Starting /dee2/code/volunteer_pipeline.sh SRR5423590 current disk space = 3088846192640 free memory = 1491234072 SRR5423590 SRAfilesize 252687994eb1db332db80a3c806f9a66 SRR5423590.sra SRR5423590.sra file validated SRR5423590 is single end SRR5423590 is conventional basespace SRR5423590 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9375 33.0 25.0 34.0 2.0 34.0 2 31.21375 33.0 28.0 34.0 27.0 34.0 3 31.41625 33.0 31.0 34.0 27.0 34.0 4 31.27575 33.0 32.0 34.0 27.0 34.0 5 32.09825 33.0 32.0 34.0 30.0 34.0 6 35.37375 38.0 36.0 38.0 29.0 38.0 7 35.80175 38.0 36.0 38.0 31.0 38.0 8 35.97375 38.0 37.0 38.0 31.0 38.0 9 36.0435 38.0 37.0 38.0 33.0 38.0 10 36.18525 38.0 37.0 38.0 33.0 38.0 11 36.3165 38.0 37.0 38.0 33.0 38.0 12 36.12875 38.0 37.0 38.0 31.0 38.0 13 36.14075 38.0 37.0 38.0 33.0 38.0 14 35.91825 38.0 37.0 38.0 31.0 38.0 15 35.55375 38.0 37.0 38.0 29.0 38.0 16 36.03075 38.0 37.0 38.0 31.0 38.0 17 36.24225 38.0 37.0 38.0 33.0 38.0 18 35.89675 38.0 37.0 38.0 31.0 38.0 19 35.83725 38.0 37.0 38.0 31.0 38.0 20 36.18125 38.0 37.0 38.0 33.0 38.0 21 36.33325 38.0 37.0 38.0 33.0 38.0 22 36.45925 38.0 37.0 38.0 34.0 38.0 23 36.2535 38.0 37.0 38.0 33.0 38.0 24 36.41225 38.0 37.0 38.0 34.0 38.0 25 36.28975 38.0 37.0 38.0 33.0 38.0 26 36.406 38.0 38.0 38.0 33.0 38.0 27 36.3345 38.0 37.0 38.0 33.0 38.0 28 36.43725 38.0 38.0 38.0 34.0 38.0 29 36.42275 38.0 38.0 38.0 34.0 38.0 30 36.318 38.0 38.0 38.0 33.0 38.0 31 36.4635 38.0 38.0 38.0 34.0 38.0 32 36.5 38.0 38.0 38.0 34.0 38.0 33 36.288 38.0 37.0 38.0 33.0 38.0 34 36.40075 38.0 37.0 38.0 33.0 38.0 35 36.34025 38.0 37.0 38.0 34.0 38.0 36 36.14325 38.0 37.0 38.0 33.0 38.0 37 36.17 38.0 37.0 38.0 33.0 38.0 38 36.3655 38.0 37.0 38.0 33.0 38.0 39 36.3535 38.0 38.0 38.0 33.0 38.0 40 36.41275 38.0 38.0 38.0 34.0 38.0 41 36.16075 38.0 37.0 38.0 33.0 38.0 42 36.14525 38.0 37.0 38.0 33.0 38.0 43 36.31625 38.0 37.0 38.0 33.0 38.0 44 36.38925 38.0 38.0 38.0 34.0 38.0 45 36.2395 38.0 37.0 38.0 33.0 38.0 46 36.355 38.0 38.0 38.0 33.0 38.0 47 36.37775 38.0 38.0 38.0 33.0 38.0 48 36.50925 38.0 38.0 38.0 34.0 38.0 49 36.47125 38.0 38.0 38.0 34.0 38.0 50 36.42375 38.0 38.0 38.0 34.0 38.0 51 36.34025 38.0 38.0 38.0 34.0 38.0 52 36.06925 38.0 37.0 38.0 33.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 1.0 24 5.0 25 15.0 26 17.0 27 25.0 28 37.0 29 70.0 30 88.0 31 115.0 32 144.0 33 178.0 34 282.0 35 507.0 36 1070.0 37 1444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.35493137567826 10.85221832109799 7.851899138206192 44.94095116501756 2 22.95 15.625 34.65 26.775 3 22.575 18.25 24.45 34.725 4 24.325 25.624999999999996 22.675 27.375 5 24.224999999999998 30.2 24.099999999999998 21.475 6 18.525 32.324999999999996 24.349999999999998 24.8 7 13.950000000000001 22.85 42.9 20.3 8 17.175 22.400000000000002 32.300000000000004 28.125 9 18.075 21.6 34.725 25.6 10 19.2 34.949999999999996 26.174999999999997 19.675 11 23.75 26.625 22.125 27.500000000000004 12 21.425 24.175 26.474999999999998 27.925 13 20.200000000000003 26.224999999999998 29.4 24.175 14 20.925 25.3 28.925 24.85 15 21.775 24.875 26.1 27.250000000000004 16 20.724999999999998 26.8 27.750000000000004 24.725 17 21.025 25.15 27.125 26.700000000000003 18 19.825 26.400000000000002 26.700000000000003 27.075 19 20.45 26.650000000000002 26.0 26.900000000000002 20 20.9 26.275 27.6 25.224999999999998 21 20.200000000000003 27.474999999999998 26.575 25.75 22 20.525 26.450000000000003 26.974999999999998 26.05 23 20.424999999999997 26.224999999999998 26.875 26.474999999999998 24 21.025 26.174999999999997 27.125 25.674999999999997 25 20.125 27.275 25.474999999999998 27.125 26 20.525 25.0 27.500000000000004 26.974999999999998 27 20.825 25.55 27.85 25.775 28 19.875 26.25 27.474999999999998 26.400000000000002 29 19.775000000000002 25.900000000000002 27.6 26.724999999999998 30 19.8 26.0 28.4 25.8 31 20.9 26.450000000000003 26.75 25.900000000000002 32 20.775 25.624999999999996 26.825 26.775 33 20.025000000000002 25.374999999999996 28.050000000000004 26.55 34 20.925 27.025 26.575 25.474999999999998 35 21.475 25.35 27.325 25.85 36 20.875 26.474999999999998 27.175 25.474999999999998 37 21.175 26.900000000000002 26.55 25.374999999999996 38 20.225 26.400000000000002 27.35 26.025 39 21.125 25.15 26.875 26.85 40 19.825 26.375 28.175 25.624999999999996 41 22.075 24.425 27.650000000000002 25.85 42 19.875 26.025 27.725 26.375 43 21.349999999999998 26.6 25.874999999999996 26.174999999999997 44 20.8 25.224999999999998 27.625 26.35 45 20.575 25.724999999999998 26.55 27.150000000000002 46 22.1 26.025 26.05 25.825 47 21.55 25.775 26.3 26.375 48 21.425 26.0 26.400000000000002 26.174999999999997 49 22.45 25.974999999999998 25.7 25.874999999999996 50 20.7 25.474999999999998 27.425 26.400000000000002 51 20.724999999999998 24.8 27.474999999999998 27.0 52 21.230307576894223 25.63140785196299 26.85671417854464 26.281570392598148 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 8.0 23 14.0 24 10.5 25 7.0 26 11.5 27 16.0 28 22.5 29 29.0 30 40.0 31 51.0 32 64.0 33 77.0 34 100.5 35 124.0 36 136.0 37 148.0 38 180.0 39 224.5 40 237.0 41 276.0 42 315.0 43 327.5 44 340.0 45 376.5 46 413.0 47 398.5 48 384.0 49 394.0 50 404.0 51 359.0 52 314.0 53 281.5 54 249.0 55 225.0 56 201.0 57 187.0 58 173.0 59 137.5 60 102.0 61 87.5 62 73.0 63 57.5 64 32.5 65 23.0 66 20.0 67 17.0 68 14.5 69 12.0 70 10.5 71 9.0 72 7.0 73 5.0 74 4.0 75 3.0 76 2.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra Read 2090198 spots for SRR5423590.sra Written 2090198 spots for SRR5423590.sra Read 2090193 spots for SRR5423590.sra Written 2090193 spots for SRR5423590.sra SRR ids: ['SRR5423590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_itv433nx SRR5423590.sra spots: 41803865 blocks: [[1, 2090193], [2090194, 4180386], [4180387, 6270579], [6270580, 8360772], [8360773, 10450965], [10450966, 12541158], [12541159, 14631351], [14631352, 16721544], [16721545, 18811737], [18811738, 20901930], [20901931, 22992123], [22992124, 25082316], [25082317, 27172509], [27172510, 29262702], [29262703, 31352895], [31352896, 33443088], [33443089, 35533281], [35533282, 37623474], [37623475, 39713667], [39713668, 41803865]] SRR5423590 file size 7275877 SRR5423590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423590 SRR5423590_1.fastq Input file: SRR5423590_1.fastq trimmed: SRR5423590-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:36:22 2025 >> started Thu Feb 13 15:36:40 2025 >> done (18.237s) 41803865 reads processed; of these: 2742 ( 0.01%) short reads filtered out after trimming by size control 8428 ( 0.02%) empty reads filtered out after trimming by size control 41792695 (99.97%) reads available; of these: 3262 ( 0.01%) trimmed reads available after processing 41789433 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 72 0.00% 19 60 0.00% 20 74 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 3056 0.01% 52 41789433 99.99% 41792695 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=22 prefix-density=0.21 prefix-fanout=1.8 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=54.25 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=8.3 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 13 15:36:52 Started mapping on | Feb 13 15:36:52 Finished on | Feb 13 15:37:31 Mapping speed, Million of reads per hour | 3857.79 Number of input reads | 41792695 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 38062687 Uniquely mapped reads % | 91.07% Average mapped length | 51.81 Number of splices: Total | 4860582 Number of splices: Annotated (sjdb) | 4761001 Number of splices: GT/AG | 4781858 Number of splices: GC/AG | 68451 Number of splices: AT/AC | 4698 Number of splices: Non-canonical | 5575 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2523259 % of reads mapped to multiple loci | 6.04% Number of reads mapped to too many loci | 813897 % of reads mapped to too many loci | 1.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1206749 1206749 1206749 N_multimapping 2523259 2523259 2523259 N_noFeature 1509995 37763378 1664788 N_ambiguous 256408 465 111705 UnstrandedReadsAssigned:36296284 PositiveStrandReadsAssigned:298844 NegativeStrandReadsAssigned:36286194 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423590 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423590-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,792,695 reads, 36,677,782 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,364 rounds 52401 SRR5423590.ke.tsv 34699 SRR5423590.se.tsv 87100 total ==> SRR5423590.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3127.59 51.0733 Potri.005G024800.1.v4.1 1035 936 909.75 30.4583 Potri.004G059700.1.v4.1 961 862 3.06699 0.111497 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 735.06 8.09939 Potri.016G087400.1.v4.1 270 171 1064.76 195.126 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 191.143 3.57817 Potri.012G127500.1.v4.1 977 878 27555 983.479 ==> SRR5423590.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1033 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 202 SRR5423590 completed mapping pipeline successfully