Starting /dee2/code/volunteer_pipeline.sh SRR5423598 current disk space = 3088837967872 free memory = 1494783376 SRR5423598 SRAfilesize a3e0fd6201f1ebe4ffa33bed228edfd4 SRR5423598.sra SRR5423598.sra file validated SRR5423598 is single end SRR5423598 is conventional basespace SRR5423598 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423598_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.1585 33.0 28.0 34.0 2.0 34.0 2 31.28125 33.0 30.0 34.0 27.0 34.0 3 31.561 33.0 32.0 34.0 27.0 34.0 4 30.15175 33.0 31.0 34.0 15.0 34.0 5 31.66025 33.0 32.0 34.0 27.0 34.0 6 34.94075 38.0 35.0 38.0 28.0 38.0 7 35.57775 38.0 36.0 38.0 29.0 38.0 8 35.4235 38.0 36.0 38.0 29.0 38.0 9 35.96975 38.0 37.0 38.0 31.0 38.0 10 35.8095 38.0 37.0 38.0 31.0 38.0 11 36.087 38.0 37.0 38.0 31.0 38.0 12 35.9695 38.0 37.0 38.0 31.0 38.0 13 35.5685 38.0 36.0 38.0 29.0 38.0 14 35.89875 38.0 37.0 38.0 31.0 38.0 15 36.2025 38.0 37.0 38.0 33.0 38.0 16 36.0745 38.0 37.0 38.0 33.0 38.0 17 36.0885 38.0 37.0 38.0 32.0 38.0 18 36.0095 38.0 37.0 38.0 31.0 38.0 19 36.0375 38.0 37.0 38.0 31.0 38.0 20 36.073 38.0 37.0 38.0 33.0 38.0 21 36.202 38.0 37.0 38.0 33.0 38.0 22 36.2985 38.0 37.0 38.0 33.0 38.0 23 35.579 38.0 37.0 38.0 29.0 38.0 24 36.011 38.0 37.0 38.0 31.0 38.0 25 36.07675 38.0 37.0 38.0 33.0 38.0 26 36.0125 38.0 37.0 38.0 31.0 38.0 27 35.6555 38.0 37.0 38.0 29.0 38.0 28 35.87375 38.0 37.0 38.0 31.0 38.0 29 35.89925 38.0 37.0 38.0 31.0 38.0 30 36.1 38.0 37.0 38.0 33.0 38.0 31 36.1145 38.0 37.0 38.0 33.0 38.0 32 36.11275 38.0 37.0 38.0 32.0 38.0 33 36.0525 38.0 37.0 38.0 32.0 38.0 34 35.87475 38.0 37.0 38.0 31.0 38.0 35 35.9915 38.0 37.0 38.0 33.0 38.0 36 35.62525 38.0 37.0 38.0 29.0 38.0 37 35.8035 38.0 37.0 38.0 29.0 38.0 38 35.8045 38.0 37.0 38.0 31.0 38.0 39 36.13475 38.0 37.0 38.0 33.0 38.0 40 35.88925 38.0 37.0 38.0 31.0 38.0 41 35.362 38.0 36.0 38.0 29.0 38.0 42 35.33925 38.0 36.0 38.0 28.0 38.0 43 35.676 38.0 36.0 38.0 29.0 38.0 44 35.6485 38.0 36.0 38.0 29.0 38.0 45 36.038 38.0 37.0 38.0 32.0 38.0 46 36.047 38.0 37.0 38.0 33.0 38.0 47 35.90775 38.0 37.0 38.0 31.0 38.0 48 36.04375 38.0 37.0 38.0 32.0 38.0 49 36.302 38.0 37.0 38.0 33.0 38.0 50 36.20475 38.0 37.0 38.0 33.0 38.0 51 36.239 38.0 37.0 38.0 33.0 38.0 52 35.587 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 5.0 24 3.0 25 15.0 26 26.0 27 35.0 28 70.0 29 86.0 30 121.0 31 131.0 32 158.0 33 244.0 34 312.0 35 439.0 36 963.0 37 1390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.47681331747919 11.920332936979786 8.263971462544589 40.33888228299644 2 22.775000000000002 15.475 34.025 27.725 3 20.8 20.599999999999998 25.174999999999997 33.425 4 25.025 28.349999999999998 22.25 24.375 5 25.174999999999997 30.25 22.875 21.7 6 20.150000000000002 32.675 23.9 23.275000000000002 7 16.400000000000002 21.275 42.225 20.1 8 17.875 21.025 30.2 30.9 9 19.75 19.25 32.475 28.525 10 20.974999999999998 35.075 22.575 21.375 11 25.0 24.025 20.349999999999998 30.625000000000004 12 23.575 22.3 26.25 27.875 13 22.05 24.975 26.025 26.950000000000003 14 21.25 26.075 26.974999999999998 25.7 15 23.3 22.975 25.874999999999996 27.85 16 21.7 24.625 26.1 27.575 17 22.95 24.975 24.875 27.200000000000003 18 22.0 23.525 25.674999999999997 28.799999999999997 19 23.7 24.7 24.075 27.525 20 23.575 24.474999999999998 26.0 25.95 21 22.400000000000002 24.425 25.474999999999998 27.700000000000003 22 24.025 24.125 24.2 27.650000000000002 23 21.85 25.174999999999997 25.05 27.925 24 23.525 23.575 24.575 28.325 25 23.25 23.474999999999998 25.25 28.025 26 23.875 22.7 26.1 27.325 27 22.6 24.275 25.1 28.025 28 23.05 25.074999999999996 26.0 25.874999999999996 29 23.05 23.974999999999998 24.9 28.075 30 23.225 23.075000000000003 24.675 29.025000000000002 31 22.95 23.875 25.85 27.325 32 24.4 24.45 24.425 26.724999999999998 33 24.075 23.599999999999998 24.675 27.650000000000002 34 22.375 23.75 25.1 28.775000000000002 35 23.400000000000002 23.075000000000003 25.6 27.925 36 22.0 24.6 24.75 28.65 37 22.575 24.0 25.525 27.900000000000002 38 23.1 23.65 25.25 28.000000000000004 39 23.474999999999998 23.35 24.95 28.225 40 22.475 25.05 24.5 27.975 41 24.075 24.25 24.875 26.8 42 22.900000000000002 23.925 24.725 28.449999999999996 43 23.974999999999998 23.474999999999998 24.725 27.825 44 23.625 22.625 24.9 28.849999999999998 45 22.85 22.55 26.0 28.599999999999998 46 22.825 23.775 23.95 29.45 47 24.175 23.325000000000003 24.825 27.675 48 23.0 23.799999999999997 24.95 28.249999999999996 49 23.474999999999998 23.5 24.15 28.875 50 23.375 24.25 24.175 28.199999999999996 51 22.8 23.474999999999998 25.7 28.025 52 24.4 23.724999999999998 24.4 27.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 2.0 15 4.0 16 2.5 17 1.0 18 2.0 19 3.0 20 4.5 21 6.0 22 8.5 23 11.0 24 11.0 25 11.0 26 18.5 27 26.0 28 29.0 29 32.0 30 37.5 31 43.0 32 44.5 33 46.0 34 64.0 35 82.0 36 97.0 37 112.0 38 128.0 39 149.0 40 154.0 41 184.5 42 215.0 43 216.5 44 218.0 45 247.5 46 277.0 47 299.5 48 322.0 49 334.5 50 347.0 51 342.5 52 338.0 53 336.0 54 334.0 55 297.5 56 261.0 57 230.0 58 199.0 59 192.0 60 185.0 61 183.0 62 181.0 63 150.5 64 104.0 65 88.0 66 79.0 67 70.0 68 59.0 69 48.0 70 37.5 71 27.0 72 29.0 73 31.0 74 28.0 75 25.0 76 21.5 77 18.0 78 14.0 79 10.0 80 8.0 81 6.0 82 4.0 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.96129032258064 94.89999999999999 2 1.4709677419354839 2.85 3 0.25806451612903225 0.75 4 0.15483870967741936 0.6 5 0.025806451612903226 0.125 6 0.1032258064516129 0.6 7 0.025806451612903226 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 7 0.17500000000000002 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 6 0.15 No Hit CCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCT 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit GTTCAATTAGATCAGCCCATCAGGCCATGCGGATCCAGGTGGCACCGGCCCG 6 0.15 No Hit GTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra Read 1551098 spots for SRR5423598.sra Written 1551098 spots for SRR5423598.sra Read 1551086 spots for SRR5423598.sra Written 1551086 spots for SRR5423598.sra SRR ids: ['SRR5423598.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_csuqv71t SRR5423598.sra spots: 31021732 blocks: [[1, 1551086], [1551087, 3102172], [3102173, 4653258], [4653259, 6204344], [6204345, 7755430], [7755431, 9306516], [9306517, 10857602], [10857603, 12408688], [12408689, 13959774], [13959775, 15510860], [15510861, 17061946], [17061947, 18613032], [18613033, 20164118], [20164119, 21715204], [21715205, 23266290], [23266291, 24817376], [24817377, 26368462], [26368463, 27919548], [27919549, 29470634], [29470635, 31021732]] SRR5423598 file size 5396586 SRR5423598 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423598 SRR5423598_1.fastq Input file: SRR5423598_1.fastq trimmed: SRR5423598-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 16:01:44 2025 >> started Thu Feb 13 16:01:57 2025 >> done (13.475s) 31021732 reads processed; of these: 2272 ( 0.01%) short reads filtered out after trimming by size control 6123 ( 0.02%) empty reads filtered out after trimming by size control 31013337 (99.97%) reads available; of these: 2377 ( 0.01%) trimmed reads available after processing 31010960 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 42 0.00% 20 35 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 4 0.00% 49 0 0.00% 50 3 0.00% 51 2246 0.01% 52 31010960 99.99% 31013337 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.67 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=1.0 sequence=TGCGGATCCAGGTGGCACCGGCCCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACCAGCCTCACGCTGTGCCCTCCCCTCTAGGAGCCACGACACCCAGGTCTTCACTAGGATGCCTTGGCTCAACTCCTGGCTTGGAACGGGCGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=11.56 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.9 sequence=CCCCGAGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGGGAGGCACTCGGTCCTCCGGATTTTCAAGGGCCGCCGGGGGCGCACCGGACACCACGCGACGTGCGGTGCTCTTCCAGCCGCTGGACCCTACCTCCGACTAAGTCGTTTCCAGGGTGGGCGGGCTGTTAAACAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTCAGGAATTTTAACCCGATTCCCTTTCGAAGCTCGCGCGCGAACGCGCTGTCGGACGGGCTTCCCCCGTCTC Started job on | Feb 13 16:02:15 Started mapping on | Feb 13 16:02:15 Finished on | Feb 13 16:02:56 Mapping speed, Million of reads per hour | 2723.12 Number of input reads | 31013337 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 23583454 Uniquely mapped reads % | 76.04% Average mapped length | 51.83 Number of splices: Total | 2105486 Number of splices: Annotated (sjdb) | 2060554 Number of splices: GT/AG | 2071979 Number of splices: GC/AG | 27008 Number of splices: AT/AC | 1994 Number of splices: Non-canonical | 4505 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1541705 % of reads mapped to multiple loci | 4.97% Number of reads mapped to too many loci | 2094822 % of reads mapped to too many loci | 6.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.21% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5888178 5888178 5888178 N_multimapping 1541705 1541705 1541705 N_noFeature 4393433 22461449 5451822 N_ambiguous 126570 803 62260 UnstrandedReadsAssigned:19063451 PositiveStrandReadsAssigned:1121202 NegativeStrandReadsAssigned:18069372 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423598 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423598-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,013,337 reads, 19,424,786 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52401 SRR5423598.ke.tsv 34699 SRR5423598.se.tsv 87100 total ==> SRR5423598.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2662.01 83.188 Potri.005G024800.1.v4.1 1035 936 225.141 14.4246 Potri.004G059700.1.v4.1 961 862 2 0.139139 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 451.045 9.51079 Potri.016G087400.1.v4.1 270 171 261.803 91.813 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 165.615 5.93295 Potri.012G127500.1.v4.1 977 878 1009 68.9164 ==> SRR5423598.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 557 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 58 SRR5423598 completed mapping pipeline successfully