Starting /dee2/code/volunteer_pipeline.sh SRR5423597 current disk space = 3088790294528 free memory = 1532776084 SRR5423597 SRAfilesize 2a0316a62f4c7d8235b2ed01e226f0e1 SRR5423597.sra SRR5423597.sra file validated SRR5423597 is single end SRR5423597 is conventional basespace SRR5423597 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423597_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.90075 33.0 32.0 34.0 18.0 34.0 2 31.873 33.0 32.0 34.0 27.0 34.0 3 32.2295 33.0 32.0 34.0 28.0 34.0 4 30.71675 33.0 31.0 34.0 15.0 34.0 5 31.81725 33.0 32.0 34.0 28.0 34.0 6 34.90825 38.0 35.0 38.0 28.0 38.0 7 34.765 38.0 35.0 38.0 27.0 38.0 8 35.2815 38.0 36.0 38.0 29.0 38.0 9 35.693 38.0 36.0 38.0 30.0 38.0 10 35.39825 38.0 36.0 38.0 29.0 38.0 11 35.1455 38.0 36.0 38.0 29.0 38.0 12 35.58 38.0 36.0 38.0 29.0 38.0 13 35.5065 38.0 36.0 38.0 29.0 38.0 14 34.9525 38.0 35.0 38.0 28.0 38.0 15 33.6935 38.0 33.0 38.0 16.0 38.0 16 34.53375 38.0 34.0 38.0 27.0 38.0 17 35.32875 38.0 36.0 38.0 28.0 38.0 18 35.54975 38.0 36.0 38.0 29.0 38.0 19 35.75175 38.0 36.0 38.0 29.0 38.0 20 35.72525 38.0 36.0 38.0 29.0 38.0 21 35.58175 38.0 36.0 38.0 29.0 38.0 22 29.05375 34.0 16.0 38.0 15.0 38.0 23 29.31225 31.0 16.0 38.0 16.0 38.0 24 32.99975 36.0 29.0 38.0 25.0 38.0 25 34.48725 37.0 34.0 38.0 27.0 38.0 26 34.865 38.0 35.0 38.0 27.0 38.0 27 34.48375 38.0 34.0 38.0 25.0 38.0 28 34.55925 38.0 34.0 38.0 27.0 38.0 29 28.81775 34.0 16.0 38.0 15.0 38.0 30 32.9585 37.0 29.0 38.0 25.0 38.0 31 27.11125 28.0 16.0 37.0 15.0 38.0 32 32.485 36.0 28.0 38.0 25.0 38.0 33 34.32575 37.0 34.0 38.0 27.0 38.0 34 34.9325 38.0 35.0 38.0 27.0 38.0 35 35.50175 38.0 36.0 38.0 29.0 38.0 36 35.228 38.0 36.0 38.0 28.0 38.0 37 35.1535 38.0 36.0 38.0 28.0 38.0 38 35.94875 38.0 37.0 38.0 31.0 38.0 39 35.51 38.0 36.0 38.0 29.0 38.0 40 35.717 38.0 36.0 38.0 29.0 38.0 41 36.13975 38.0 37.0 38.0 33.0 38.0 42 36.022 38.0 37.0 38.0 33.0 38.0 43 35.973 38.0 37.0 38.0 31.0 38.0 44 35.506 38.0 37.0 38.0 29.0 38.0 45 35.131 38.0 36.0 38.0 27.0 38.0 46 35.146 38.0 36.0 38.0 27.0 38.0 47 35.83225 38.0 36.0 38.0 30.0 38.0 48 36.22325 38.0 37.0 38.0 33.0 38.0 49 36.201 38.0 37.0 38.0 33.0 38.0 50 35.84425 38.0 37.0 38.0 31.0 38.0 51 35.7845 38.0 37.0 38.0 30.0 38.0 52 35.01325 38.0 35.0 38.0 28.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 4.0 23 5.0 24 12.0 25 27.0 26 32.0 27 54.0 28 84.0 29 115.0 30 164.0 31 220.0 32 281.0 33 384.0 34 543.0 35 840.0 36 906.0 37 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25854993160055 12.366621067031463 7.387140902872777 38.98768809849521 2 21.3 16.2 36.775000000000006 25.724999999999998 3 20.9 21.175 24.7 33.225 4 27.125 28.050000000000004 21.175 23.65 5 25.174999999999997 31.45 21.575 21.8 6 20.625 32.475 22.650000000000002 24.25 7 16.675 19.925 42.3 21.099999999999998 8 17.549999999999997 20.4 30.525000000000002 31.525 9 18.725 20.9 32.175 28.199999999999996 10 22.45 34.075 22.475 21.0 11 24.099999999999998 24.575 20.45 30.875000000000004 12 24.4 21.25 25.2 29.15 13 20.75 24.5 26.55 28.199999999999996 14 22.875 23.65 27.525 25.95 15 23.150000000000002 22.900000000000002 29.299999999999997 24.65 16 23.425 23.825 24.7 28.050000000000004 17 23.75 24.099999999999998 24.825 27.325 18 22.875 24.474999999999998 26.025 26.625 19 23.525 24.55 24.075 27.85 20 23.575 24.45 25.45 26.525 21 23.225 23.25 26.224999999999998 27.3 22 21.475 21.4 33.074999999999996 24.05 23 22.5 24.099999999999998 28.249999999999996 25.15 24 23.95 25.174999999999997 23.825 27.05 25 24.15 25.374999999999996 23.599999999999998 26.875 26 22.650000000000002 25.650000000000002 25.4 26.3 27 24.425 24.125 23.625 27.825 28 23.35 25.025 24.8 26.825 29 25.5 22.525000000000002 28.349999999999998 23.625 30 23.150000000000002 22.925 26.424999999999997 27.500000000000004 31 21.625 22.25 31.15 24.975 32 24.275 25.6 24.075 26.05 33 23.05 24.95 24.9 27.1 34 22.775000000000002 25.0 24.75 27.474999999999998 35 23.35 23.425 24.875 28.349999999999998 36 21.85 25.124999999999996 25.0 28.025 37 23.275000000000002 24.3 25.374999999999996 27.05 38 24.05 24.325 24.725 26.900000000000002 39 23.400000000000002 23.025000000000002 25.3 28.275 40 23.549999999999997 24.5 25.15 26.8 41 24.275 25.05 23.275000000000002 27.400000000000002 42 24.5 22.650000000000002 25.6 27.250000000000004 43 24.75 23.674999999999997 24.725 26.85 44 24.224999999999998 23.95 24.45 27.375 45 23.724999999999998 25.874999999999996 22.650000000000002 27.750000000000004 46 24.425 24.325 25.275 25.974999999999998 47 24.95 23.525 23.95 27.575 48 23.425 24.65 24.75 27.175 49 22.95 24.75 23.799999999999997 28.499999999999996 50 22.775000000000002 25.974999999999998 23.775 27.474999999999998 51 24.4 24.975 24.15 26.474999999999998 52 24.575 23.7 23.3 28.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 2.0 20 4.0 21 6.0 22 7.5 23 9.0 24 13.0 25 17.0 26 22.0 27 27.0 28 34.5 29 42.0 30 41.0 31 40.0 32 48.0 33 56.0 34 71.5 35 87.0 36 102.0 37 117.0 38 135.5 39 162.5 40 171.0 41 187.5 42 204.0 43 233.0 44 262.0 45 262.0 46 262.0 47 280.5 48 299.0 49 301.5 50 304.0 51 321.0 52 338.0 53 325.5 54 313.0 55 287.5 56 262.0 57 243.5 58 225.0 59 213.5 60 202.0 61 181.5 62 161.0 63 143.5 64 107.5 65 89.0 66 76.0 67 63.0 68 52.5 69 42.0 70 37.5 71 33.0 72 33.0 73 33.0 74 23.0 75 13.0 76 14.5 77 16.0 78 12.5 79 9.0 80 8.5 81 8.0 82 5.5 83 3.0 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70327993897789 97.05 2 1.0678871090770405 2.1 3 0.10170353419781336 0.3 4 0.07627765064836003 0.3 5 0.05085176709890668 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563377 spots for SRR5423597.sra Written 1563377 spots for SRR5423597.sra Read 1563395 spots for SRR5423597.sra Written 1563395 spots for SRR5423597.sra SRR ids: ['SRR5423597.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x81eekfa SRR5423597.sra spots: 31267558 blocks: [[1, 1563377], [1563378, 3126754], [3126755, 4690131], [4690132, 6253508], [6253509, 7816885], [7816886, 9380262], [9380263, 10943639], [10943640, 12507016], [12507017, 14070393], [14070394, 15633770], [15633771, 17197147], [17197148, 18760524], [18760525, 20323901], [20323902, 21887278], [21887279, 23450655], [23450656, 25014032], [25014033, 26577409], [26577410, 28140786], [28140787, 29704163], [29704164, 31267558]] SRR5423597 file size 5439469 SRR5423597 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423597 SRR5423597_1.fastq Input file: SRR5423597_1.fastq trimmed: SRR5423597-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:50:08 2025 >> started Thu Feb 13 15:50:22 2025 >> done (14.122s) 31267558 reads processed; of these: 2136 ( 0.01%) short reads filtered out after trimming by size control 6316 ( 0.02%) empty reads filtered out after trimming by size control 31259106 (99.97%) reads available; of these: 1834 ( 0.01%) trimmed reads available after processing 31257272 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 41 0.00% 20 45 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 3 0.00% 50 10 0.00% 51 1682 0.01% 52 31257272 99.99% 31259106 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.62 fanout-score-rank=27 prefix-density=0.53 prefix-fanout=1.0 sequence=TGCGGATCCAGGTGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCACGACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=10.52 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.0 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCGT Started job on | Feb 13 15:50:40 Started mapping on | Feb 13 15:50:41 Finished on | Feb 13 15:51:24 Mapping speed, Million of reads per hour | 2617.04 Number of input reads | 31259106 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23743977 Uniquely mapped reads % | 75.96% Average mapped length | 51.82 Number of splices: Total | 2116385 Number of splices: Annotated (sjdb) | 2071285 Number of splices: GT/AG | 2082964 Number of splices: GC/AG | 26865 Number of splices: AT/AC | 1999 Number of splices: Non-canonical | 4557 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1554350 % of reads mapped to multiple loci | 4.97% Number of reads mapped to too many loci | 2110131 % of reads mapped to too many loci | 6.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.30% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5960779 5960779 5960779 N_multimapping 1554350 1554350 1554350 N_noFeature 4425834 22613426 5492614 N_ambiguous 128286 804 63822 UnstrandedReadsAssigned:19189857 PositiveStrandReadsAssigned:1129747 NegativeStrandReadsAssigned:18187541 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423597 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423597-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,259,106 reads, 19,318,529 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52401 SRR5423597.ke.tsv 34699 SRR5423597.se.tsv 87100 total ==> SRR5423597.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2712.74 85.2476 Potri.005G024800.1.v4.1 1035 936 200.1 12.892 Potri.004G059700.1.v4.1 961 862 6.16529 0.431315 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 440.612 9.34276 Potri.016G087400.1.v4.1 270 171 238 83.9324 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 148.524 5.35046 Potri.012G127500.1.v4.1 977 878 962 66.0738 ==> SRR5423597.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 527 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 59 SRR5423597 completed mapping pipeline successfully