Starting /dee2/code/volunteer_pipeline.sh SRR5423594 current disk space = 3088922087424 free memory = 1577340676 SRR5423594 SRAfilesize 48478ea6ebff02a7c2a4d468e0cbd6d2 SRR5423594.sra SRR5423594.sra file validated SRR5423594 is single end SRR5423594 is conventional basespace SRR5423594 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.606 33.0 31.0 34.0 2.0 34.0 2 31.508 33.0 31.0 34.0 27.0 34.0 3 31.7525 33.0 32.0 34.0 27.0 34.0 4 30.31775 33.0 31.0 34.0 15.0 34.0 5 31.70175 33.0 32.0 34.0 27.0 34.0 6 35.09725 38.0 35.0 38.0 29.0 38.0 7 35.614 38.0 36.0 38.0 30.0 38.0 8 35.61475 38.0 36.0 38.0 30.0 38.0 9 36.13325 38.0 37.0 38.0 32.0 38.0 10 36.0365 38.0 37.0 38.0 31.0 38.0 11 36.03875 38.0 37.0 38.0 31.0 38.0 12 35.9925 38.0 37.0 38.0 31.0 38.0 13 35.6615 38.0 36.0 38.0 29.0 38.0 14 35.91125 38.0 37.0 38.0 31.0 38.0 15 36.185 38.0 37.0 38.0 33.0 38.0 16 36.089 38.0 37.0 38.0 33.0 38.0 17 36.142 38.0 37.0 38.0 33.0 38.0 18 36.10575 38.0 37.0 38.0 33.0 38.0 19 35.94025 38.0 37.0 38.0 31.0 38.0 20 36.3165 38.0 37.0 38.0 33.0 38.0 21 36.23875 38.0 37.0 38.0 33.0 38.0 22 36.386 38.0 37.0 38.0 33.0 38.0 23 35.83225 38.0 37.0 38.0 31.0 38.0 24 36.0435 38.0 37.0 38.0 32.0 38.0 25 36.2495 38.0 37.0 38.0 33.0 38.0 26 36.19025 38.0 37.0 38.0 33.0 38.0 27 35.596 38.0 36.0 38.0 29.0 38.0 28 35.89225 38.0 37.0 38.0 31.0 38.0 29 36.00225 38.0 37.0 38.0 31.0 38.0 30 36.16225 38.0 37.0 38.0 33.0 38.0 31 36.21925 38.0 37.0 38.0 33.0 38.0 32 36.1345 38.0 37.0 38.0 32.0 38.0 33 36.21425 38.0 37.0 38.0 33.0 38.0 34 35.91325 38.0 37.0 38.0 31.0 38.0 35 35.92825 38.0 37.0 38.0 31.0 38.0 36 35.74725 38.0 37.0 38.0 31.0 38.0 37 35.818 38.0 37.0 38.0 31.0 38.0 38 36.00125 38.0 37.0 38.0 31.0 38.0 39 36.2305 38.0 37.0 38.0 33.0 38.0 40 35.943 38.0 37.0 38.0 31.0 38.0 41 35.5995 38.0 36.0 38.0 29.0 38.0 42 35.54925 38.0 37.0 38.0 29.0 38.0 43 35.70925 38.0 37.0 38.0 29.0 38.0 44 35.87575 38.0 37.0 38.0 31.0 38.0 45 36.16175 38.0 37.0 38.0 33.0 38.0 46 36.14525 38.0 37.0 38.0 33.0 38.0 47 36.0265 38.0 37.0 38.0 31.0 38.0 48 36.135 38.0 37.0 38.0 33.0 38.0 49 36.1725 38.0 37.0 38.0 33.0 38.0 50 36.304 38.0 37.0 38.0 33.0 38.0 51 36.2295 38.0 37.0 38.0 33.0 38.0 52 35.733 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 3.0 24 9.0 25 10.0 26 26.0 27 36.0 28 53.0 29 72.0 30 111.0 31 140.0 32 164.0 33 220.0 34 279.0 35 471.0 36 951.0 37 1452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.69113329418673 13.534938344098649 6.048150322959484 38.72577803875514 2 21.15 16.475 36.8 25.575 3 21.349999999999998 20.125 25.25 33.275 4 25.0 28.225 22.925 23.849999999999998 5 24.55 33.525 21.8 20.125 6 20.25 32.025 23.25 24.474999999999998 7 15.299999999999999 21.975 43.0 19.725 8 17.4 19.775000000000002 31.85 30.975 9 18.0 19.7 32.175 30.125 10 20.0 35.449999999999996 23.325000000000003 21.224999999999998 11 24.725 26.1 21.125 28.050000000000004 12 23.474999999999998 21.95 26.025 28.549999999999997 13 21.85 24.625 27.1 26.424999999999997 14 21.15 25.7 27.6 25.55 15 21.95 23.974999999999998 27.0 27.075 16 21.825 25.900000000000002 25.85 26.424999999999997 17 23.200000000000003 22.95 26.200000000000003 27.650000000000002 18 20.1 24.725 27.150000000000002 28.025 19 22.6 24.65 25.8 26.950000000000003 20 22.725 24.125 25.674999999999997 27.474999999999998 21 22.225 24.15 25.900000000000002 27.725 22 22.075 25.624999999999996 24.9 27.400000000000002 23 22.325 26.325 24.175 27.175 24 21.15 24.7 26.55 27.6 25 22.6 24.8 24.175 28.425 26 23.175 25.4 25.324999999999996 26.1 27 22.2 24.425 24.6 28.775000000000002 28 22.575 24.349999999999998 27.05 26.025 29 23.200000000000003 25.2 24.575 27.025 30 22.1 24.6 26.125 27.175 31 23.474999999999998 24.525 25.3 26.700000000000003 32 24.95 24.0 25.074999999999996 25.974999999999998 33 23.225 24.7 25.275 26.8 34 23.05 25.6 24.75 26.6 35 23.875 23.674999999999997 25.1 27.35 36 21.975 24.05 25.05 28.925 37 23.075000000000003 25.374999999999996 24.6 26.950000000000003 38 22.85 25.1 25.324999999999996 26.724999999999998 39 22.05 25.0 24.175 28.775000000000002 40 22.275 25.5 25.825 26.400000000000002 41 23.875 24.075 25.35 26.700000000000003 42 23.225 22.575 26.8 27.400000000000002 43 23.724999999999998 24.6 24.925 26.75 44 24.3 22.925 25.174999999999997 27.6 45 22.6 24.55 24.5 28.349999999999998 46 23.875 23.549999999999997 25.924999999999997 26.650000000000002 47 24.55 23.425 24.6 27.425 48 23.175 23.150000000000002 25.25 28.425 49 22.15 25.525 25.95 26.375 50 22.875 24.0 24.6 28.525 51 22.45 23.549999999999997 25.674999999999997 28.325 52 22.225 25.174999999999997 25.7 26.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 4.0 13 2.5 14 1.0 15 1.0 16 2.0 17 3.0 18 2.5 19 2.0 20 4.5 21 7.0 22 8.0 23 9.0 24 9.0 25 9.0 26 14.5 27 20.0 28 24.0 29 28.0 30 32.0 31 36.0 32 52.0 33 68.0 34 78.0 35 88.0 36 98.0 37 108.0 38 128.5 39 176.0 40 203.0 41 202.0 42 201.0 43 225.5 44 250.0 45 272.5 46 295.0 47 318.5 48 342.0 49 353.0 50 364.0 51 344.5 52 325.0 53 335.0 54 345.0 55 304.5 56 264.0 57 248.5 58 233.0 59 211.5 60 190.0 61 169.5 62 149.0 63 122.0 64 89.0 65 83.0 66 62.5 67 42.0 68 33.5 69 25.0 70 19.0 71 13.0 72 15.0 73 17.0 74 14.5 75 12.0 76 11.5 77 11.0 78 6.0 79 1.0 80 1.5 81 2.0 82 2.5 83 3.0 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.75309917355372 94.625 2 1.7303719008264464 3.35 3 0.23243801652892562 0.675 4 0.10330578512396695 0.4 5 0.10330578512396695 0.5 6 0.07747933884297521 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit GTTCATATTAGGGAAAGGAGAGCACGGGGAAGAGGGGGCTCGGCCCGATCAT 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 5 0.125 No Hit CTCTGCCACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439757 spots for SRR5423594.sra Written 1439757 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra Read 1439740 spots for SRR5423594.sra Written 1439740 spots for SRR5423594.sra SRR ids: ['SRR5423594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mi1hi35d SRR5423594.sra spots: 28794817 blocks: [[1, 1439740], [1439741, 2879480], [2879481, 4319220], [4319221, 5758960], [5758961, 7198700], [7198701, 8638440], [8638441, 10078180], [10078181, 11517920], [11517921, 12957660], [12957661, 14397400], [14397401, 15837140], [15837141, 17276880], [17276881, 18716620], [18716621, 20156360], [20156361, 21596100], [21596101, 23035840], [23035841, 24475580], [24475581, 25915320], [25915321, 27355060], [27355061, 28794817]] SRR5423594 file size 5008401 SRR5423594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423594 SRR5423594_1.fastq Input file: SRR5423594_1.fastq trimmed: SRR5423594-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 16:13:09 2025 >> started Thu Feb 13 16:13:22 2025 >> done (13.022s) 28794817 reads processed; of these: 2167 ( 0.01%) short reads filtered out after trimming by size control 3048 ( 0.01%) empty reads filtered out after trimming by size control 28789602 (99.98%) reads available; of these: 2289 ( 0.01%) trimmed reads available after processing 28787313 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 50 0.00% 19 41 0.00% 20 45 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 0 0.00% 50 3 0.00% 51 2149 0.01% 52 28787313 99.99% 28789602 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.69 fanout-score-rank=29 prefix-density=0.68 prefix-fanout=1.0 sequence=TGCGGATCCAGGTGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCACGACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=7.66 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=1.2 sequence=GGTTTCCCGATTCGGATACTCTCGGATCAAAGCGTGTTTGCCGCTCCCCGAGATTTTTCGC Started job on | Feb 13 16:13:34 Started mapping on | Feb 13 16:13:34 Finished on | Feb 13 16:14:17 Mapping speed, Million of reads per hour | 2410.29 Number of input reads | 28789602 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23369783 Uniquely mapped reads % | 81.17% Average mapped length | 51.84 Number of splices: Total | 2229261 Number of splices: Annotated (sjdb) | 2193540 Number of splices: GT/AG | 2197290 Number of splices: GC/AG | 25624 Number of splices: AT/AC | 1897 Number of splices: Non-canonical | 4450 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1683900 % of reads mapped to multiple loci | 5.85% Number of reads mapped to too many loci | 1171888 % of reads mapped to too many loci | 4.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.88% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3735919 3735919 3735919 N_multimapping 1683900 1683900 1683900 N_noFeature 4011943 22343636 4957106 N_ambiguous 148191 632 66654 UnstrandedReadsAssigned:19209649 PositiveStrandReadsAssigned:1025515 NegativeStrandReadsAssigned:18346023 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423594 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423594-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,789,602 reads, 19,264,350 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52401 SRR5423594.ke.tsv 34699 SRR5423594.se.tsv 87100 total ==> SRR5423594.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1607.92 52.4174 Potri.005G024800.1.v4.1 1035 936 74.016 4.94694 Potri.004G059700.1.v4.1 961 862 45 3.26582 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 462.455 10.1725 Potri.016G087400.1.v4.1 270 171 351.717 128.672 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 117.74 4.40005 Potri.012G127500.1.v4.1 977 878 662 47.1683 ==> SRR5423594.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 643 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 89 SRR5423594 completed mapping pipeline successfully