Starting /dee2/code/volunteer_pipeline.sh SRR5423587 current disk space = 3088915140608 free memory = 1469567536 SRR5423587 SRAfilesize d61b2c4a8d1fe5d0ef208eda0686dd64 SRR5423587.sra SRR5423587.sra file validated SRR5423587 is single end SRR5423587 is conventional basespace SRR5423587 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18825 34.0 31.0 34.0 30.0 34.0 2 32.45675 34.0 31.0 34.0 30.0 34.0 3 32.42425 34.0 31.0 34.0 30.0 34.0 4 35.83725 37.0 35.0 37.0 35.0 37.0 5 36.0245 37.0 35.0 37.0 35.0 37.0 6 35.98925 37.0 35.0 37.0 35.0 37.0 7 35.93 37.0 35.0 37.0 35.0 37.0 8 36.0265 37.0 35.0 37.0 35.0 37.0 9 37.77925 39.0 37.0 39.0 35.0 39.0 10 37.63975 39.0 37.0 39.0 35.0 39.0 11 37.6765 39.0 37.0 39.0 35.0 39.0 12 37.635 39.0 37.0 39.0 35.0 39.0 13 37.5315 39.0 37.0 39.0 35.0 39.0 14 39.0065 40.0 38.0 41.0 36.0 41.0 15 39.018 40.0 38.0 41.0 36.0 41.0 16 39.028 40.0 38.0 41.0 36.0 41.0 17 38.933 40.0 38.0 41.0 35.0 41.0 18 39.09025 40.0 38.0 41.0 36.0 41.0 19 39.0205 40.0 39.0 41.0 36.0 41.0 20 38.92275 40.0 38.0 41.0 35.0 41.0 21 38.8415 40.0 38.0 41.0 35.0 41.0 22 39.0235 40.0 39.0 41.0 36.0 41.0 23 38.8505 40.0 38.0 41.0 34.0 41.0 24 38.87775 40.0 38.0 41.0 35.0 41.0 25 38.80325 40.0 38.0 41.0 35.0 41.0 26 38.8915 40.0 38.0 41.0 35.0 41.0 27 38.83375 40.0 38.0 41.0 35.0 41.0 28 38.86 40.0 38.0 41.0 35.0 41.0 29 38.9105 40.0 38.0 41.0 35.0 41.0 30 38.8075 40.0 38.0 41.0 35.0 41.0 31 38.73625 40.0 38.0 41.0 35.0 41.0 32 38.85225 40.0 38.0 41.0 35.0 41.0 33 38.60625 40.0 38.0 41.0 34.0 41.0 34 38.71975 40.0 38.0 41.0 35.0 41.0 35 38.67475 40.0 38.0 41.0 34.0 41.0 36 38.6305 40.0 38.0 41.0 35.0 41.0 37 38.48575 40.0 38.0 41.0 34.0 41.0 38 38.4965 40.0 38.0 41.0 34.0 41.0 39 38.43225 40.0 38.0 41.0 34.0 41.0 40 38.36675 40.0 38.0 41.0 34.0 41.0 41 38.2835 40.0 38.0 41.0 34.0 41.0 42 38.1665 40.0 38.0 41.0 33.0 41.0 43 38.22675 40.0 38.0 41.0 34.0 41.0 44 38.26175 40.0 38.0 41.0 33.0 41.0 45 38.2825 40.0 38.0 41.0 33.0 41.0 46 38.13825 40.0 38.0 41.0 33.0 41.0 47 38.0385 40.0 38.0 41.0 33.0 41.0 48 38.1005 40.0 37.0 41.0 33.0 41.0 49 38.08525 40.0 37.0 41.0 33.0 41.0 50 37.90025 40.0 37.0 41.0 33.0 41.0 51 37.93925 40.0 37.0 41.0 33.0 41.0 52 36.987 39.0 36.0 41.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2110 1 0.0 2110 2 0.0 2110 3 0.0 2110 4 0.0 2110 5 0.0 2110 6 0.0 2110 7 0.0 2110 8 0.0 2110 9 0.0 2110 10 0.0 2110 11 0.0 2110 12 0.0 2110 13 0.0 2110 14 0.0 2110 15 0.0 2110 16 0.0 2110 17 0.0 2110 18 0.0 2110 19 0.0 2110 20 0.0 2110 21 0.0 2110 22 0.0 2110 23 0.0 2110 24 0.0 2110 25 0.0 2110 26 0.0 2110 27 0.0 2110 28 0.0 2110 29 0.0 2110 30 0.0 2110 31 0.0 2110 32 0.0 2110 33 0.0 2110 34 0.0 2110 35 0.0 2110 36 0.0 2110 37 0.0 2110 38 0.0 2110 39 0.0 2110 40 0.0 2110 41 0.0 2110 42 0.0 2110 43 0.0 2110 44 0.0 2110 45 0.0 2110 46 0.0 2110 47 0.0 2110 48 0.0 2110 49 0.0 2110 50 0.0 2110 51 0.0 2110 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 2.0 23 2.0 24 5.0 25 5.0 26 7.0 27 18.0 28 20.0 29 32.0 30 51.0 31 41.0 32 76.0 33 107.0 34 134.0 35 169.0 36 256.0 37 383.0 38 728.0 39 1944.0 40 17.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.62525050100201 11.24749498997996 7.18937875751503 43.93787575150301 2 22.425 15.45 34.175 27.950000000000003 3 21.975 19.025 23.974999999999998 35.025 4 24.95 26.125 22.7 26.224999999999998 5 24.725 31.05 23.45 20.775 6 18.224999999999998 32.9 24.95 23.925 7 14.649999999999999 22.45 42.375 20.525 8 16.45 22.325 33.050000000000004 28.175 9 17.325 19.675 35.625 27.375 10 18.425 35.775 25.825 19.975 11 23.599999999999998 26.275 22.925 27.200000000000003 12 21.325 23.474999999999998 28.075 27.125 13 20.075000000000003 25.8 28.199999999999996 25.924999999999997 14 21.325 25.374999999999996 27.85 25.45 15 20.474999999999998 24.85 27.900000000000002 26.775 16 22.175 25.6 26.85 25.374999999999996 17 21.45 26.0 26.25 26.3 18 19.275000000000002 25.874999999999996 27.700000000000003 27.150000000000002 19 20.925 26.75 27.275 25.05 20 21.55 25.324999999999996 26.8 26.325 21 20.4 25.4 27.675 26.525 22 20.724999999999998 25.2 28.025 26.05 23 21.15 27.500000000000004 26.150000000000002 25.2 24 21.6 25.2 25.924999999999997 27.275 25 19.85 26.450000000000003 27.425 26.275 26 20.25 25.8 29.075 24.875 27 21.224999999999998 23.400000000000002 27.150000000000002 28.225 28 19.85 28.575 26.150000000000002 25.424999999999997 29 21.2 24.925 26.950000000000003 26.924999999999997 30 21.224999999999998 25.25 27.474999999999998 26.05 31 20.65 26.55 27.025 25.775 32 21.349999999999998 25.924999999999997 27.474999999999998 25.25 33 21.275 25.5 26.275 26.950000000000003 34 20.4 26.400000000000002 26.200000000000003 27.0 35 20.200000000000003 25.324999999999996 28.4 26.075 36 20.575 24.175 27.725 27.525 37 22.3 25.95 25.674999999999997 26.075 38 21.425 26.0 26.6 25.974999999999998 39 20.599999999999998 25.25 26.6 27.55 40 21.525 26.200000000000003 25.874999999999996 26.400000000000002 41 22.45 26.025 26.924999999999997 24.6 42 21.4 24.325 26.525 27.750000000000004 43 21.375 25.775 25.424999999999997 27.425 44 20.549999999999997 25.275 27.675 26.5 45 21.3 24.175 27.800000000000004 26.724999999999998 46 21.425 24.375 27.975 26.224999999999998 47 21.91095547773887 24.787393696848426 26.21310655327664 27.088544272136065 48 20.860430215107552 24.137068534267133 27.738869434717362 27.263631815907953 49 20.95 25.650000000000002 27.075 26.325 50 19.80495123780945 27.056764191047762 27.781945486371594 25.35633908477119 51 21.5 23.674999999999997 27.075 27.750000000000004 52 21.2 23.9 27.650000000000002 27.250000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 3.0 21 5.0 22 5.5 23 6.0 24 9.5 25 13.0 26 12.0 27 11.0 28 22.5 29 34.0 30 36.5 31 39.0 32 51.5 33 64.0 34 76.5 35 89.0 36 113.5 37 138.0 38 160.0 39 205.5 40 229.0 41 247.5 42 266.0 43 320.0 44 374.0 45 369.0 46 364.0 47 402.5 48 441.0 49 410.5 50 380.0 51 351.0 52 322.0 53 300.5 54 279.0 55 271.5 56 264.0 57 209.5 58 155.0 59 133.5 60 112.0 61 96.0 62 80.0 63 73.5 64 55.0 65 43.0 66 30.0 67 17.0 68 11.5 69 6.0 70 5.0 71 4.0 72 5.0 73 6.0 74 4.5 75 3.0 76 2.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.05 48 0.05 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5794910556815319 1.15 3 0.02519526329050139 0.075 4 0.05039052658100278 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra Read 200000 spots for SRR5423587.sra Written 200000 spots for SRR5423587.sra SRR ids: ['SRR5423587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8x1dc8y7 SRR5423587.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423587 file size 703970 SRR5423587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423587 SRR5423587_1.fastq Input file: SRR5423587_1.fastq trimmed: SRR5423587-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:24:47 2025 >> started Thu Feb 13 15:24:48 2025 >> done (1.924s) 4000000 reads processed; of these: 198 ( 0.00%) short reads filtered out after trimming by size control 709 ( 0.02%) empty reads filtered out after trimming by size control 3999093 (99.98%) reads available; of these: 56737 ( 1.42%) trimmed reads available after processing 3942356 (98.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 7 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 6 0.00% 27 6 0.00% 28 7 0.00% 29 14 0.00% 30 9 0.00% 31 23 0.00% 32 17 0.00% 33 28 0.00% 34 23 0.00% 35 40 0.00% 36 35 0.00% 37 49 0.00% 38 52 0.00% 39 68 0.00% 40 96 0.00% 41 120 0.00% 42 111 0.00% 43 160 0.00% 44 250 0.01% 45 347 0.01% 46 587 0.01% 47 705 0.02% 48 1232 0.03% 49 2427 0.06% 50 6846 0.17% 51 43451 1.09% 52 3942356 98.58% 3999093 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=51.55 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=8.5 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:25:04 Started mapping on | Feb 13 15:25:04 Finished on | Feb 13 15:25:09 Mapping speed, Million of reads per hour | 2879.35 Number of input reads | 3999093 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3649398 Uniquely mapped reads % | 91.26% Average mapped length | 51.81 Number of splices: Total | 462916 Number of splices: Annotated (sjdb) | 453143 Number of splices: GT/AG | 455226 Number of splices: GC/AG | 6577 Number of splices: AT/AC | 469 Number of splices: Non-canonical | 644 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244748 % of reads mapped to multiple loci | 6.12% Number of reads mapped to too many loci | 75456 % of reads mapped to too many loci | 1.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104947 104947 104947 N_multimapping 244748 244748 244748 N_noFeature 143595 3619535 159780 N_ambiguous 24529 64 10815 UnstrandedReadsAssigned:3481274 PositiveStrandReadsAssigned:29799 NegativeStrandReadsAssigned:3478803 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423587 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423587-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,093 reads, 3,634,934 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR5423587.ke.tsv 34699 SRR5423587.se.tsv 87100 total ==> SRR5423587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 298.669 49.2338 Potri.005G024800.1.v4.1 1035 936 95.0363 32.1189 Potri.004G059700.1.v4.1 961 862 2 0.733956 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 59.8902 6.66151 Potri.016G087400.1.v4.1 270 171 112 207.19 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.347 3.656 Potri.012G127500.1.v4.1 977 878 2686 967.74 ==> SRR5423587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR5423587 completed mapping pipeline successfully