Starting /dee2/code/volunteer_pipeline.sh SRR5423588 current disk space = 3088906625024 free memory = 1437355156 SRR5423588 SRAfilesize 57703e36c306c9115f73894534e3c894 SRR5423588.sra SRR5423588.sra file validated SRR5423588 is single end SRR5423588 is conventional basespace SRR5423588 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5145 34.0 31.0 34.0 31.0 34.0 2 32.52125 34.0 31.0 34.0 30.0 34.0 3 32.7545 34.0 31.0 34.0 31.0 34.0 4 36.17425 37.0 37.0 37.0 35.0 37.0 5 36.099 37.0 37.0 37.0 35.0 37.0 6 36.08375 37.0 36.0 37.0 35.0 37.0 7 36.105 37.0 36.0 37.0 35.0 37.0 8 36.15675 37.0 36.0 37.0 35.0 37.0 9 37.85925 39.0 38.0 39.0 35.0 39.0 10 37.721 39.0 38.0 39.0 35.0 39.0 11 37.875 39.0 38.0 39.0 35.0 39.0 12 37.834 39.0 38.0 39.0 35.0 39.0 13 37.78375 39.0 38.0 39.0 35.0 39.0 14 39.2975 41.0 39.0 41.0 36.0 41.0 15 39.23825 41.0 39.0 41.0 36.0 41.0 16 39.157 41.0 39.0 41.0 36.0 41.0 17 39.21075 41.0 39.0 41.0 36.0 41.0 18 39.14025 40.0 39.0 41.0 36.0 41.0 19 39.24775 41.0 39.0 41.0 36.0 41.0 20 39.216 41.0 39.0 41.0 36.0 41.0 21 39.19175 40.0 39.0 41.0 36.0 41.0 22 39.0345 40.0 39.0 41.0 36.0 41.0 23 39.01575 40.0 39.0 41.0 35.0 41.0 24 39.19 41.0 39.0 41.0 36.0 41.0 25 39.203 40.0 39.0 41.0 36.0 41.0 26 39.072 40.0 39.0 41.0 36.0 41.0 27 39.0805 40.0 39.0 41.0 36.0 41.0 28 38.9775 40.0 39.0 41.0 36.0 41.0 29 38.91775 40.0 39.0 41.0 35.0 41.0 30 38.91775 40.0 39.0 41.0 35.0 41.0 31 38.90175 40.0 39.0 41.0 35.0 41.0 32 38.911 40.0 39.0 41.0 35.0 41.0 33 38.92775 40.0 39.0 41.0 35.0 41.0 34 38.711 40.0 38.0 41.0 35.0 41.0 35 38.82325 40.0 38.0 41.0 35.0 41.0 36 38.87125 40.0 38.0 41.0 35.0 41.0 37 38.74425 40.0 38.0 41.0 35.0 41.0 38 38.64725 40.0 38.0 41.0 34.0 41.0 39 38.52725 40.0 38.0 41.0 34.0 41.0 40 38.45975 40.0 38.0 41.0 34.0 41.0 41 38.56125 40.0 38.0 41.0 34.0 41.0 42 38.37925 40.0 38.0 41.0 34.0 41.0 43 38.24575 40.0 38.0 41.0 33.0 41.0 44 38.21525 40.0 38.0 41.0 34.0 41.0 45 38.195 40.0 38.0 41.0 33.0 41.0 46 38.0965 40.0 38.0 41.0 33.0 41.0 47 38.01275 40.0 38.0 41.0 33.0 41.0 48 37.919 40.0 38.0 41.0 33.0 41.0 49 38.1195 40.0 38.0 41.0 33.0 41.0 50 37.93975 40.0 37.0 41.0 33.0 41.0 51 37.9405 40.0 37.0 41.0 33.0 41.0 52 37.06075 39.0 36.0 41.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2208 1 0.0 2208 2 0.0 2208 3 0.0 2208 4 0.0 2208 5 0.0 2208 6 0.0 2208 7 0.0 2208 8 0.0 2208 9 0.0 2208 10 0.0 2208 11 0.0 2208 12 0.0 2208 13 0.0 2208 14 0.0 2208 15 0.0 2208 16 0.0 2208 17 0.0 2208 18 0.0 2208 19 0.0 2208 20 0.0 2208 21 0.0 2208 22 0.0 2208 23 0.0 2208 24 0.0 2208 25 0.0 2208 26 0.0 2208 27 0.0 2208 28 0.0 2208 29 0.0 2208 30 0.0 2208 31 0.0 2208 32 0.0 2208 33 0.0 2208 34 0.0 2208 35 0.0 2208 36 0.0 2208 37 0.0 2208 38 0.0 2208 39 0.0 2208 40 0.0 2208 41 0.0 2208 42 0.0 2208 43 0.0 2208 44 0.0 2208 45 0.0 2208 46 0.0 2208 47 0.0 2208 48 0.0 2208 49 0.0 2208 50 0.0 2208 51 0.0 2208 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 6.0 24 3.0 25 10.0 26 12.0 27 14.0 28 24.0 29 21.0 30 44.0 31 51.0 32 66.0 33 91.0 34 104.0 35 161.0 36 202.0 37 339.0 38 702.0 39 2129.0 40 17.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.98197295943916 11.116675012518778 7.386079118678017 43.51527290936404 2 22.5 14.274999999999999 35.199999999999996 28.025 3 21.3 17.25 24.6 36.85 4 25.45 25.624999999999996 21.425 27.500000000000004 5 24.375 29.875 25.2 20.549999999999997 6 18.775 32.25 24.125 24.85 7 14.274999999999999 22.725 42.825 20.175 8 16.35 21.45 31.85 30.349999999999998 9 18.275 20.849999999999998 34.025 26.85 10 18.6 36.1 25.424999999999997 19.875 11 23.799999999999997 26.375 21.75 28.075 12 21.224999999999998 22.45 28.299999999999997 28.025 13 19.375 26.650000000000002 28.625 25.35 14 20.1 26.174999999999997 27.925 25.8 15 21.099999999999998 24.575 27.675 26.650000000000002 16 21.325 25.775 26.8 26.1 17 22.225 25.3 27.400000000000002 25.074999999999996 18 21.6 26.075 26.0 26.325 19 20.25 25.775 26.825 27.150000000000002 20 19.325 24.9 29.349999999999998 26.424999999999997 21 20.705176294073517 25.331332833208304 27.581895473868467 26.38159539884971 22 20.599999999999998 25.5 26.8 27.1 23 21.224999999999998 25.324999999999996 27.250000000000004 26.200000000000003 24 20.474999999999998 24.95 26.625 27.950000000000003 25 20.7 26.125 27.05 26.125 26 19.425 26.674999999999997 27.575 26.325 27 20.075000000000003 27.125 26.1 26.700000000000003 28 21.4 26.424999999999997 26.150000000000002 26.025 29 20.75 26.150000000000002 26.974999999999998 26.125 30 20.424999999999997 24.675 26.924999999999997 27.975 31 21.625 25.650000000000002 27.375 25.35 32 20.8 26.224999999999998 27.325 25.650000000000002 33 20.925 24.75 26.974999999999998 27.35 34 20.674999999999997 25.650000000000002 26.325 27.35 35 21.0 25.6 27.800000000000004 25.6 36 21.425 23.825 27.675 27.075 37 21.175 25.825 26.674999999999997 26.325 38 20.75 26.25 27.175 25.825 39 20.424999999999997 25.124999999999996 26.650000000000002 27.800000000000004 40 21.575 26.0 26.474999999999998 25.95 41 21.775 25.5 26.825 25.900000000000002 42 21.825 24.95 26.224999999999998 27.0 43 21.2 26.625 26.5 25.674999999999997 44 20.575 24.975 27.625 26.825 45 20.9 25.624999999999996 25.35 28.125 46 21.10527631907977 24.756189047261813 25.531382845711427 28.60715178794699 47 21.710855427713856 25.937968984492244 26.88844422211106 25.46273136568284 48 21.010505252626313 24.81240620310155 27.138569284642323 27.03851925962982 49 21.355338834708675 24.93123280820205 26.85671417854464 26.85671417854464 50 20.635317658829415 25.337668834417208 27.263631815907953 26.76338169084542 51 20.0 24.9 26.775 28.325 52 22.575 25.35 25.1 26.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 2.0 21 1.0 22 5.0 23 9.0 24 8.0 25 7.0 26 10.5 27 14.0 28 23.0 29 32.0 30 35.5 31 39.0 32 43.5 33 48.0 34 74.5 35 101.0 36 123.0 37 145.0 38 165.5 39 206.0 40 226.0 41 265.0 42 304.0 43 319.0 44 334.0 45 347.0 46 360.0 47 363.5 48 367.0 49 365.5 50 364.0 51 365.0 52 366.0 53 332.0 54 298.0 55 271.5 56 245.0 57 212.0 58 179.0 59 154.5 60 130.0 61 111.0 62 92.0 63 76.5 64 44.0 65 27.0 66 27.0 67 27.0 68 18.5 69 10.0 70 10.0 71 10.0 72 8.5 73 7.0 74 6.0 75 5.0 76 3.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.05 48 0.05 49 0.025 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9113924050633 97.675 2 0.9367088607594937 1.8499999999999999 3 0.12658227848101267 0.375 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra Read 200000 spots for SRR5423588.sra Written 200000 spots for SRR5423588.sra SRR ids: ['SRR5423588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6egysj59 SRR5423588.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423588 file size 703973 SRR5423588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423588 SRR5423588_1.fastq Input file: SRR5423588_1.fastq trimmed: SRR5423588-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:23:19 2025 >> started Thu Feb 13 15:23:21 2025 >> done (1.866s) 4000000 reads processed; of these: 209 ( 0.01%) short reads filtered out after trimming by size control 680 ( 0.02%) empty reads filtered out after trimming by size control 3999111 (99.98%) reads available; of these: 53725 ( 1.34%) trimmed reads available after processing 3945386 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 8 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 8 0.00% 28 3 0.00% 29 8 0.00% 30 14 0.00% 31 11 0.00% 32 29 0.00% 33 26 0.00% 34 34 0.00% 35 26 0.00% 36 45 0.00% 37 42 0.00% 38 53 0.00% 39 76 0.00% 40 88 0.00% 41 88 0.00% 42 127 0.00% 43 176 0.00% 44 231 0.01% 45 337 0.01% 46 486 0.01% 47 708 0.02% 48 1176 0.03% 49 2327 0.06% 50 6334 0.16% 51 41224 1.03% 52 3945386 98.66% 3999111 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=15 prefix-density=0.24 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=51.47 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=8.5 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:23:34 Started mapping on | Feb 13 15:23:34 Finished on | Feb 13 15:23:39 Mapping speed, Million of reads per hour | 2879.36 Number of input reads | 3999111 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650125 Uniquely mapped reads % | 91.27% Average mapped length | 51.81 Number of splices: Total | 463997 Number of splices: Annotated (sjdb) | 454110 Number of splices: GT/AG | 456350 Number of splices: GC/AG | 6568 Number of splices: AT/AC | 436 Number of splices: Non-canonical | 643 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244579 % of reads mapped to multiple loci | 6.12% Number of reads mapped to too many loci | 74910 % of reads mapped to too many loci | 1.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104407 104407 104407 N_multimapping 244579 244579 244579 N_noFeature 142300 3620599 158304 N_ambiguous 24489 45 10943 UnstrandedReadsAssigned:3483336 PositiveStrandReadsAssigned:29481 NegativeStrandReadsAssigned:3480878 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423588 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423588-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,111 reads, 3,647,418 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR5423588.ke.tsv 34699 SRR5423588.se.tsv 87100 total ==> SRR5423588.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 295 48.4664 Potri.005G024800.1.v4.1 1035 936 85.0342 28.6425 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 59.4416 6.58953 Potri.016G087400.1.v4.1 270 171 119 219.404 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22.5358 4.24434 Potri.012G127500.1.v4.1 977 878 2675 960.557 ==> SRR5423588.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR5423588 completed mapping pipeline successfully