Starting /dee2/code/volunteer_pipeline.sh SRR5423593 current disk space = 3088827867136 free memory = 1440558208 SRR5423593 SRAfilesize e9055eb310576470b0bd054127dbefc3 SRR5423593.sra SRR5423593.sra file validated SRR5423593 is single end SRR5423593 is conventional basespace SRR5423593 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423593_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.30525 33.0 32.0 34.0 25.0 34.0 2 31.885 33.0 32.0 34.0 27.0 34.0 3 32.28525 33.0 32.0 34.0 28.0 34.0 4 30.62375 33.0 31.0 34.0 15.0 34.0 5 31.74975 33.0 32.0 34.0 27.0 34.0 6 35.011 38.0 35.0 38.0 28.0 38.0 7 34.8045 38.0 35.0 38.0 27.0 38.0 8 35.388 38.0 36.0 38.0 29.0 38.0 9 35.76575 38.0 36.0 38.0 31.0 38.0 10 35.26075 38.0 36.0 38.0 29.0 38.0 11 35.22775 38.0 36.0 38.0 29.0 38.0 12 35.61375 38.0 36.0 38.0 29.0 38.0 13 35.40225 38.0 36.0 38.0 29.0 38.0 14 34.9555 38.0 35.0 38.0 28.0 38.0 15 33.939 38.0 34.0 38.0 16.0 38.0 16 34.7365 38.0 34.0 38.0 28.0 38.0 17 35.572 38.0 36.0 38.0 29.0 38.0 18 35.64375 38.0 36.0 38.0 29.0 38.0 19 35.82025 38.0 36.0 38.0 31.0 38.0 20 35.80975 38.0 36.0 38.0 31.0 38.0 21 35.62975 38.0 36.0 38.0 29.0 38.0 22 29.57775 34.0 16.0 38.0 15.0 38.0 23 29.846 33.0 25.0 38.0 16.0 38.0 24 33.27325 37.0 29.0 38.0 25.0 38.0 25 34.6275 37.0 34.0 38.0 27.0 38.0 26 35.0335 38.0 35.0 38.0 28.0 38.0 27 34.45575 38.0 35.0 38.0 25.0 38.0 28 34.66225 38.0 35.0 38.0 27.0 38.0 29 28.9535 34.0 16.0 38.0 16.0 38.0 30 32.948 36.0 29.0 38.0 25.0 38.0 31 27.283 29.0 16.0 37.0 15.0 38.0 32 32.70425 36.0 28.0 38.0 25.0 38.0 33 34.40175 37.0 34.0 38.0 27.0 38.0 34 34.93475 38.0 35.0 38.0 27.0 38.0 35 35.57775 38.0 36.0 38.0 29.0 38.0 36 35.3265 38.0 36.0 38.0 29.0 38.0 37 35.07625 38.0 36.0 38.0 28.0 38.0 38 35.80525 38.0 36.0 38.0 29.0 38.0 39 35.37825 38.0 36.0 38.0 29.0 38.0 40 35.7035 38.0 36.0 38.0 31.0 38.0 41 36.075 38.0 37.0 38.0 32.0 38.0 42 36.0465 38.0 37.0 38.0 32.0 38.0 43 36.04525 38.0 37.0 38.0 31.0 38.0 44 35.5405 38.0 36.0 38.0 29.0 38.0 45 35.047 38.0 36.0 38.0 27.0 38.0 46 35.18575 38.0 36.0 38.0 28.0 38.0 47 35.763 38.0 36.0 38.0 29.0 38.0 48 36.23825 38.0 37.0 38.0 33.0 38.0 49 36.07575 38.0 37.0 38.0 32.0 38.0 50 35.894 38.0 37.0 38.0 31.0 38.0 51 35.9165 38.0 37.0 38.0 31.0 38.0 52 35.07675 38.0 35.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 4.0 24 13.0 25 20.0 26 39.0 27 52.0 28 80.0 29 101.0 30 168.0 31 218.0 32 292.0 33 396.0 34 540.0 35 746.0 36 971.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.78557976863061 12.536992198009148 6.4030131826742 40.274414850686036 2 21.425 15.625 36.925000000000004 26.025 3 19.875 21.475 25.474999999999998 33.175 4 25.724999999999998 27.85 22.2 24.224999999999998 5 23.724999999999998 34.125 22.225 19.925 6 20.45 34.25 22.95 22.35 7 15.825 21.349999999999998 43.3 19.525000000000002 8 17.474999999999998 19.400000000000002 31.1 32.025 9 18.475 19.7 31.874999999999996 29.95 10 20.349999999999998 35.875 23.1 20.674999999999997 11 23.775 25.624999999999996 22.375 28.225 12 21.9 22.3 26.974999999999998 28.825 13 20.95 23.625 28.799999999999997 26.625 14 21.775 23.95 27.500000000000004 26.775 15 22.0 22.2 30.225 25.575 16 22.95 24.675 26.150000000000002 26.224999999999998 17 23.724999999999998 23.375 25.575 27.325 18 21.25 25.3 26.200000000000003 27.250000000000004 19 23.599999999999998 25.124999999999996 24.075 27.200000000000003 20 22.95 23.974999999999998 26.900000000000002 26.174999999999997 21 22.75 23.95 26.35 26.950000000000003 22 20.175 22.825 33.550000000000004 23.45 23 21.5 25.15 27.525 25.825 24 22.975 23.025000000000002 25.35 28.65 25 22.05 25.6 24.85 27.500000000000004 26 23.225 24.075 26.674999999999997 26.025 27 22.5 23.525 25.775 28.199999999999996 28 22.5 25.474999999999998 26.375 25.650000000000002 29 23.225 21.6 30.475 24.7 30 22.15 23.35 26.200000000000003 28.299999999999997 31 20.724999999999998 22.425 32.9 23.95 32 23.075000000000003 24.075 26.450000000000003 26.400000000000002 33 23.674999999999997 23.9 25.174999999999997 27.250000000000004 34 23.325000000000003 24.349999999999998 25.874999999999996 26.450000000000003 35 23.05 24.425 25.2 27.325 36 21.925 24.525 24.25 29.299999999999997 37 22.125 25.074999999999996 24.875 27.925 38 22.775000000000002 24.425 25.525 27.275 39 21.7 25.775 24.4 28.125 40 22.375 25.674999999999997 26.025 25.924999999999997 41 23.825 24.6 25.0 26.575 42 22.8 23.125 26.450000000000003 27.625 43 23.625 24.5 24.5 27.375 44 21.825 24.099999999999998 26.424999999999997 27.650000000000002 45 22.45 23.775 26.474999999999998 27.3 46 22.35 24.275 25.575 27.800000000000004 47 23.525 23.05 26.125 27.3 48 23.799999999999997 22.6 26.0 27.6 49 22.8 23.825 25.8 27.575 50 22.400000000000002 23.799999999999997 25.174999999999997 28.625 51 22.375 23.425 25.074999999999996 29.125 52 23.375 24.4 26.224999999999998 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 3.5 21 6.0 22 10.5 23 15.0 24 14.0 25 13.0 26 20.0 27 27.0 28 32.0 29 37.0 30 40.0 31 43.0 32 51.5 33 60.0 34 76.5 35 93.0 36 108.0 37 123.0 38 136.0 39 162.5 40 176.0 41 191.5 42 207.0 43 238.0 44 269.0 45 280.0 46 291.0 47 318.5 48 346.0 49 330.5 50 315.0 51 344.0 52 373.0 53 355.0 54 337.0 55 310.0 56 283.0 57 260.5 58 238.0 59 203.5 60 169.0 61 153.0 62 137.0 63 115.5 64 81.5 65 69.0 66 56.0 67 43.0 68 35.5 69 28.0 70 23.0 71 18.0 72 15.0 73 12.0 74 11.0 75 10.0 76 8.5 77 7.0 78 6.0 79 5.0 80 2.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24280666330137 98.3 2 0.6814740030287734 1.35 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439440 spots for SRR5423593.sra Written 1439440 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra Read 1439426 spots for SRR5423593.sra Written 1439426 spots for SRR5423593.sra SRR ids: ['SRR5423593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t1_4lb2_ SRR5423593.sra spots: 28788534 blocks: [[1, 1439426], [1439427, 2878852], [2878853, 4318278], [4318279, 5757704], [5757705, 7197130], [7197131, 8636556], [8636557, 10075982], [10075983, 11515408], [11515409, 12954834], [12954835, 14394260], [14394261, 15833686], [15833687, 17273112], [17273113, 18712538], [18712539, 20151964], [20151965, 21591390], [21591391, 23030816], [23030817, 24470242], [24470243, 25909668], [25909669, 27349094], [27349095, 28788534]] SRR5423593 file size 5007339 SRR5423593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423593 SRR5423593_1.fastq Input file: SRR5423593_1.fastq trimmed: SRR5423593-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:36:44 2025 >> started Thu Feb 13 15:36:56 2025 >> done (12.168s) 28788534 reads processed; of these: 2049 ( 0.01%) short reads filtered out after trimming by size control 2968 ( 0.01%) empty reads filtered out after trimming by size control 28783517 (99.98%) reads available; of these: 1835 ( 0.01%) trimmed reads available after processing 28781682 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 59 0.00% 20 44 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 4 0.00% 50 11 0.00% 51 1657 0.01% 52 28781682 99.99% 28783517 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.69 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=1.0 sequence=TGCGGATCCAGGTGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCACGACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=9.07 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.5 sequence=CCAGCACCCCTCCT Started job on | Feb 13 15:37:10 Started mapping on | Feb 13 15:37:10 Finished on | Feb 13 15:37:48 Mapping speed, Million of reads per hour | 2726.86 Number of input reads | 28783517 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23348903 Uniquely mapped reads % | 81.12% Average mapped length | 51.83 Number of splices: Total | 2221285 Number of splices: Annotated (sjdb) | 2185448 Number of splices: GT/AG | 2189835 Number of splices: GC/AG | 25261 Number of splices: AT/AC | 1796 Number of splices: Non-canonical | 4393 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1681091 % of reads mapped to multiple loci | 5.84% Number of reads mapped to too many loci | 1169893 % of reads mapped to too many loci | 4.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.95% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3753523 3753523 3753523 N_multimapping 1681091 1681091 1681091 N_noFeature 4007972 22321618 4954512 N_ambiguous 148244 637 66961 UnstrandedReadsAssigned:19192687 PositiveStrandReadsAssigned:1026648 NegativeStrandReadsAssigned:18327430 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423593 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423593-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,783,517 reads, 19,017,489 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,330 rounds 52401 SRR5423593.ke.tsv 34699 SRR5423593.se.tsv 87100 total ==> SRR5423593.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1569 51.8536 Potri.005G024800.1.v4.1 1035 936 76.0657 5.15399 Potri.004G059700.1.v4.1 961 862 42 3.0901 Potri.007G009000.2.v4.1 1416 1317 1 0.0481554 Potri.003G141000.2.v4.1 2943 2844 454.179 10.1281 Potri.016G087400.1.v4.1 270 171 418 155.028 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 112.959 4.27955 Potri.012G127500.1.v4.1 977 878 698 50.4187 ==> SRR5423593.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 663 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 89 SRR5423593 completed mapping pipeline successfully