Starting /dee2/code/volunteer_pipeline.sh SRR5423592 current disk space = 3088875802624 free memory = 1482634368 SRR5423592 SRAfilesize 50aa05e0ab90dee37448559f9dc9baca SRR5423592.sra SRR5423592.sra file validated SRR5423592 is single end SRR5423592 is conventional basespace SRR5423592 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.41025 33.0 30.0 34.0 2.0 34.0 2 31.35225 33.0 30.0 34.0 27.0 34.0 3 31.61825 33.0 32.0 34.0 27.0 34.0 4 30.25025 33.0 31.0 34.0 15.0 34.0 5 31.6865 33.0 32.0 34.0 27.0 34.0 6 34.95725 38.0 35.0 38.0 28.0 38.0 7 35.58575 38.0 36.0 38.0 29.0 38.0 8 35.4305 38.0 36.0 38.0 29.0 38.0 9 36.0225 38.0 37.0 38.0 31.0 38.0 10 35.84625 38.0 37.0 38.0 31.0 38.0 11 35.91025 38.0 37.0 38.0 31.0 38.0 12 35.8435 38.0 37.0 38.0 31.0 38.0 13 35.58975 38.0 36.0 38.0 29.0 38.0 14 35.937 38.0 37.0 38.0 31.0 38.0 15 36.23675 38.0 37.0 38.0 33.0 38.0 16 36.17925 38.0 37.0 38.0 33.0 38.0 17 36.211 38.0 37.0 38.0 33.0 38.0 18 36.13575 38.0 37.0 38.0 33.0 38.0 19 36.0545 38.0 37.0 38.0 32.0 38.0 20 36.312 38.0 37.0 38.0 33.0 38.0 21 36.1555 38.0 37.0 38.0 33.0 38.0 22 36.4225 38.0 37.0 38.0 34.0 38.0 23 35.771 38.0 37.0 38.0 31.0 38.0 24 36.058 38.0 37.0 38.0 32.0 38.0 25 36.28025 38.0 37.0 38.0 33.0 38.0 26 36.2085 38.0 37.0 38.0 33.0 38.0 27 35.58975 38.0 37.0 38.0 29.0 38.0 28 35.92325 38.0 37.0 38.0 31.0 38.0 29 36.06875 38.0 37.0 38.0 32.0 38.0 30 36.16475 38.0 37.0 38.0 33.0 38.0 31 36.25725 38.0 37.0 38.0 33.0 38.0 32 36.10275 38.0 37.0 38.0 33.0 38.0 33 36.19275 38.0 37.0 38.0 33.0 38.0 34 35.992 38.0 37.0 38.0 32.0 38.0 35 35.94775 38.0 37.0 38.0 31.0 38.0 36 35.7275 38.0 37.0 38.0 31.0 38.0 37 35.914 38.0 37.0 38.0 31.0 38.0 38 35.94025 38.0 37.0 38.0 31.0 38.0 39 36.09275 38.0 37.0 38.0 33.0 38.0 40 35.92475 38.0 37.0 38.0 31.0 38.0 41 35.505 38.0 36.0 38.0 29.0 38.0 42 35.36925 38.0 36.0 38.0 28.0 38.0 43 35.72575 38.0 37.0 38.0 29.0 38.0 44 35.779 38.0 37.0 38.0 31.0 38.0 45 36.18125 38.0 37.0 38.0 33.0 38.0 46 36.17575 38.0 37.0 38.0 33.0 38.0 47 36.065 38.0 37.0 38.0 33.0 38.0 48 36.1005 38.0 37.0 38.0 33.0 38.0 49 36.1635 38.0 37.0 38.0 33.0 38.0 50 36.3415 38.0 37.0 38.0 33.0 38.0 51 36.2245 38.0 37.0 38.0 33.0 38.0 52 35.69275 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 7.0 25 14.0 26 22.0 27 39.0 28 57.0 29 85.0 30 104.0 31 129.0 32 173.0 33 227.0 34 300.0 35 456.0 36 959.0 37 1424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.9117821195974 11.663706335109532 7.904085257548846 39.52042628774423 2 22.400000000000002 15.049999999999999 35.25 27.3 3 19.775000000000002 21.725 25.374999999999996 33.125 4 24.375 29.525000000000002 21.8 24.3 5 24.725 31.1 21.975 22.2 6 20.225 34.4 22.875 22.5 7 15.55 21.125 43.175000000000004 20.150000000000002 8 18.125 21.425 29.099999999999998 31.35 9 18.35 20.3 32.85 28.499999999999996 10 20.7 35.125 24.275 19.900000000000002 11 24.05 26.525 20.349999999999998 29.075 12 22.775000000000002 21.425 25.924999999999997 29.875 13 19.1 24.825 29.2 26.875 14 20.625 25.6 27.55 26.224999999999998 15 23.325000000000003 24.275 26.025 26.375 16 21.65 25.7 25.25 27.400000000000002 17 22.625 24.175 26.400000000000002 26.8 18 22.0 25.25 26.174999999999997 26.575 19 22.05 26.375 25.525 26.05 20 22.400000000000002 25.924999999999997 26.174999999999997 25.5 21 23.95 24.675 24.6 26.775 22 23.425 25.324999999999996 24.95 26.3 23 22.725 26.450000000000003 24.6 26.224999999999998 24 22.45 24.6 26.724999999999998 26.224999999999998 25 21.75 25.874999999999996 25.75 26.625 26 22.5 25.4 25.674999999999997 26.424999999999997 27 22.75 25.674999999999997 24.175 27.400000000000002 28 22.55 26.125 26.05 25.275 29 23.425 23.849999999999998 26.325 26.400000000000002 30 21.825 25.575 25.5 27.1 31 23.225 25.900000000000002 25.45 25.424999999999997 32 24.175 23.974999999999998 24.7 27.150000000000002 33 22.1 25.1 25.55 27.250000000000004 34 23.0 25.4 25.05 26.55 35 23.225 23.0 25.5 28.275 36 22.5 25.6 25.45 26.450000000000003 37 21.575 26.25 25.3 26.875 38 23.025000000000002 24.525 26.200000000000003 26.25 39 22.325 24.875 25.25 27.55 40 22.6 26.25 24.25 26.900000000000002 41 24.15 24.25 25.75 25.85 42 20.8 25.474999999999998 25.825 27.900000000000002 43 23.075000000000003 24.099999999999998 25.525 27.3 44 23.674999999999997 22.85 25.45 28.025 45 23.0 24.2 25.4 27.400000000000002 46 22.775000000000002 24.625 24.875 27.725 47 23.674999999999997 23.9 25.35 27.075 48 23.9 23.225 24.75 28.125 49 23.525 24.65 24.55 27.275 50 22.6 24.099999999999998 26.200000000000003 27.1 51 23.125 24.25 23.95 28.675 52 24.0 24.375 24.375 27.250000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 4.0 16 5.5 17 7.0 18 6.0 19 5.0 20 5.5 21 6.0 22 7.0 23 8.0 24 11.5 25 15.0 26 17.5 27 20.0 28 28.0 29 36.0 30 39.5 31 43.0 32 56.5 33 70.0 34 83.0 35 96.0 36 106.5 37 117.0 38 137.0 39 169.5 40 182.0 41 192.5 42 203.0 43 231.0 44 259.0 45 276.0 46 293.0 47 307.5 48 322.0 49 348.5 50 375.0 51 353.0 52 331.0 53 328.5 54 326.0 55 295.0 56 264.0 57 242.5 58 221.0 59 207.0 60 193.0 61 171.0 62 149.0 63 127.5 64 91.0 65 76.0 66 56.5 67 37.0 68 32.5 69 28.0 70 23.5 71 19.0 72 15.5 73 12.0 74 10.0 75 8.0 76 7.5 77 7.0 78 4.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.81266083376222 95.025 2 1.7241379310344827 3.35 3 0.28306742151312403 0.8250000000000001 4 0.12866700977869275 0.5 5 0.0 0.0 6 0.0514668039114771 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit GGGAGCCCCGTCAGGTCGCCAAACTACGACGAGAGTTTCGCCTTTTGAAGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474854 spots for SRR5423592.sra Written 1474854 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra Read 1474837 spots for SRR5423592.sra Written 1474837 spots for SRR5423592.sra SRR ids: ['SRR5423592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7a7h5q5l SRR5423592.sra spots: 29496757 blocks: [[1, 1474837], [1474838, 2949674], [2949675, 4424511], [4424512, 5899348], [5899349, 7374185], [7374186, 8849022], [8849023, 10323859], [10323860, 11798696], [11798697, 13273533], [13273534, 14748370], [14748371, 16223207], [16223208, 17698044], [17698045, 19172881], [19172882, 20647718], [20647719, 22122555], [22122556, 23597392], [23597393, 25072229], [25072230, 26547066], [26547067, 28021903], [28021904, 29496757]] SRR5423592 file size 5130760 SRR5423592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423592 SRR5423592_1.fastq Input file: SRR5423592_1.fastq trimmed: SRR5423592-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:34:56 2025 >> started Thu Feb 13 15:35:10 2025 >> done (13.590s) 29496757 reads processed; of these: 2266 ( 0.01%) short reads filtered out after trimming by size control 5146 ( 0.02%) empty reads filtered out after trimming by size control 29489345 (99.97%) reads available; of these: 2376 ( 0.01%) trimmed reads available after processing 29486969 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 43 0.00% 20 44 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 5 0.00% 49 0 0.00% 50 3 0.00% 51 2221 0.01% 52 29486969 99.99% 29489345 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=12 prefix-density=0.95 prefix-fanout=1.0 sequence=GGAGACCTTAGGCCAGCACCCCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=9.31 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=1.0 sequence=GGGAGACCTTAAGCCAGCACCCATCCT Started job on | Feb 13 15:35:25 Started mapping on | Feb 13 15:35:26 Finished on | Feb 13 15:36:01 Mapping speed, Million of reads per hour | 3033.19 Number of input reads | 29489345 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23903031 Uniquely mapped reads % | 81.06% Average mapped length | 51.84 Number of splices: Total | 2345122 Number of splices: Annotated (sjdb) | 2306946 Number of splices: GT/AG | 2312273 Number of splices: GC/AG | 26381 Number of splices: AT/AC | 1901 Number of splices: Non-canonical | 4567 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1779690 % of reads mapped to multiple loci | 6.04% Number of reads mapped to too many loci | 1189934 % of reads mapped to too many loci | 4.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.84% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3806624 3806624 3806624 N_multimapping 1779690 1779690 1779690 N_noFeature 3866060 23110067 4581225 N_ambiguous 145161 751 66704 UnstrandedReadsAssigned:19891810 PositiveStrandReadsAssigned:792213 NegativeStrandReadsAssigned:19255102 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423592 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423592-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,489,345 reads, 20,285,280 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR5423592.ke.tsv 34699 SRR5423592.se.tsv 87100 total ==> SRR5423592.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1998.63 62.1374 Potri.005G024800.1.v4.1 1035 936 91.0575 5.80412 Potri.004G059700.1.v4.1 961 862 38.4071 2.65828 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 523.474 10.9815 Potri.016G087400.1.v4.1 270 171 480 167.472 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 129.366 4.61065 Potri.012G127500.1.v4.1 977 878 643 43.6931 ==> SRR5423592.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 625 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 68 SRR5423592 completed mapping pipeline successfully