Starting /dee2/code/volunteer_pipeline.sh SRR5423586 current disk space = 3089297514496 free memory = 1443044476 SRR5423586 SRAfilesize 6a4f659eb5e2eba0da72850f32c68d6d SRR5423586.sra SRR5423586.sra file validated SRR5423586 is single end SRR5423586 is conventional basespace SRR5423586 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9745 33.0 31.0 34.0 30.0 34.0 2 32.2635 34.0 31.0 34.0 30.0 34.0 3 32.13525 34.0 31.0 34.0 30.0 34.0 4 35.03025 37.0 35.0 37.0 32.0 37.0 5 35.6455 37.0 35.0 37.0 33.0 37.0 6 35.822 37.0 35.0 37.0 35.0 37.0 7 35.88225 37.0 35.0 37.0 35.0 37.0 8 35.961 37.0 35.0 37.0 35.0 37.0 9 37.65425 39.0 37.0 39.0 35.0 39.0 10 37.5425 39.0 37.0 39.0 35.0 39.0 11 37.53375 39.0 37.0 39.0 35.0 39.0 12 37.52425 39.0 37.0 39.0 35.0 39.0 13 37.5175 39.0 37.0 39.0 35.0 39.0 14 38.80525 40.0 38.0 41.0 35.0 41.0 15 38.847 40.0 38.0 41.0 35.0 41.0 16 38.75575 40.0 38.0 41.0 34.0 41.0 17 38.69975 40.0 38.0 41.0 34.0 41.0 18 38.774 40.0 38.0 41.0 34.0 41.0 19 38.693 40.0 38.0 41.0 34.0 41.0 20 38.71725 40.0 38.0 41.0 34.0 41.0 21 38.72225 40.0 38.0 41.0 34.0 41.0 22 38.6525 40.0 38.0 41.0 34.0 41.0 23 38.84675 40.0 38.0 41.0 35.0 41.0 24 38.75525 40.0 38.0 41.0 35.0 41.0 25 38.779 40.0 38.0 41.0 35.0 41.0 26 38.75825 40.0 38.0 41.0 35.0 41.0 27 38.6905 40.0 38.0 41.0 34.0 41.0 28 38.6935 40.0 38.0 41.0 34.0 41.0 29 38.56075 40.0 38.0 41.0 34.0 41.0 30 38.6755 40.0 38.0 41.0 34.0 41.0 31 38.6585 40.0 38.0 41.0 34.0 41.0 32 38.4245 40.0 38.0 41.0 34.0 41.0 33 38.474 40.0 38.0 41.0 34.0 41.0 34 38.57925 40.0 38.0 41.0 35.0 41.0 35 38.4755 40.0 38.0 41.0 34.0 41.0 36 38.47775 40.0 38.0 41.0 34.0 41.0 37 38.4415 40.0 38.0 41.0 34.0 41.0 38 38.3045 40.0 38.0 41.0 34.0 41.0 39 38.2485 40.0 38.0 41.0 33.0 41.0 40 38.39375 40.0 38.0 41.0 34.0 41.0 41 38.1635 40.0 38.0 41.0 33.0 41.0 42 38.04225 40.0 38.0 41.0 33.0 41.0 43 38.12275 40.0 38.0 41.0 33.0 41.0 44 38.11875 40.0 37.0 41.0 33.0 41.0 45 37.9455 40.0 37.0 41.0 33.0 41.0 46 37.86325 40.0 37.0 41.0 33.0 41.0 47 37.9525 40.0 37.0 41.0 33.0 41.0 48 37.8935 40.0 37.0 41.0 33.0 41.0 49 37.89325 40.0 37.0 41.0 33.0 41.0 50 37.7815 40.0 37.0 41.0 33.0 41.0 51 37.6455 40.0 37.0 41.0 32.0 41.0 52 36.80875 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1311 1 0.0 1311 2 0.0 1311 3 0.0 1311 4 0.0 1311 5 0.0 1311 6 0.0 1311 7 0.0 1311 8 0.0 1311 9 0.0 1311 10 0.0 1311 11 0.0 1311 12 0.0 1311 13 0.0 1311 14 0.0 1311 15 0.0 1311 16 0.0 1311 17 0.0 1311 18 0.0 1311 19 0.0 1311 20 0.0 1311 21 0.0 1311 22 0.0 1311 23 0.0 1311 24 0.0 1311 25 0.0 1311 26 0.0 1311 27 0.0 1311 28 0.0 1311 29 0.0 1311 30 0.0 1311 31 0.0 1311 32 0.0 1311 33 0.0 1311 34 0.0 1311 35 0.0 1311 36 0.0 1311 37 0.0 1311 38 0.0 1311 39 0.0 1311 40 0.0 1311 41 0.0 1311 42 0.0 1311 43 0.0 1311 44 0.0 1311 45 0.0 1311 46 0.0 1311 47 0.0 1311 48 0.0 1311 49 0.0 1311 50 0.0 1311 51 0.0 1311 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 6.0 25 7.0 26 14.0 27 13.0 28 28.0 29 37.0 30 49.0 31 62.0 32 96.0 33 109.0 34 141.0 35 204.0 36 258.0 37 408.0 38 740.0 39 1815.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.041572752316554 11.49511645379414 7.7134986225895315 42.74981217129977 2 23.1 15.0 35.4 26.5 3 22.275 17.849999999999998 25.224999999999998 34.65 4 24.9 26.200000000000003 23.35 25.55 5 25.85 29.75 24.25 20.150000000000002 6 18.7 32.550000000000004 24.025 24.725 7 14.35 22.6 43.45 19.6 8 17.549999999999997 21.825 32.300000000000004 28.325 9 19.425 21.575 34.699999999999996 24.3 10 19.225 35.0 25.374999999999996 20.4 11 23.875 25.825 22.425 27.875 12 21.025 24.575 27.05 27.35 13 19.950000000000003 26.35 28.825 24.875 14 20.225 26.1 27.525 26.150000000000002 15 20.549999999999997 25.8 28.249999999999996 25.4 16 20.375 25.275 28.275 26.075 17 20.200000000000003 25.224999999999998 28.675 25.900000000000002 18 19.875 27.450000000000003 26.575 26.1 19 21.0 27.250000000000004 26.450000000000003 25.3 20 21.475 26.924999999999997 26.75 24.85 21 21.625 25.924999999999997 27.474999999999998 24.975 22 21.25 25.5 26.674999999999997 26.575 23 20.549999999999997 25.650000000000002 27.1 26.700000000000003 24 22.45 25.324999999999996 26.325 25.900000000000002 25 19.775000000000002 25.55 27.950000000000003 26.724999999999998 26 20.424999999999997 27.500000000000004 26.450000000000003 25.624999999999996 27 20.275000000000002 26.900000000000002 27.075 25.75 28 19.875 26.674999999999997 27.725 25.724999999999998 29 20.275000000000002 25.924999999999997 28.549999999999997 25.25 30 20.25 25.25 27.775 26.724999999999998 31 20.325 25.874999999999996 26.55 27.250000000000004 32 20.9 24.55 28.1 26.450000000000003 33 21.075 25.4 27.175 26.35 34 20.75 25.974999999999998 26.974999999999998 26.3 35 19.825 24.775 29.049999999999997 26.35 36 20.599999999999998 25.75 27.725 25.924999999999997 37 20.674999999999997 25.275 27.650000000000002 26.400000000000002 38 21.025 25.85 26.150000000000002 26.974999999999998 39 20.775 25.575 27.6 26.05 40 21.525 25.45 26.825 26.200000000000003 41 20.825 25.8 26.775 26.6 42 18.975 26.974999999999998 27.400000000000002 26.650000000000002 43 22.355588897224308 25.18129532383096 26.531632908227053 25.93148287071768 44 20.599999999999998 25.074999999999996 27.075 27.250000000000004 45 21.65 24.45 27.575 26.325 46 20.424999999999997 25.974999999999998 27.075 26.525 47 21.180295073768445 25.581395348837212 27.33183295823956 25.906476619154787 48 20.335167583791897 25.11255627813907 28.114057028514257 26.43821910955478 49 20.25 26.35 26.950000000000003 26.450000000000003 50 21.75543885971493 24.831207801950487 27.106776694173547 26.30657664416104 51 20.9 26.3 27.125 25.674999999999997 52 21.4 26.150000000000002 27.800000000000004 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 3.0 21 6.0 22 5.5 23 5.0 24 8.0 25 11.0 26 15.0 27 19.0 28 21.0 29 23.0 30 37.0 31 51.0 32 72.0 33 93.0 34 98.5 35 104.0 36 136.5 37 169.0 38 185.0 39 219.0 40 237.0 41 266.0 42 295.0 43 307.5 44 320.0 45 344.5 46 369.0 47 365.5 48 362.0 49 381.0 50 400.0 51 387.5 52 375.0 53 326.0 54 277.0 55 253.0 56 229.0 57 185.5 58 142.0 59 119.0 60 96.0 61 90.5 62 85.0 63 69.0 64 41.0 65 29.0 66 23.0 67 17.0 68 13.0 69 9.0 70 8.5 71 8.0 72 8.0 73 8.0 74 5.5 75 3.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.0 47 0.025 48 0.05 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.605296343001261 1.2 3 0.1008827238335435 0.3 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra Read 200000 spots for SRR5423586.sra Written 200000 spots for SRR5423586.sra SRR ids: ['SRR5423586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__jllk02q SRR5423586.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423586 file size 703945 SRR5423586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423586 SRR5423586_1.fastq Input file: SRR5423586_1.fastq trimmed: SRR5423586-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:55:19 2025 >> started Thu Feb 13 14:55:21 2025 >> done (2.777s) 4000000 reads processed; of these: 202 ( 0.01%) short reads filtered out after trimming by size control 634 ( 0.02%) empty reads filtered out after trimming by size control 3999164 (99.98%) reads available; of these: 55156 ( 1.38%) trimmed reads available after processing 3944008 (98.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 6 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 6 0.00% 27 5 0.00% 28 3 0.00% 29 12 0.00% 30 10 0.00% 31 15 0.00% 32 20 0.00% 33 24 0.00% 34 32 0.00% 35 28 0.00% 36 35 0.00% 37 52 0.00% 38 40 0.00% 39 66 0.00% 40 83 0.00% 41 103 0.00% 42 103 0.00% 43 156 0.00% 44 250 0.01% 45 338 0.01% 46 474 0.01% 47 645 0.02% 48 1118 0.03% 49 2222 0.06% 50 6242 0.16% 51 43042 1.08% 52 3944008 98.62% 3999164 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=14 prefix-density=0.24 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=54.92 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=8.7 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 14:55:33 Started mapping on | Feb 13 14:55:34 Finished on | Feb 13 14:55:39 Mapping speed, Million of reads per hour | 2879.40 Number of input reads | 3999164 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3648740 Uniquely mapped reads % | 91.24% Average mapped length | 51.81 Number of splices: Total | 463521 Number of splices: Annotated (sjdb) | 453733 Number of splices: GT/AG | 455825 Number of splices: GC/AG | 6573 Number of splices: AT/AC | 446 Number of splices: Non-canonical | 677 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244973 % of reads mapped to multiple loci | 6.13% Number of reads mapped to too many loci | 76049 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105451 105451 105451 N_multimapping 244973 244973 244973 N_noFeature 142931 3618829 159087 N_ambiguous 24912 62 11117 UnstrandedReadsAssigned:3480897 PositiveStrandReadsAssigned:29849 NegativeStrandReadsAssigned:3478536 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423586 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423586-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,164 reads, 3,645,411 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR5423586.ke.tsv 34699 SRR5423586.se.tsv 87100 total ==> SRR5423586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 276 45.3602 Potri.005G024800.1.v4.1 1035 936 69 23.2495 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 73.1624 8.11334 Potri.016G087400.1.v4.1 270 171 106 195.502 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 3.76804 Potri.012G127500.1.v4.1 977 878 2661 955.854 ==> SRR5423586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR5423586 completed mapping pipeline successfully