Starting /dee2/code/volunteer_pipeline.sh SRR5423591 current disk space = 3088800243712 free memory = 1481149028 SRR5423591 SRAfilesize 7846d2f5173875efeb87d2eb7682ea1d SRR5423591.sra SRR5423591.sra file validated SRR5423591 is single end SRR5423591 is conventional basespace SRR5423591 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423591_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.71825 33.0 32.0 34.0 18.0 34.0 2 31.6955 33.0 32.0 34.0 27.0 34.0 3 32.123 33.0 32.0 34.0 27.0 34.0 4 30.62225 33.0 31.0 34.0 15.0 34.0 5 31.8195 33.0 32.0 34.0 27.0 34.0 6 35.01275 38.0 35.0 38.0 28.0 38.0 7 34.837 38.0 35.0 38.0 27.0 38.0 8 35.413 38.0 36.0 38.0 29.0 38.0 9 35.81275 38.0 36.0 38.0 31.0 38.0 10 35.3645 38.0 36.0 38.0 29.0 38.0 11 35.16475 38.0 36.0 38.0 29.0 38.0 12 35.7715 38.0 36.0 38.0 30.0 38.0 13 35.4585 38.0 36.0 38.0 29.0 38.0 14 34.948 38.0 35.0 38.0 28.0 38.0 15 33.639 38.0 33.0 38.0 16.0 38.0 16 34.696 38.0 34.0 38.0 28.0 38.0 17 35.48775 38.0 36.0 38.0 29.0 38.0 18 35.78375 38.0 36.0 38.0 31.0 38.0 19 35.84275 38.0 37.0 38.0 31.0 38.0 20 35.801 38.0 37.0 38.0 30.0 38.0 21 35.8025 38.0 36.0 38.0 31.0 38.0 22 29.58675 34.0 16.0 38.0 16.0 38.0 23 29.63675 33.0 24.0 38.0 16.0 38.0 24 33.1475 36.0 29.0 38.0 25.0 38.0 25 34.571 37.0 34.0 38.0 27.0 38.0 26 34.7975 38.0 35.0 38.0 27.0 38.0 27 34.433 38.0 34.0 38.0 25.0 38.0 28 34.749 38.0 35.0 38.0 27.0 38.0 29 28.76625 34.0 16.0 38.0 16.0 38.0 30 32.83475 37.0 28.0 38.0 25.0 38.0 31 27.28 29.0 16.0 37.0 15.0 38.0 32 32.75875 36.0 28.0 38.0 25.0 38.0 33 34.45525 37.0 34.0 38.0 27.0 38.0 34 35.073 38.0 35.0 38.0 28.0 38.0 35 35.60875 38.0 36.0 38.0 29.0 38.0 36 35.3045 38.0 36.0 38.0 29.0 38.0 37 35.14725 38.0 36.0 38.0 28.0 38.0 38 35.822 38.0 37.0 38.0 31.0 38.0 39 35.544 38.0 36.0 38.0 29.0 38.0 40 35.85425 38.0 37.0 38.0 31.0 38.0 41 36.1515 38.0 37.0 38.0 33.0 38.0 42 36.1755 38.0 37.0 38.0 33.0 38.0 43 36.19075 38.0 37.0 38.0 33.0 38.0 44 35.7265 38.0 37.0 38.0 29.0 38.0 45 35.0555 38.0 36.0 38.0 27.0 38.0 46 35.216 38.0 36.0 38.0 28.0 38.0 47 35.89525 38.0 37.0 38.0 29.0 38.0 48 36.2935 38.0 37.0 38.0 33.0 38.0 49 36.164 38.0 37.0 38.0 33.0 38.0 50 35.84475 38.0 37.0 38.0 31.0 38.0 51 35.9125 38.0 37.0 38.0 31.0 38.0 52 35.04625 38.0 35.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 7.0 24 9.0 25 23.0 26 38.0 27 44.0 28 92.0 29 121.0 30 144.0 31 223.0 32 286.0 33 358.0 34 529.0 35 833.0 36 968.0 37 324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.27332601536773 13.007683863885841 7.683863885839736 38.0351262349067 2 23.225 16.0 35.5 25.275 3 19.900000000000002 21.875 26.200000000000003 32.025 4 26.55 27.925 22.075 23.45 5 25.124999999999996 32.0 22.575 20.3 6 19.1 33.35 24.075 23.474999999999998 7 14.975 21.875 42.525 20.625 8 17.325 21.5 31.525 29.65 9 19.025 19.2 35.275 26.5 10 20.05 34.8 23.775 21.375 11 24.0 24.925 22.2 28.875 12 22.825 23.599999999999998 26.400000000000002 27.175 13 21.525 25.55 27.675 25.25 14 21.4 25.674999999999997 27.700000000000003 25.224999999999998 15 21.025 24.725 28.65 25.6 16 21.375 25.3 26.625 26.700000000000003 17 22.675 24.975 25.15 27.200000000000003 18 23.05 24.05 26.625 26.275 19 22.35 25.424999999999997 26.3 25.924999999999997 20 21.65 25.474999999999998 27.224999999999998 25.650000000000002 21 22.75 24.5 25.45 27.3 22 19.375 22.425 34.125 24.075 23 20.849999999999998 23.849999999999998 29.875 25.424999999999997 24 21.3 24.9 26.35 27.450000000000003 25 23.05 25.3 24.15 27.500000000000004 26 22.325 24.099999999999998 26.424999999999997 27.150000000000002 27 21.125 24.224999999999998 26.8 27.85 28 22.975 24.474999999999998 27.474999999999998 25.074999999999996 29 25.324999999999996 22.3 28.775000000000002 23.599999999999998 30 23.1 24.4 25.7 26.8 31 21.224999999999998 22.1 32.975 23.7 32 22.7 24.6 26.5 26.200000000000003 33 22.3 24.875 24.85 27.975 34 23.1 24.675 25.275 26.950000000000003 35 22.45 23.275000000000002 27.0 27.275 36 22.85 25.025 24.8 27.325 37 24.125 24.425 25.025 26.424999999999997 38 22.325 25.624999999999996 24.85 27.200000000000003 39 23.200000000000003 24.85 25.05 26.900000000000002 40 24.125 25.4 25.474999999999998 25.0 41 23.599999999999998 24.099999999999998 25.575 26.724999999999998 42 21.625 23.625 27.675 27.075 43 22.475 25.1 25.900000000000002 26.525 44 21.775 24.0 25.224999999999998 28.999999999999996 45 22.075 25.85 25.224999999999998 26.85 46 21.65 24.825 26.900000000000002 26.625 47 23.974999999999998 23.775 25.974999999999998 26.275 48 22.875 24.975 25.674999999999997 26.474999999999998 49 22.15 25.374999999999996 24.85 27.625 50 21.7 25.575 23.65 29.075 51 21.9 24.325 25.074999999999996 28.7 52 23.25 23.875 24.925 27.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 2.0 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 2.5 15 5.0 16 3.0 17 1.0 18 2.5 19 4.0 20 4.0 21 4.0 22 10.0 23 16.0 24 14.0 25 12.0 26 18.5 27 25.0 28 24.5 29 24.0 30 39.0 31 54.0 32 68.0 33 82.0 34 94.5 35 107.0 36 111.5 37 116.0 38 139.0 39 182.5 40 203.0 41 209.0 42 215.0 43 244.0 44 273.0 45 292.0 46 311.0 47 325.5 48 340.0 49 346.5 50 353.0 51 349.0 52 345.0 53 330.0 54 315.0 55 288.0 56 261.0 57 242.0 58 223.0 59 188.5 60 154.0 61 138.0 62 122.0 63 101.0 64 69.5 65 59.0 66 54.5 67 50.0 68 36.0 69 22.0 70 21.5 71 21.0 72 15.0 73 9.0 74 10.5 75 12.0 76 9.5 77 7.0 78 5.5 79 4.0 80 3.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16603487490522 98.1 2 0.7076067728076826 1.4000000000000001 3 0.050543340914834464 0.15 4 0.025271670457417232 0.1 5 0.050543340914834464 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit CCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475669 spots for SRR5423591.sra Written 1475669 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra Read 1475666 spots for SRR5423591.sra Written 1475666 spots for SRR5423591.sra SRR ids: ['SRR5423591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w67rt7xm SRR5423591.sra spots: 29513323 blocks: [[1, 1475666], [1475667, 2951332], [2951333, 4426998], [4426999, 5902664], [5902665, 7378330], [7378331, 8853996], [8853997, 10329662], [10329663, 11805328], [11805329, 13280994], [13280995, 14756660], [14756661, 16232326], [16232327, 17707992], [17707993, 19183658], [19183659, 20659324], [20659325, 22134990], [22134991, 23610656], [23610657, 25086322], [25086323, 26561988], [26561989, 28037654], [28037655, 29513323]] SRR5423591 file size 5133685 SRR5423591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423591 SRR5423591_1.fastq Input file: SRR5423591_1.fastq trimmed: SRR5423591-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:38:39 2025 >> started Thu Feb 13 15:38:53 2025 >> done (13.856s) 29513323 reads processed; of these: 2191 ( 0.01%) short reads filtered out after trimming by size control 5248 ( 0.02%) empty reads filtered out after trimming by size control 29505884 (99.97%) reads available; of these: 1792 ( 0.01%) trimmed reads available after processing 29504092 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 61 0.00% 20 46 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 4 0.00% 50 9 0.00% 51 1624 0.01% 52 29504092 99.99% 29505884 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=13 prefix-density=0.95 prefix-fanout=1.1 sequence=GGAGACCTTAGGCCAGCACCCCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=9.48 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=2.4 sequence=CCAGCACCCCTCCT Started job on | Feb 13 15:39:09 Started mapping on | Feb 13 15:39:10 Finished on | Feb 13 15:39:46 Mapping speed, Million of reads per hour | 2950.59 Number of input reads | 29505884 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23900760 Uniquely mapped reads % | 81.00% Average mapped length | 51.83 Number of splices: Total | 2342851 Number of splices: Annotated (sjdb) | 2304966 Number of splices: GT/AG | 2310066 Number of splices: GC/AG | 26325 Number of splices: AT/AC | 1937 Number of splices: Non-canonical | 4523 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1777616 % of reads mapped to multiple loci | 6.02% Number of reads mapped to too many loci | 1189863 % of reads mapped to too many loci | 4.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.91% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3827508 3827508 3827508 N_multimapping 1777616 1777616 1777616 N_noFeature 3865139 23106359 4581734 N_ambiguous 145058 734 66615 UnstrandedReadsAssigned:19890563 PositiveStrandReadsAssigned:793667 NegativeStrandReadsAssigned:19252411 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423591 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423591-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,505,884 reads, 20,046,924 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR5423591.ke.tsv 34699 SRR5423591.se.tsv 87100 total ==> SRR5423591.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1889.23 59.4837 Potri.005G024800.1.v4.1 1035 936 97.0942 6.26766 Potri.004G059700.1.v4.1 961 862 31 2.17291 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 556.749 11.8282 Potri.016G087400.1.v4.1 270 171 466.812 164.943 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 109.738 3.96086 Potri.012G127500.1.v4.1 977 878 634 43.6297 ==> SRR5423591.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 661 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 57 SRR5423591 completed mapping pipeline successfully