Starting /dee2/code/volunteer_pipeline.sh SRR5423596 current disk space = 3088865087488 free memory = 1450050536 SRR5423596 SRAfilesize 1696a90ca8a395c0481deda1a1208c66 SRR5423596.sra SRR5423596.sra file validated SRR5423596 is single end SRR5423596 is conventional basespace SRR5423596 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423596_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5685 33.0 27.0 34.0 2.0 34.0 2 31.22625 33.0 28.0 34.0 27.0 34.0 3 31.4545 33.0 31.0 34.0 27.0 34.0 4 30.19125 33.0 31.0 34.0 15.0 34.0 5 31.68675 33.0 32.0 34.0 27.0 34.0 6 34.97475 38.0 35.0 38.0 28.0 38.0 7 35.37675 38.0 36.0 38.0 29.0 38.0 8 35.6065 38.0 36.0 38.0 29.0 38.0 9 36.069 38.0 37.0 38.0 31.0 38.0 10 35.819 38.0 37.0 38.0 31.0 38.0 11 35.90275 38.0 37.0 38.0 31.0 38.0 12 35.89 38.0 37.0 38.0 31.0 38.0 13 35.2655 38.0 36.0 38.0 29.0 38.0 14 35.86 38.0 37.0 38.0 31.0 38.0 15 36.04825 38.0 37.0 38.0 32.0 38.0 16 35.9765 38.0 37.0 38.0 31.0 38.0 17 36.15575 38.0 37.0 38.0 33.0 38.0 18 35.97125 38.0 37.0 38.0 31.0 38.0 19 35.8375 38.0 37.0 38.0 31.0 38.0 20 36.06775 38.0 37.0 38.0 32.0 38.0 21 36.151 38.0 37.0 38.0 33.0 38.0 22 36.3415 38.0 37.0 38.0 33.0 38.0 23 35.73525 38.0 37.0 38.0 29.0 38.0 24 36.031 38.0 37.0 38.0 31.0 38.0 25 36.18425 38.0 37.0 38.0 33.0 38.0 26 36.1555 38.0 37.0 38.0 33.0 38.0 27 35.6995 38.0 37.0 38.0 29.0 38.0 28 35.90875 38.0 37.0 38.0 31.0 38.0 29 36.0805 38.0 37.0 38.0 31.0 38.0 30 36.06925 38.0 37.0 38.0 32.0 38.0 31 36.0125 38.0 37.0 38.0 31.0 38.0 32 35.96525 38.0 37.0 38.0 31.0 38.0 33 36.18175 38.0 37.0 38.0 33.0 38.0 34 35.86375 38.0 37.0 38.0 31.0 38.0 35 35.786 38.0 37.0 38.0 31.0 38.0 36 35.58525 38.0 36.0 38.0 29.0 38.0 37 35.78325 38.0 37.0 38.0 31.0 38.0 38 35.86025 38.0 37.0 38.0 31.0 38.0 39 36.0185 38.0 37.0 38.0 31.0 38.0 40 35.91725 38.0 37.0 38.0 31.0 38.0 41 35.613 38.0 37.0 38.0 29.0 38.0 42 35.48775 38.0 36.0 38.0 29.0 38.0 43 35.83175 38.0 37.0 38.0 31.0 38.0 44 35.8225 38.0 37.0 38.0 31.0 38.0 45 36.20075 38.0 37.0 38.0 33.0 38.0 46 36.19575 38.0 37.0 38.0 33.0 38.0 47 36.096 38.0 37.0 38.0 33.0 38.0 48 36.0355 38.0 37.0 38.0 31.0 38.0 49 36.16375 38.0 37.0 38.0 33.0 38.0 50 36.2255 38.0 37.0 38.0 33.0 38.0 51 36.10025 38.0 37.0 38.0 33.0 38.0 52 35.67 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 4.0 22 2.0 23 3.0 24 11.0 25 13.0 26 23.0 27 51.0 28 52.0 29 78.0 30 98.0 31 133.0 32 164.0 33 240.0 34 319.0 35 480.0 36 998.0 37 1330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.564817652467056 11.860251302482379 7.477781182960467 41.0971498620901 2 22.2 14.975 37.8 25.025 3 20.599999999999998 20.599999999999998 25.45 33.35 4 24.825 28.075 22.925 24.175 5 24.825 30.925000000000004 23.05 21.2 6 20.625 31.025000000000002 24.275 24.075 7 16.725 20.775 41.725 20.775 8 18.15 19.475 30.85 31.525 9 19.55 20.200000000000003 31.45 28.799999999999997 10 21.025 35.025 23.35 20.599999999999998 11 25.45 24.875 19.975 29.7 12 23.175 21.375 26.35 29.099999999999998 13 21.325 24.4 27.224999999999998 27.05 14 21.725 25.424999999999997 26.3 26.55 15 23.0 25.15 24.875 26.974999999999998 16 23.474999999999998 23.849999999999998 25.324999999999996 27.35 17 22.925 24.474999999999998 25.2 27.400000000000002 18 22.25 25.025 25.924999999999997 26.8 19 22.400000000000002 24.825 24.85 27.925 20 23.400000000000002 24.9 26.5 25.2 21 22.925 23.525 25.775 27.775 22 22.325 24.425 25.2 28.050000000000004 23 23.025000000000002 25.124999999999996 25.95 25.900000000000002 24 23.05 23.3 26.625 27.025 25 22.125 24.5 25.374999999999996 28.000000000000004 26 23.5 22.525000000000002 26.200000000000003 27.775 27 23.400000000000002 23.0 25.75 27.85 28 23.65 22.95 25.4 28.000000000000004 29 22.475 23.3 26.55 27.675 30 23.35 23.150000000000002 25.2 28.299999999999997 31 23.400000000000002 23.05 26.125 27.425 32 23.9 23.925 25.4 26.775 33 23.45 23.549999999999997 24.675 28.325 34 22.925 24.075 26.150000000000002 26.85 35 23.05 24.875 25.224999999999998 26.85 36 23.400000000000002 23.125 24.95 28.525 37 24.099999999999998 23.1 24.45 28.349999999999998 38 21.95 24.875 26.674999999999997 26.5 39 23.425 22.75 25.874999999999996 27.950000000000003 40 24.075 23.799999999999997 25.074999999999996 27.05 41 23.5 24.65 25.074999999999996 26.775 42 23.25 23.0 25.4 28.349999999999998 43 23.525 24.275 24.275 27.925 44 23.599999999999998 23.1 26.474999999999998 26.825 45 23.9 23.875 24.325 27.900000000000002 46 22.15 24.7 24.65 28.499999999999996 47 23.799999999999997 22.2 25.674999999999997 28.325 48 23.7 22.575 26.275 27.450000000000003 49 22.925 23.325000000000003 25.724999999999998 28.025 50 22.975 23.775 24.6 28.65 51 23.849999999999998 23.65 23.799999999999997 28.7 52 23.075000000000003 24.099999999999998 24.275 28.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.5 19 3.0 20 2.5 21 2.0 22 5.5 23 9.0 24 7.5 25 6.0 26 13.0 27 20.0 28 28.0 29 36.0 30 38.0 31 40.0 32 45.5 33 51.0 34 64.0 35 77.0 36 94.5 37 112.0 38 133.5 39 172.5 40 190.0 41 204.0 42 218.0 43 226.5 44 235.0 45 257.0 46 279.0 47 298.5 48 318.0 49 334.5 50 351.0 51 329.5 52 308.0 53 310.0 54 312.0 55 300.0 56 288.0 57 264.5 58 241.0 59 216.5 60 192.0 61 174.5 62 157.0 63 129.5 64 98.5 65 95.0 66 77.5 67 60.0 68 45.0 69 30.0 70 31.0 71 32.0 72 28.5 73 25.0 74 20.5 75 16.0 76 15.5 77 15.0 78 13.0 79 11.0 80 7.0 81 3.0 82 3.0 83 3.0 84 2.5 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7313740654808 94.77499999999999 2 1.7530291312193864 3.4000000000000004 3 0.3351379221448827 0.975 4 0.10311936065996391 0.4 5 0.025779840164990978 0.125 6 0.025779840164990978 0.15 7 0.025779840164990978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit CCCTACTGAAGATTATGAAGGCGAGCACTGAAACACGAAAGGCTTGTAGACT 6 0.15 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865632 spots for SRR5423596.sra Written 1865632 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra Read 1865627 spots for SRR5423596.sra Written 1865627 spots for SRR5423596.sra SRR ids: ['SRR5423596.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ftga8n41 SRR5423596.sra spots: 37312545 blocks: [[1, 1865627], [1865628, 3731254], [3731255, 5596881], [5596882, 7462508], [7462509, 9328135], [9328136, 11193762], [11193763, 13059389], [13059390, 14925016], [14925017, 16790643], [16790644, 18656270], [18656271, 20521897], [20521898, 22387524], [22387525, 24253151], [24253152, 26118778], [26118779, 27984405], [27984406, 29850032], [29850033, 31715659], [31715660, 33581286], [33581287, 35446913], [35446914, 37312545]] SRR5423596 file size 6493143 SRR5423596 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423596 SRR5423596_1.fastq Input file: SRR5423596_1.fastq trimmed: SRR5423596-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:34:10 2025 >> started Thu Feb 13 15:34:35 2025 >> done (24.935s) 37312545 reads processed; of these: 3658 ( 0.01%) short reads filtered out after trimming by size control 6757 ( 0.02%) empty reads filtered out after trimming by size control 37302130 (99.97%) reads available; of these: 3096 ( 0.01%) trimmed reads available after processing 37299034 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 94 0.00% 19 91 0.00% 20 75 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 3 0.00% 49 0 0.00% 50 7 0.00% 51 2826 0.01% 52 37299034 99.99% 37302130 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=13 prefix-density=0.85 prefix-fanout=1.0 sequence=GGAGACCTTAGGCCAGCACCCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=17.47 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.2 sequence=TCATCTTCCTTCAAAGCACACTTAGGGTGAAGATCAAAGTCACATTGTTTGCAATAGAAAGACCACCTATATCCCGTTTCCCCACAGCCATCGCAACCGTATGCACTGCGTTTAGTACGTATCAGCTCATGCTCAGTATGAAGTTCGTGTTTCACTTTCTCTGGCCACCCCTTTGCCTTTTCCTCAAGCTCCTCCTCCAATTGCTTTAGATGTTCCTCGGTAAATGGAAAAGCATCTGCCCCGTAAGCTGTCAAGTGCATCCGAGCTTCCTTGGTAATGGTCCGGCCACTTGGG Started job on | Feb 13 15:34:51 Started mapping on | Feb 13 15:34:51 Finished on | Feb 13 15:35:44 Mapping speed, Million of reads per hour | 2533.73 Number of input reads | 37302130 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 28190331 Uniquely mapped reads % | 75.57% Average mapped length | 51.83 Number of splices: Total | 2599641 Number of splices: Annotated (sjdb) | 2544896 Number of splices: GT/AG | 2559140 Number of splices: GC/AG | 32817 Number of splices: AT/AC | 2250 Number of splices: Non-canonical | 5434 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2035412 % of reads mapped to multiple loci | 5.46% Number of reads mapped to too many loci | 2087086 % of reads mapped to too many loci | 5.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.35% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7076387 7076387 7076387 N_multimapping 2035412 2035412 2035412 N_noFeature 5184218 27213360 6082542 N_ambiguous 157523 923 78065 UnstrandedReadsAssigned:22848590 PositiveStrandReadsAssigned:976048 NegativeStrandReadsAssigned:22029724 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423596 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423596-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,302,130 reads, 23,429,118 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,370 rounds 52401 SRR5423596.ke.tsv 34699 SRR5423596.se.tsv 87100 total ==> SRR5423596.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3461.54 90.5929 Potri.005G024800.1.v4.1 1035 936 460.096 24.6873 Potri.004G059700.1.v4.1 961 862 3 0.174789 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 576.424 10.1792 Potri.016G087400.1.v4.1 270 171 316 92.8092 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 243.344 7.3007 Potri.012G127500.1.v4.1 977 878 1054 60.2901 ==> SRR5423596.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 740 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 63 SRR5423596 completed mapping pipeline successfully