Starting /dee2/code/volunteer_pipeline.sh SRR5423595 current disk space = 3088816721920 free memory = 1491656060 SRR5423595 SRAfilesize 4063d2620c8f7128ae2dd5ace5def2cd SRR5423595.sra SRR5423595.sra file validated SRR5423595 is single end SRR5423595 is conventional basespace SRR5423595 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423595_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.46875 33.0 32.0 34.0 18.0 34.0 2 31.7615 33.0 32.0 34.0 27.0 34.0 3 32.08875 33.0 32.0 34.0 27.0 34.0 4 30.6675 33.0 31.0 34.0 15.0 34.0 5 31.82625 33.0 32.0 34.0 28.0 34.0 6 35.093 38.0 35.0 38.0 29.0 38.0 7 34.98425 38.0 35.0 38.0 28.0 38.0 8 35.582 38.0 36.0 38.0 29.0 38.0 9 35.81525 38.0 36.0 38.0 31.0 38.0 10 35.4245 38.0 36.0 38.0 29.0 38.0 11 35.426 38.0 36.0 38.0 29.0 38.0 12 35.83175 38.0 36.0 38.0 31.0 38.0 13 35.482 38.0 36.0 38.0 29.0 38.0 14 34.88375 38.0 35.0 38.0 28.0 38.0 15 33.7425 38.0 34.0 38.0 16.0 38.0 16 34.64375 38.0 34.0 38.0 27.0 38.0 17 35.522 38.0 36.0 38.0 29.0 38.0 18 35.7085 38.0 36.0 38.0 29.0 38.0 19 35.90125 38.0 37.0 38.0 31.0 38.0 20 35.892 38.0 36.0 38.0 31.0 38.0 21 35.717 38.0 36.0 38.0 31.0 38.0 22 29.55625 34.0 16.0 38.0 15.0 38.0 23 29.697 33.0 25.0 38.0 16.0 38.0 24 33.157 36.0 29.0 38.0 25.0 38.0 25 34.54925 37.0 34.0 38.0 27.0 38.0 26 34.8325 38.0 35.0 38.0 27.0 38.0 27 34.396 38.0 34.0 38.0 25.0 38.0 28 34.6355 38.0 34.0 38.0 27.0 38.0 29 28.778 34.0 16.0 38.0 16.0 38.0 30 32.874 36.0 29.0 38.0 25.0 38.0 31 27.301 29.0 16.0 37.0 15.0 38.0 32 32.5645 36.0 28.0 38.0 25.0 38.0 33 34.484 37.0 34.0 38.0 27.0 38.0 34 35.02025 38.0 35.0 38.0 28.0 38.0 35 35.55025 38.0 36.0 38.0 29.0 38.0 36 35.32075 38.0 36.0 38.0 29.0 38.0 37 35.07125 38.0 36.0 38.0 27.0 38.0 38 35.786 38.0 37.0 38.0 29.0 38.0 39 35.62525 38.0 36.0 38.0 29.0 38.0 40 35.72475 38.0 37.0 38.0 30.0 38.0 41 36.185 38.0 37.0 38.0 33.0 38.0 42 36.13125 38.0 37.0 38.0 33.0 38.0 43 36.039 38.0 37.0 38.0 31.0 38.0 44 35.61425 38.0 37.0 38.0 29.0 38.0 45 35.166 38.0 36.0 38.0 28.0 38.0 46 35.0465 38.0 36.0 38.0 27.0 38.0 47 35.81225 38.0 37.0 38.0 29.0 38.0 48 36.2075 38.0 37.0 38.0 33.0 38.0 49 36.16425 38.0 37.0 38.0 33.0 38.0 50 36.007 38.0 37.0 38.0 32.0 38.0 51 35.90225 38.0 37.0 38.0 31.0 38.0 52 35.12175 38.0 35.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 5.0 24 12.0 25 21.0 26 31.0 27 58.0 28 85.0 29 128.0 30 151.0 31 184.0 32 280.0 33 396.0 34 556.0 35 768.0 36 965.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.033268644302744 11.422234543942334 7.319101746603826 41.22539506515109 2 21.175 15.875 36.625 26.325 3 19.825 20.150000000000002 25.724999999999998 34.300000000000004 4 25.874999999999996 28.15 22.025 23.95 5 25.25 33.050000000000004 21.8 19.900000000000002 6 19.900000000000002 33.550000000000004 22.825 23.724999999999998 7 16.55 19.025 44.15 20.275000000000002 8 17.599999999999998 20.9 30.625000000000004 30.875000000000004 9 19.225 19.8 32.975 28.000000000000004 10 22.05 33.800000000000004 22.650000000000002 21.5 11 23.375 24.75 22.325 29.549999999999997 12 23.25 22.375 26.05 28.325 13 20.674999999999997 24.275 26.6 28.449999999999996 14 20.825 25.674999999999997 28.000000000000004 25.5 15 21.375 23.425 28.849999999999998 26.35 16 23.1 24.525 25.45 26.924999999999997 17 23.025000000000002 24.224999999999998 26.1 26.650000000000002 18 22.175 24.875 25.45 27.500000000000004 19 21.95 24.575 26.025 27.450000000000003 20 23.75 24.55 25.650000000000002 26.05 21 22.1 23.95 24.7 29.25 22 20.775 22.675 31.95 24.6 23 22.875 23.925 29.425 23.775 24 22.875 24.85 24.775 27.500000000000004 25 23.849999999999998 23.75 24.375 28.025 26 23.025000000000002 24.45 25.575 26.950000000000003 27 22.85 24.45 26.025 26.674999999999997 28 23.0 24.575 25.95 26.474999999999998 29 25.5 21.3 29.175 24.025 30 21.75 23.75 27.750000000000004 26.75 31 22.025 21.5 31.974999999999998 24.5 32 24.575 24.775 25.25 25.4 33 23.95 23.200000000000003 26.1 26.75 34 22.475 24.55 25.25 27.725 35 23.35 23.925 24.875 27.85 36 22.875 24.0 24.875 28.249999999999996 37 22.825 24.7 24.575 27.900000000000002 38 23.5 24.375 25.424999999999997 26.700000000000003 39 22.775000000000002 24.375 25.275 27.575 40 23.599999999999998 24.85 25.874999999999996 25.674999999999997 41 24.625 24.05 25.775 25.55 42 21.95 23.5 26.150000000000002 28.4 43 24.075 23.474999999999998 24.525 27.925 44 22.45 23.45 26.224999999999998 27.875 45 21.875 24.075 25.525 28.525 46 22.85 24.675 24.625 27.85 47 23.674999999999997 23.674999999999997 25.85 26.8 48 22.075 24.8 25.825 27.3 49 22.75 24.325 25.275 27.650000000000002 50 22.525000000000002 23.150000000000002 25.2 29.125 51 21.95 23.724999999999998 25.15 29.175 52 23.75 23.45 24.9 27.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 3.0 21 5.0 22 7.5 23 10.0 24 14.5 25 19.0 26 17.5 27 16.0 28 28.0 29 40.0 30 43.5 31 47.0 32 48.5 33 50.0 34 67.5 35 85.0 36 102.5 37 120.0 38 136.5 39 176.5 40 200.0 41 213.0 42 226.0 43 241.0 44 256.0 45 269.0 46 282.0 47 306.5 48 331.0 49 340.0 50 349.0 51 346.5 52 344.0 53 345.5 54 347.0 55 302.0 56 257.0 57 224.5 58 192.0 59 179.5 60 167.0 61 158.0 62 149.0 63 120.5 64 81.5 65 71.0 66 57.5 67 44.0 68 42.5 69 41.0 70 34.5 71 28.0 72 28.5 73 29.0 74 21.0 75 13.0 76 11.0 77 9.0 78 11.0 79 13.0 80 8.0 81 3.0 82 2.5 83 2.0 84 2.5 85 3.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.825000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.856416772554 97.25 2 0.8386277001270648 1.6500000000000001 3 0.20330368487928843 0.6 4 0.07623888182973317 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025412960609911054 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866963 spots for SRR5423595.sra Written 1866963 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra Read 1866951 spots for SRR5423595.sra Written 1866951 spots for SRR5423595.sra SRR ids: ['SRR5423595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xe2zn9jn SRR5423595.sra spots: 37339032 blocks: [[1, 1866951], [1866952, 3733902], [3733903, 5600853], [5600854, 7467804], [7467805, 9334755], [9334756, 11201706], [11201707, 13068657], [13068658, 14935608], [14935609, 16802559], [16802560, 18669510], [18669511, 20536461], [20536462, 22403412], [22403413, 24270363], [24270364, 26137314], [26137315, 28004265], [28004266, 29871216], [29871217, 31738167], [31738168, 33605118], [33605119, 35472069], [35472070, 37339032]] SRR5423595 file size 6497799 SRR5423595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423595 SRR5423595_1.fastq Input file: SRR5423595_1.fastq trimmed: SRR5423595-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:46:18 2025 >> started Thu Feb 13 15:46:37 2025 >> done (18.625s) 37339032 reads processed; of these: 3688 ( 0.01%) short reads filtered out after trimming by size control 6596 ( 0.02%) empty reads filtered out after trimming by size control 37328748 (99.97%) reads available; of these: 2277 ( 0.01%) trimmed reads available after processing 37326471 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 72 0.00% 19 86 0.00% 20 76 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 3 0.00% 50 5 0.00% 51 2034 0.01% 52 37326471 99.99% 37328748 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=1.1 sequence=GGAGACCTTAGGCCAGCACCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=11.68 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.9 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCG Started job on | Feb 13 15:46:56 Started mapping on | Feb 13 15:46:56 Finished on | Feb 13 15:48:16 Mapping speed, Million of reads per hour | 1679.79 Number of input reads | 37328748 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 28181504 Uniquely mapped reads % | 75.50% Average mapped length | 51.83 Number of splices: Total | 2594430 Number of splices: Annotated (sjdb) | 2539713 Number of splices: GT/AG | 2554055 Number of splices: GC/AG | 32769 Number of splices: AT/AC | 2204 Number of splices: Non-canonical | 5402 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2037987 % of reads mapped to multiple loci | 5.46% Number of reads mapped to too many loci | 2084145 % of reads mapped to too many loci | 5.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.44% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7109257 7109257 7109257 N_multimapping 2037987 2037987 2037987 N_noFeature 5185883 27200756 6087814 N_ambiguous 157023 904 77411 UnstrandedReadsAssigned:22838598 PositiveStrandReadsAssigned:979844 NegativeStrandReadsAssigned:22016279 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423595 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423595-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,328,748 reads, 23,119,693 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,368 rounds 52401 SRR5423595.ke.tsv 34699 SRR5423595.se.tsv 87100 total ==> SRR5423595.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3504.84 92.984 Potri.005G024800.1.v4.1 1035 936 426.222 23.1833 Potri.004G059700.1.v4.1 961 862 5 0.295309 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 508.424 9.10146 Potri.016G087400.1.v4.1 270 171 310.738 92.5152 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 213.376 6.48939 Potri.012G127500.1.v4.1 977 878 1038 60.189 ==> SRR5423595.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 735 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 70 SRR5423595 completed mapping pipeline successfully