Starting /dee2/code/volunteer_pipeline.sh SRR5423589 current disk space = 3089015431168 free memory = 1449891136 SRR5423589 SRAfilesize 221fc5809945c739da0aeaa1d643d92b SRR5423589.sra SRR5423589.sra file validated SRR5423589 is single end SRR5423589 is conventional basespace SRR5423589 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59925 34.0 31.0 34.0 31.0 34.0 2 32.70775 34.0 31.0 34.0 31.0 34.0 3 32.778 34.0 31.0 34.0 31.0 34.0 4 36.0515 37.0 37.0 37.0 35.0 37.0 5 36.0765 37.0 37.0 37.0 35.0 37.0 6 36.023 37.0 35.0 37.0 35.0 37.0 7 36.1 37.0 35.0 37.0 35.0 37.0 8 36.08 37.0 35.0 37.0 35.0 37.0 9 37.8465 39.0 38.0 39.0 35.0 39.0 10 37.72325 39.0 38.0 39.0 35.0 39.0 11 37.69275 39.0 38.0 39.0 35.0 39.0 12 37.759 39.0 38.0 39.0 35.0 39.0 13 37.8235 39.0 38.0 39.0 35.0 39.0 14 39.26125 41.0 39.0 41.0 36.0 41.0 15 39.1885 41.0 39.0 41.0 36.0 41.0 16 39.25925 41.0 39.0 41.0 36.0 41.0 17 39.25875 41.0 39.0 41.0 36.0 41.0 18 39.2495 41.0 39.0 41.0 36.0 41.0 19 39.323 41.0 39.0 41.0 36.0 41.0 20 39.12175 40.0 39.0 41.0 36.0 41.0 21 38.89775 40.0 38.0 41.0 35.0 41.0 22 38.992 40.0 39.0 41.0 35.0 41.0 23 39.05175 40.0 39.0 41.0 35.0 41.0 24 39.12925 40.0 39.0 41.0 36.0 41.0 25 39.147 40.0 39.0 41.0 36.0 41.0 26 39.10775 40.0 39.0 41.0 36.0 41.0 27 39.04925 40.0 39.0 41.0 36.0 41.0 28 38.91975 40.0 39.0 41.0 35.0 41.0 29 38.9485 40.0 39.0 41.0 36.0 41.0 30 38.98325 40.0 39.0 41.0 35.0 41.0 31 38.99125 40.0 39.0 41.0 35.0 41.0 32 38.7335 40.0 38.0 41.0 35.0 41.0 33 38.76775 40.0 38.0 41.0 35.0 41.0 34 38.57725 40.0 38.0 41.0 34.0 41.0 35 38.80675 40.0 38.0 41.0 35.0 41.0 36 38.738 40.0 38.0 41.0 35.0 41.0 37 38.57875 40.0 38.0 41.0 34.0 41.0 38 38.62475 40.0 38.0 41.0 34.0 41.0 39 38.65675 40.0 38.0 41.0 34.0 41.0 40 38.60725 40.0 38.0 41.0 34.0 41.0 41 38.5735 40.0 38.0 41.0 34.0 41.0 42 38.481 40.0 38.0 41.0 34.0 41.0 43 38.3845 40.0 38.0 41.0 33.0 41.0 44 38.409 40.0 38.0 41.0 34.0 41.0 45 38.30375 40.0 38.0 41.0 33.0 41.0 46 38.114 40.0 38.0 41.0 33.0 41.0 47 38.05475 40.0 37.0 41.0 33.0 41.0 48 38.137 40.0 38.0 41.0 33.0 41.0 49 37.8745 40.0 37.0 41.0 33.0 41.0 50 37.98675 40.0 37.0 41.0 33.0 41.0 51 37.859 40.0 37.0 41.0 33.0 41.0 52 36.8055 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2306 1 0.0 2306 2 0.0 2306 3 0.0 2306 4 0.0 2306 5 0.0 2306 6 0.0 2306 7 0.0 2306 8 0.0 2306 9 0.0 2306 10 0.0 2306 11 0.0 2306 12 0.0 2306 13 0.0 2306 14 0.0 2306 15 0.0 2306 16 0.0 2306 17 0.0 2306 18 0.0 2306 19 0.0 2306 20 0.0 2306 21 0.0 2306 22 0.0 2306 23 0.0 2306 24 0.0 2306 25 0.0 2306 26 0.0 2306 27 0.0 2306 28 0.0 2306 29 0.0 2306 30 0.0 2306 31 0.0 2306 32 0.0 2306 33 0.0 2306 34 0.0 2306 35 0.0 2306 36 0.0 2306 37 0.0 2306 38 0.0 2306 39 0.0 2306 40 0.0 2306 41 0.0 2306 42 0.0 2306 43 0.0 2306 44 0.0 2306 45 0.0 2306 46 0.0 2306 47 0.0 2306 48 0.0 2306 49 0.0 2306 50 0.0 2306 51 0.0 2306 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 3.0 26 3.0 27 16.0 28 25.0 29 26.0 30 37.0 31 45.0 32 89.0 33 96.0 34 119.0 35 172.0 36 237.0 37 336.0 38 653.0 39 2120.0 40 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.019009504752376 11.030515257628814 6.778389194597299 44.172086043021515 2 23.225 14.7 35.449999999999996 26.625 3 21.9 17.599999999999998 23.724999999999998 36.775000000000006 4 24.4 25.4 22.85 27.35 5 23.375 31.75 23.925 20.95 6 18.8 31.674999999999997 23.875 25.650000000000002 7 14.325 23.325000000000003 43.075 19.275000000000002 8 17.125 21.025 33.25 28.599999999999998 9 18.025 20.375 34.1 27.500000000000004 10 19.025 35.699999999999996 25.674999999999997 19.6 11 23.075000000000003 27.35 22.15 27.425 12 20.599999999999998 22.7 26.674999999999997 30.025000000000002 13 19.225 26.900000000000002 27.825 26.05 14 20.5 26.1 27.575 25.825 15 20.474999999999998 25.624999999999996 26.825 27.075 16 20.4 26.55 26.125 26.924999999999997 17 19.775000000000002 26.900000000000002 27.125 26.200000000000003 18 20.925 26.75 27.650000000000002 24.675 19 22.0 25.25 26.05 26.700000000000003 20 21.075 26.25 27.950000000000003 24.725 21 19.475 25.5 28.275 26.75 22 21.675 27.1 26.0 25.224999999999998 23 21.425 25.624999999999996 27.325 25.624999999999996 24 21.224999999999998 24.375 28.475 25.924999999999997 25 20.925 25.424999999999997 26.650000000000002 27.0 26 21.325 26.275 26.674999999999997 25.724999999999998 27 20.724999999999998 26.35 25.6 27.325 28 20.45 27.35 26.125 26.075 29 21.725 24.625 27.075 26.575 30 21.725 25.05 26.55 26.674999999999997 31 21.475 26.125 26.200000000000003 26.200000000000003 32 21.224999999999998 25.874999999999996 27.025 25.874999999999996 33 21.925 25.724999999999998 27.35 25.0 34 21.95 25.525 25.874999999999996 26.650000000000002 35 21.525 25.2 27.224999999999998 26.05 36 20.65 25.924999999999997 26.35 27.075 37 22.25 26.1 25.224999999999998 26.424999999999997 38 19.425 26.700000000000003 27.425 26.450000000000003 39 21.05 24.95 26.775 27.224999999999998 40 21.15 24.8 27.3 26.75 41 21.65 25.025 27.55 25.775 42 21.125 25.650000000000002 27.0 26.224999999999998 43 21.925 26.275 25.424999999999997 26.375 44 21.224999999999998 24.3 28.475 26.0 45 22.175 24.55 26.424999999999997 26.85 46 21.325 24.6 26.375 27.700000000000003 47 20.75 24.525 27.224999999999998 27.500000000000004 48 20.0 25.5 28.1 26.400000000000002 49 19.975 26.224999999999998 26.724999999999998 27.075 50 19.900000000000002 25.224999999999998 27.3 27.575 51 21.4 25.874999999999996 25.724999999999998 27.0 52 22.875 24.925 25.85 26.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 4.5 23 7.0 24 8.5 25 10.0 26 14.0 27 18.0 28 23.5 29 29.0 30 37.0 31 45.0 32 67.0 33 89.0 34 85.0 35 81.0 36 116.0 37 151.0 38 161.5 39 198.5 40 225.0 41 254.0 42 283.0 43 305.0 44 327.0 45 346.0 46 365.0 47 358.5 48 352.0 49 377.5 50 403.0 51 381.0 52 359.0 53 318.5 54 278.0 55 255.5 56 233.0 57 213.0 58 193.0 59 165.0 60 137.0 61 114.5 62 92.0 63 73.0 64 41.5 65 29.0 66 25.0 67 21.0 68 19.5 69 18.0 70 14.0 71 10.0 72 10.0 73 10.0 74 6.5 75 3.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98811029597773 97.82499999999999 2 0.8601062484189224 1.7000000000000002 3 0.12648621300278268 0.375 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164237 spots for SRR5423589.sra Written 164237 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra Read 164235 spots for SRR5423589.sra Written 164235 spots for SRR5423589.sra SRR ids: ['SRR5423589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_27l3jos3 SRR5423589.sra spots: 3284702 blocks: [[1, 164235], [164236, 328470], [328471, 492705], [492706, 656940], [656941, 821175], [821176, 985410], [985411, 1149645], [1149646, 1313880], [1313881, 1478115], [1478116, 1642350], [1642351, 1806585], [1806586, 1970820], [1970821, 2135055], [2135056, 2299290], [2299291, 2463525], [2463526, 2627760], [2627761, 2791995], [2791996, 2956230], [2956231, 3120465], [3120466, 3284702]] SRR5423589 file size 577908 SRR5423589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423589 SRR5423589_1.fastq Input file: SRR5423589_1.fastq trimmed: SRR5423589-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:17:44 2025 >> started Thu Feb 13 15:17:46 2025 >> done (2.305s) 3284702 reads processed; of these: 170 ( 0.01%) short reads filtered out after trimming by size control 539 ( 0.02%) empty reads filtered out after trimming by size control 3283993 (99.98%) reads available; of these: 38982 ( 1.19%) trimmed reads available after processing 3245011 (98.81%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 5 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 2 0.00% 28 4 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 12 0.00% 33 21 0.00% 34 15 0.00% 35 21 0.00% 36 15 0.00% 37 22 0.00% 38 33 0.00% 39 31 0.00% 40 44 0.00% 41 52 0.00% 42 73 0.00% 43 117 0.00% 44 126 0.00% 45 197 0.01% 46 268 0.01% 47 388 0.01% 48 701 0.02% 49 1423 0.04% 50 4413 0.13% 51 30958 0.94% 52 3245011 98.81% 3283993 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=17 prefix-density=0.24 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=49.05 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=8.2 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:18:00 Started mapping on | Feb 13 15:18:00 Finished on | Feb 13 15:18:05 Mapping speed, Million of reads per hour | 2364.47 Number of input reads | 3283993 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2996687 Uniquely mapped reads % | 91.25% Average mapped length | 51.81 Number of splices: Total | 380203 Number of splices: Annotated (sjdb) | 372376 Number of splices: GT/AG | 374027 Number of splices: GC/AG | 5347 Number of splices: AT/AC | 343 Number of splices: Non-canonical | 486 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201380 % of reads mapped to multiple loci | 6.13% Number of reads mapped to too many loci | 62477 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 85926 85926 85926 N_multimapping 201380 201380 201380 N_noFeature 118193 2972379 131311 N_ambiguous 20005 50 8788 UnstrandedReadsAssigned:2858489 PositiveStrandReadsAssigned:24258 NegativeStrandReadsAssigned:2856588 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423589 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423589-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,283,993 reads, 2,995,025 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR5423589.ke.tsv 34699 SRR5423589.se.tsv 87100 total ==> SRR5423589.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 241 48.1736 Potri.005G024800.1.v4.1 1035 936 53 21.7204 Potri.004G059700.1.v4.1 961 862 1 0.445 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.4098 5.98986 Potri.016G087400.1.v4.1 270 171 85 190.673 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.5201 3.78552 Potri.012G127500.1.v4.1 977 878 2216 968.15 ==> SRR5423589.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR5423589 completed mapping pipeline successfully