10 0.0 1213 11 0.0 1213 12 0.0 1213 13 0.0 1213 14 0.0 1213 15 0.0 1213 16 0.0 1213 17 0.0 1213 18 0.0 1213 19 0.0 1213 20 0.0 1213 21 0.0 1213 22 0.0 1213 23 0.0 1213 24 0.0 1213 25 0.0 1213 26 0.0 1213 27 0.0 1213 28 0.0 1213 29 0.0 1213 30 0.0 1213 31 0.0 1213 32 0.0 1213 33 0.0 1213 34 0.0 1213 35 0.0 1213 36 0.0 1213 37 0.0 1213 38 0.0 1213 39 0.0 1213 40 0.0 1213 41 0.0 1213 42 0.0 1213 43 0.0 1213 44 0.0 1213 45 0.0 1213 46 0.0 1213 47 0.0 1213 48 0.0 1213 49 0.0 1213 50 0.0 1213 51 0.0 1213 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 1.0 23 3.0 24 6.0 25 7.0 26 10.0 27 12.0 28 24.0 29 41.0 30 57.0 31 81.0 32 115.0 33 141.0 34 159.0 35 221.0 36 348.0 37 455.0 38 731.0 39 1572.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.58758758758759 11.811811811811811 7.482482482482483 43.11811811811812 2 22.375 15.85 34.425 27.35 3 21.625 18.7 24.0 35.675000000000004 4 24.125 24.325 25.074999999999996 26.474999999999998 5 24.125 30.65 23.599999999999998 21.625 6 18.8 32.725 25.05 23.425 7 14.325 22.225 43.65 19.8 8 16.925 22.525000000000002 31.775 28.775000000000002 9 18.0 20.0 34.2 27.800000000000004 10 18.224999999999998 35.975 25.1 20.7 11 22.675 27.35 22.775000000000002 27.200000000000003 12 21.65 22.25 28.425 27.675 13 19.35 26.325 28.000000000000004 26.325 14 19.725 26.8 28.499999999999996 24.975 15 20.325 25.624999999999996 27.400000000000002 26.650000000000002 16 20.349999999999998 25.75 28.15 25.75 17 20.349999999999998 26.375 27.05 26.224999999999998 18 19.875 26.325 26.825 26.974999999999998 19 20.65 27.275 26.375 25.7 20 20.200000000000003 26.700000000000003 27.575 25.525 21 20.974999999999998 25.525 26.825 26.674999999999997 22 20.349999999999998 26.55 27.975 25.124999999999996 23 21.825 26.3 26.674999999999997 25.2 24 19.475 26.174999999999997 27.450000000000003 26.900000000000002 25 20.325 25.424999999999997 27.625 26.625 26 20.599999999999998 26.375 27.125 25.900000000000002 27 20.625 25.825 26.375 27.175 28 20.275000000000002 27.05 27.175 25.5 29 20.875 26.400000000000002 27.775 24.95 30 20.225 25.95 27.175 26.650000000000002 31 21.075 25.75 25.974999999999998 27.200000000000003 32 19.900000000000002 26.150000000000002 27.525 26.424999999999997 33 20.075000000000003 24.9 27.650000000000002 27.375 34 21.224999999999998 25.6 26.575 26.6 35 20.825 26.05 26.825 26.3 36 20.150000000000002 25.874999999999996 27.175 26.8 37 22.25 26.525 25.575 25.650000000000002 38 21.099999999999998 26.724999999999998 26.950000000000003 25.224999999999998 39 21.15 24.45 27.625 26.775 40 21.275 25.4 27.025 26.3 41 21.3 25.025 27.900000000000002 25.775 42 21.025 24.349999999999998 27.55 27.075 43 20.474999999999998 26.05 26.55 26.924999999999997 44 20.65 26.200000000000003 27.675 25.474999999999998 45 21.275 26.700000000000003 26.0 26.025 46 20.325 27.125 25.825 26.724999999999998 47 21.7 24.075 26.700000000000003 27.525 48 21.330332583145786 24.981245311327832 26.93173293323331 26.756689172293076 49 22.55563890972743 25.6064016004001 26.506626656664167 25.331332833208304 50 20.25 25.75 26.3 27.700000000000003 51 19.854963740935233 24.85621405351338 26.65666416604151 28.632158039509875 52 21.10527631907977 25.156289072268066 27.581895473868467 26.156539134783696 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 4.0 23 6.0 24 6.0 25 6.0 26 13.5 27 21.0 28 26.5 29 32.0 30 39.0 31 46.0 32 69.0 33 92.0 34 114.5 35 137.0 36 138.0 37 139.0 38 163.0 39 207.0 40 227.0 41 262.0 42 297.0 43 321.0 44 345.0 45 339.5 46 334.0 47 352.0 48 370.0 49 375.5 50 381.0 51 365.0 52 349.0 53 319.5 54 290.0 55 257.0 56 224.0 57 198.5 58 173.0 59 147.0 60 121.0 61 98.5 62 76.0 63 63.5 64 41.0 65 31.0 66 28.5 67 26.0 68 19.0 69 12.0 70 9.0 71 6.0 72 7.0 73 8.0 74 6.0 75 4.0 76 3.0 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.0 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra Read 200000 spots for SRR5423585.sra Written 200000 spots for SRR5423585.sra SRR ids: ['SRR5423585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yn5kmupi SRR5423585.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423585 file size 704006 SRR5423585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423585 SRR5423585_1.fastq Input file: SRR5423585_1.fastq trimmed: SRR5423585-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:12:53 2025 >> started Thu Feb 13 15:12:55 2025 >> done (2.064s) 4000000 reads processed; of these: 195 ( 0.00%) short reads filtered out after trimming by size control 683 ( 0.02%) empty reads filtered out after trimming by size control 3999122 (99.98%) reads available; of these: 53411 ( 1.34%) trimmed reads available after processing 3945711 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 13 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 6 0.00% 28 9 0.00% 29 17 0.00% 30 11 0.00% 31 15 0.00% 32 18 0.00% 33 21 0.00% 34 17 0.00% 35 31 0.00% 36 35 0.00% 37 35 0.00% 38 49 0.00% 39 57 0.00% 40 63 0.00% 41 104 0.00% 42 130 0.00% 43 136 0.00% 44 205 0.01% 45 292 0.01% 46 476 0.01% 47 595 0.01% 48 1067 0.03% 49 2122 0.05% 50 5930 0.15% 51 41928 1.05% 52 3945711 98.66% 3999122 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=1.9 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=54.34 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=8.8 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:13:07 Started mapping on | Feb 13 15:13:07 Finished on | Feb 13 15:13:14 Mapping speed, Million of reads per hour | 2056.69 Number of input reads | 3999122 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650198 Uniquely mapped reads % | 91.27% Average mapped length | 51.81 Number of splices: Total | 463818 Number of splices: Annotated (sjdb) | 453859 Number of splices: GT/AG | 456221 Number of splices: GC/AG | 6524 Number of splices: AT/AC | 430 Number of splices: Non-canonical | 643 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243875 % of reads mapped to multiple loci | 6.10% Number of reads mapped to too many loci | 75823 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105049 105049 105049 N_multimapping 243875 243875 243875 N_noFeature 143101 3620635 159103 N_ambiguous 24648 52 11060 UnstrandedReadsAssigned:3482449 PositiveStrandReadsAssigned:29511 NegativeStrandReadsAssigned:3480035 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423585 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423585-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,122 reads, 3,649,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR5423585.ke.tsv 34699 SRR5423585.se.tsv 87100 total ==> SRR5423585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 302 49.5495 Potri.005G024800.1.v4.1 1035 936 78 26.2377 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 76.2485 8.4413 Potri.016G087400.1.v4.1 270 171 97 178.601 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20.7145 3.89606 Potri.012G127500.1.v4.1 977 878 2700 968.226 ==> SRR5423585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 110 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR5423585 completed mapping pipeline successfully