Starting /dee2/code/volunteer_pipeline.sh SRR5683094 current disk space = 3050615357440 free memory = 1577386172 SRR5683094 SRAfilesize 8873b2f0189e02a3b8093f661042acd1 SRR5683094.sra SRR5683094.sra file validated SRR5683094 is paired end SRR5683094 is conventional basespace SRR5683094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5683094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.40175 34.0 33.0 34.0 33.0 34.0 2 33.49575 34.0 34.0 34.0 33.0 34.0 3 33.51475 34.0 34.0 34.0 33.0 34.0 4 33.48375 34.0 34.0 34.0 33.0 34.0 5 33.522 34.0 34.0 34.0 33.0 34.0 6 37.24225 38.0 38.0 38.0 36.0 38.0 7 37.38875 38.0 38.0 38.0 37.0 38.0 8 37.4735 38.0 38.0 38.0 37.0 38.0 9 37.46575 38.0 38.0 38.0 37.0 38.0 10-14 37.468199999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.46865 38.0 38.0 38.0 37.2 38.0 20-24 37.44665 38.0 38.0 38.0 37.2 38.0 25-29 37.27025 38.0 38.0 38.0 37.0 38.0 30-34 37.23085 38.0 38.0 38.0 36.8 38.0 35-39 37.1315 38.0 38.0 38.0 36.4 38.0 40-44 36.7526 38.0 38.0 38.0 35.0 38.0 45-49 36.82595 38.0 38.0 38.0 35.2 38.0 50-54 36.804649999999995 38.0 38.0 38.0 35.0 38.0 55-59 36.8622 38.0 38.0 38.0 35.4 38.0 60-64 36.827000000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.689499999999995 38.0 38.0 38.0 34.6 38.0 70-74 36.503949999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.5644 38.0 38.0 38.0 34.0 38.0 80-84 36.459050000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.252399999999994 38.0 37.2 38.0 33.2 38.0 90-94 35.9423 38.0 37.0 38.0 32.6 38.0 95-99 35.7168 38.0 37.0 38.0 30.6 38.0 100-104 35.68150000000001 38.0 36.6 38.0 30.6 38.0 105-109 35.540350000000004 38.0 36.2 38.0 30.0 38.0 110-114 35.211349999999996 38.0 35.8 38.0 28.4 38.0 115-119 34.8578 38.0 35.4 38.0 27.4 38.0 120-124 34.48864999999999 38.0 35.0 38.0 25.2 38.0 125-129 34.062599999999996 38.0 34.4 38.0 23.6 38.0 130-134 33.5641 38.0 34.0 38.0 19.4 38.0 135-139 32.80305 38.0 33.2 38.0 14.8 38.0 140-144 32.2136 37.8 32.6 38.0 13.8 38.0 145-149 30.904149999999998 36.8 30.4 38.0 8.6 38.0 150-151 25.60325 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 2.0 18 6.0 19 4.0 20 5.0 21 8.0 22 8.0 23 16.0 24 19.0 25 31.0 26 29.0 27 43.0 28 42.0 29 54.0 30 86.0 31 96.0 32 99.0 33 140.0 34 201.0 35 361.0 36 875.0 37 1867.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.43526170798898 15.276734284998748 10.919108439769596 39.368895567242674 2 19.35 22.6 36.75 21.3 3 17.9 24.725 27.3 30.075000000000003 4 20.95 34.0 22.85 22.2 5 20.775 36.775000000000006 23.974999999999998 18.475 6 17.375 34.675 26.775 21.175 7 13.25 22.1 44.025 20.625 8 17.724999999999998 23.674999999999997 29.599999999999998 28.999999999999996 9 16.55 22.875 32.975 27.6 10-14 19.425 29.044999999999998 26.86 24.67 15-19 19.435 28.49 27.884999999999998 24.19 20-24 19.245 28.54 28.49 23.724999999999998 25-29 19.79 29.299999999999997 27.16 23.75 30-34 19.296929692969297 28.702870287028702 28.147814781478147 23.85238523852385 35-39 19.34564010205613 28.71579368652759 28.240532292761017 23.69803391865526 40-44 19.799749687108886 29.216520650813514 27.639549436795996 23.3441802252816 45-49 20.020015011258444 28.901676257192893 27.585689266950215 23.492619464598448 50-54 19.85194818186365 29.335267343570248 27.32456359725904 23.488220877307057 55-59 19.74394878975795 28.62572514502901 28.065613122624526 23.564712942588518 60-64 19.684921230307577 29.067266816704173 27.666916729182294 23.58089522380595 65-69 20.043017206882755 28.736494597839133 27.841136454581832 23.37935174069628 70-74 20.09901980396079 28.755751150230047 27.525505101020205 23.61972394478896 75-79 20.08504252126063 28.199099549774886 27.888944472236116 23.826913456728363 80-84 19.43471735867934 29.004502251125565 27.788894447223612 23.771885942971487 85-89 20.200100050025014 28.289144572286144 27.958979489744873 23.551775887943972 90-94 20.256654468895686 29.114241315354157 27.008872625194247 23.620231590555917 95-99 20.249736723333836 28.19818464470187 28.258362168396772 23.293716463567524 100-104 20.18105431629489 29.043713113934178 27.598279483845158 23.176953085925778 105-109 20.182063722302807 28.2798979642875 28.029810433651782 23.508227879757914 110-114 20.22702270227023 28.277827782778274 27.4977497749775 23.997399739974 115-119 20.504100820164034 28.390678135627123 27.370474094818963 23.73474694938988 120-124 20.417041704170416 28.277827782778274 27.467746774677465 23.837383738373838 125-129 20.663393125563683 28.314460366770216 27.653071450045097 23.369075057621007 130-134 20.541031593822552 28.823054405975572 27.31906732613304 23.316846674068838 135-139 20.41658281344335 28.14449587442141 28.063996780036227 23.374924532099016 140-144 20.82790417961311 28.395309211185726 27.52831512478701 23.24847148441415 145-149 20.330528543356678 29.062326800020156 27.45503098705094 23.152113669572227 150-151 19.79244811202801 29.069767441860467 27.631907976994246 23.50587646911728 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 8.0 27 11.0 28 10.0 29 13.5 30 23.5 31 32.5 32 37.0 33 47.5 34 68.0 35 79.0 36 99.0 37 128.0 38 135.0 39 156.0 40 198.5 41 238.5 42 246.0 43 250.5 44 276.0 45 274.5 46 255.5 47 239.5 48 235.0 49 200.5 50 155.5 51 131.0 52 108.0 53 89.0 54 64.5 55 42.5 56 32.0 57 26.5 58 18.5 59 15.5 60 14.0 61 10.0 62 6.5 63 5.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.055 40-44 0.125 45-49 0.075 50-54 0.034999999999999996 55-59 0.02 60-64 0.025 65-69 0.04 70-74 0.02 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.255 95-99 0.295 100-104 0.03 105-109 0.034999999999999996 110-114 0.01 115-119 0.02 120-124 0.01 125-129 0.21 130-134 0.9299999999999999 135-139 0.62 140-144 0.22999999999999998 145-149 0.765 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.2625 0.0 0.0 0.0 0.0 138-139 5.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTGAA 10 0.0069790767 143.96251 4 ATTTATC 10 0.0069790767 143.96251 6 >>END_MODULE SRR5683094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5683094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.322 33.0 33.0 34.0 32.0 34.0 2 32.4155 33.0 33.0 34.0 32.0 34.0 3 32.38425 34.0 33.0 34.0 32.0 34.0 4 32.52475 34.0 33.0 34.0 32.0 34.0 5 32.4695 34.0 33.0 34.0 32.0 34.0 6 36.64975 38.0 38.0 38.0 36.0 38.0 7 36.646 38.0 38.0 38.0 36.0 38.0 8 36.848 38.0 38.0 38.0 36.0 38.0 9 36.87625 38.0 38.0 38.0 36.0 38.0 10-14 36.924499999999995 38.0 38.0 38.0 36.6 38.0 15-19 36.70225 38.0 38.0 38.0 36.0 38.0 20-24 36.41754999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.4756 38.0 38.0 38.0 35.8 38.0 30-34 36.564299999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.53835 38.0 38.0 38.0 36.0 38.0 40-44 36.63435 38.0 38.0 38.0 36.0 38.0 45-49 36.430049999999994 38.0 38.0 38.0 35.8 38.0 50-54 36.47579999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.43770000000001 38.0 38.0 38.0 35.4 38.0 60-64 36.29845 38.0 38.0 38.0 34.8 38.0 65-69 35.82905 38.0 38.0 38.0 33.6 38.0 70-74 36.17555 38.0 38.0 38.0 34.0 38.0 75-79 36.166700000000006 38.0 38.0 38.0 34.2 38.0 80-84 36.0272 38.0 38.0 38.0 34.0 38.0 85-89 35.8677 38.0 38.0 38.0 33.2 38.0 90-94 35.66715000000001 38.0 38.0 38.0 32.2 38.0 95-99 35.20219999999999 38.0 37.4 38.0 30.0 38.0 100-104 34.58205 38.0 37.0 38.0 25.6 38.0 105-109 34.51315 38.0 36.8 38.0 25.2 38.0 110-114 34.32645 38.0 36.4 38.0 24.0 38.0 115-119 34.0834 38.0 36.0 38.0 22.2 38.0 120-124 33.963499999999996 38.0 35.8 38.0 21.0 38.0 125-129 33.518249999999995 38.0 35.0 38.0 16.2 38.0 130-134 33.13974999999999 38.0 34.2 38.0 15.0 38.0 135-139 32.65185 38.0 33.6 38.0 13.6 38.0 140-144 31.868000000000002 38.0 32.2 38.0 10.8 38.0 145-149 30.770349999999997 38.0 31.0 38.0 2.0 38.0 150-151 26.246375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 24.0 4 12.0 5 3.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 4.0 13 4.0 14 5.0 15 4.0 16 6.0 17 11.0 18 9.0 19 14.0 20 20.0 21 21.0 22 21.0 23 27.0 24 32.0 25 21.0 26 30.0 27 35.0 28 44.0 29 46.0 30 62.0 31 62.0 32 100.0 33 114.0 34 153.0 35 244.0 36 541.0 37 2308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.02281368821293 18.75792141951838 14.169835234474018 29.04942965779468 2 26.776649746192895 26.548223350253807 32.25888324873096 14.416243654822336 3 20.675641351282703 28.600457200914402 30.657861315722627 20.066040132080264 4 21.93270933468252 36.40273210220086 23.24816594991146 18.41639261320516 5 24.197218710493047 38.10366624525916 21.51706700379267 16.182048040455122 6 18.781597573306367 36.98179979777553 24.570273003033368 19.66632962588473 7 18.724696356275302 19.02834008097166 41.29554655870445 20.951417004048583 8 19.262603461249057 24.429395535490343 29.571106094808126 26.73689490845247 9 21.122525682786268 25.85818090704084 29.391130042595844 23.62816336757705 10-14 23.888081030938174 28.96755753898611 26.00912600912601 21.13523542094971 15-19 23.042381432896065 28.93037336024218 27.598385469223008 20.42885973763875 20-24 23.08162641394069 28.411291144400288 27.463568735351064 21.04351370630796 25-29 23.06092426317658 28.630852736772688 27.880079135595796 20.428143864454928 30-34 22.55798676032139 28.561321946535955 28.212643387740666 20.66804790540199 35-39 23.30834683954619 28.38330632090762 27.709683954619123 20.598662884927066 40-44 22.68436727070819 28.39331684417748 28.050073191661195 20.87224269345313 45-49 23.23304074280785 27.992287787305294 28.48444872900705 20.290222740879802 50-54 22.909293154009504 28.268783496814642 28.304176357569016 20.517746991606835 55-59 23.47268504493588 28.27930930021206 28.3146521256185 19.933353529233568 60-64 23.098762928412086 28.71628472926384 27.245994727235857 20.938957615088217 65-69 22.694454401147013 28.624097496031542 27.856009012238207 20.825439090583238 70-74 22.733019774439892 28.75132756789561 27.86628230415213 20.649370353512364 75-79 23.083139711081927 27.71997171431458 28.134154965147996 21.0627336094555 80-84 23.01523252294966 28.845959850701096 27.499243417734288 20.63956420861495 85-89 23.53859322289915 28.865616031418355 27.43064296863199 20.165147777050503 90-94 22.937218596650986 28.46157737643547 27.884858602721707 20.716345424191836 95-99 23.552873798322764 28.190836571896092 27.930047044385354 20.326242585395786 100-104 23.337989549381756 28.035594184903513 27.802783382482282 20.82363288323245 105-109 23.042401733209534 28.33488084184463 28.29361394821005 20.32910347673579 110-114 23.795243019648396 27.730093071354705 28.03516028955533 20.43950361944157 115-119 23.808542428770156 28.1724972950693 27.224483487042093 20.79447678911845 120-124 23.79239465570401 28.412127440904417 27.713257965056528 20.082219938335047 125-129 24.288806431663573 28.148835291692436 27.906617192331478 19.655741084312513 130-134 24.044503966209952 28.803955908107554 27.15566086329453 19.995879262387966 135-139 24.915410642879113 27.524864144365836 28.109299702655594 19.450425510099457 140-144 24.4121573056782 27.841667522332887 27.9648834582606 19.781291713728308 145-149 24.395513941763554 27.826936927667457 27.904105360633807 19.87344376993518 150-151 24.370399070127856 28.322355676094535 28.296525894356193 19.01071935942141 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.5 2 3.0 3 3.5 4 3.5 5 4.0 6 3.5 7 3.0 8 2.0 9 2.0 10 3.0 11 2.0 12 1.0 13 2.0 14 2.5 15 1.5 16 1.5 17 3.5 18 3.0 19 0.5 20 0.0 21 0.5 22 2.5 23 4.0 24 3.0 25 3.5 26 9.0 27 11.0 28 10.0 29 13.0 30 18.5 31 22.5 32 26.5 33 38.0 34 61.0 35 71.5 36 94.0 37 125.0 38 138.5 39 170.5 40 194.0 41 215.5 42 252.5 43 281.5 44 284.0 45 266.0 46 252.5 47 237.5 48 220.5 49 190.5 50 160.5 51 127.5 52 112.0 53 100.5 54 62.5 55 43.5 56 37.0 57 29.0 58 20.5 59 12.5 60 8.5 61 6.0 62 4.0 63 3.0 64 1.5 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 1.5 3 1.575 4 1.175 5 1.125 6 1.0999999999999999 7 1.2 8 0.325 9 0.22499999999999998 10-14 0.28500000000000003 15-19 0.8999999999999999 20-24 1.87 25-29 1.435 30-34 1.055 35-39 1.28 40-44 0.9450000000000001 45-49 1.455 50-54 1.11 55-59 0.97 60-64 1.38 65-69 2.355 70-74 1.135 75-79 1.01 80-84 0.8699999999999999 85-89 0.695 90-94 1.165 95-99 2.22 100-104 3.3550000000000004 105-109 3.0700000000000003 110-114 3.3000000000000003 115-119 2.955 120-124 2.7 125-129 2.98 130-134 2.93 135-139 2.4699999999999998 140-144 2.6100000000000003 145-149 2.81 150-151 3.2125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133357 spots for SRR5683094.sra Written 1133357 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra Read 1133341 spots for SRR5683094.sra Written 1133341 spots for SRR5683094.sra SRR ids: ['SRR5683094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_1azuzk SRR5683094.sra spots: 22666836 blocks: [[1, 1133341], [1133342, 2266682], [2266683, 3400023], [3400024, 4533364], [4533365, 5666705], [5666706, 6800046], [6800047, 7933387], [7933388, 9066728], [9066729, 10200069], [10200070, 11333410], [11333411, 12466751], [12466752, 13600092], [13600093, 14733433], [14733434, 15866774], [15866775, 17000115], [17000116, 18133456], [18133457, 19266797], [19266798, 20400138], [20400139, 21533479], [21533480, 22666836]] SRR5683094 file size 7659346 SRR5683094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5683094 SRR5683094_1.fastq SRR5683094_2.fastq Input file: SRR5683094_1.fastq Paired file: SRR5683094_2.fastq trimmed: SRR5683094-trimmed-pair1.fastq, SRR5683094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:06:09 2025 >> started Tue Feb 11 13:06:33 2025 >> done (23.536s) 22666836 read pairs processed; of these: 33615 ( 0.15%) short read pairs filtered out after trimming by size control 54298 ( 0.24%) empty read pairs filtered out after trimming by size control 22578923 (99.61%) read pairs available; of these: 12112453 (53.64%) trimmed read pairs available after processing 10466470 (46.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 16 0.00% 20 8 0.00% 21 6 0.00% 22 12 0.00% 23 12 0.00% 24 10 0.00% 25 12 0.00% 26 15 0.00% 27 19 0.00% 28 15 0.00% 29 17 0.00% 30 24 0.00% 31 21 0.00% 32 20 0.00% 33 15 0.00% 34 18 0.00% 35 22 0.00% 36 22 0.00% 37 29 0.00% 38 30 0.00% 39 30 0.00% 40 44 0.00% 41 40 0.00% 42 50 0.00% 43 49 0.00% 44 63 0.00% 45 78 0.00% 46 101 0.00% 47 87 0.00% 48 105 0.00% 49 114 0.00% 50 107 0.00% 51 123 0.00% 52 157 0.00% 53 192 0.00% 54 219 0.00% 55 202 0.00% 56 227 0.00% 57 278 0.00% 58 313 0.00% 59 330 0.00% 60 439 0.00% 61 463 0.00% 62 501 0.00% 63 633 0.00% 64 644 0.00% 65 733 0.00% 66 808 0.00% 67 972 0.00% 68 1048 0.00% 69 1385 0.01% 70 1548 0.01% 71 1655 0.01% 72 1894 0.01% 73 2058 0.01% 74 2330 0.01% 75 2432 0.01% 76 2805 0.01% 77 2901 0.01% 78 3308 0.01% 79 3780 0.02% 80 4240 0.02% 81 4669 0.02% 82 5336 0.02% 83 6032 0.03% 84 7811 0.03% 85 8259 0.04% 86 9013 0.04% 87 9503 0.04% 88 10242 0.05% 89 10601 0.05% 90 11708 0.05% 91 12602 0.06% 92 13301 0.06% 93 14701 0.07% 94 15780 0.07% 95 16644 0.07% 96 17907 0.08% 97 17771 0.08% 98 18470 0.08% 99 19570 0.09% 100 20374 0.09% 101 21456 0.10% 102 22769 0.10% 103 24122 0.11% 104 25510 0.11% 105 26981 0.12% 106 27906 0.12% 107 28162 0.12% 108 29299 0.13% 109 30328 0.13% 110 31487 0.14% 111 32719 0.14% 112 34613 0.15% 113 36080 0.16% 114 37943 0.17% 115 40242 0.18% 116 41191 0.18% 117 42406 0.19% 118 43975 0.19% 119 45187 0.20% 120 46681 0.21% 121 48867 0.22% 122 51860 0.23% 123 53536 0.24% 124 57801 0.26% 125 58905 0.26% 126 61689 0.27% 127 64188 0.28% 128 66168 0.29% 129 69064 0.31% 130 72622 0.32% 131 75976 0.34% 132 79814 0.35% 133 84049 0.37% 134 90119 0.40% 135 96530 0.43% 136 103409 0.46% 137 111047 0.49% 138 119108 0.53% 139 127139 0.56% 140 137638 0.61% 141 151184 0.67% 142 169703 0.75% 143 193794 0.86% 144 224343 0.99% 145 269833 1.20% 146 340749 1.51% 147 461440 2.04% 148 696291 3.08% 149 1314202 5.82% 150 5702196 25.25% 151 10466470 46.36% 22578923 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=34 prefix-density=0.37 prefix-fanout=1.4 sequence=ATTCCTTTGCAGTTTGAACAGCATTACCAGCTTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=556.11 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=37.2 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=7.70 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=4.7 sequence=TGCAAAGGAATCAGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=4 fanout-score=325.89 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=30.1 sequence=GAAGAAGAAGAAA SRR5683094 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:07:16 Started mapping on | Feb 11 13:07:16 Finished on | Feb 11 13:09:28 Mapping speed, Million of reads per hour | 615.79 Number of input reads | 22578923 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21477240 Uniquely mapped reads % | 95.12% Average mapped length | 293.30 Number of splices: Total | 21990457 Number of splices: Annotated (sjdb) | 21558796 Number of splices: GT/AG | 21630126 Number of splices: GC/AG | 308192 Number of splices: AT/AC | 14494 Number of splices: Non-canonical | 37645 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 506633 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 46267 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 615126 615126 615126 N_multimapping 506633 506633 506633 N_noFeature 761868 21158143 951244 N_ambiguous 232886 1477 102211 UnstrandedReadsAssigned:20482486 PositiveStrandReadsAssigned:317620 NegativeStrandReadsAssigned:20423785 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5683094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5683094-trimmed-pair1.fastq SRR5683094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,578,923 reads, 20,622,584 reads pseudoaligned [quant] estimated average fragment length: 259.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR5683094.ke.tsv 34699 SRR5683094.se.tsv 87100 total ==> SRR5683094.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.29 435 11.8777 Potri.005G024800.1.v4.1 1035 776.291 94 5.81681 Potri.004G059700.1.v4.1 961 702.387 14 0.957488 Potri.007G009000.2.v4.1 1416 1157.29 4 0.166035 Potri.003G141000.2.v4.1 2943 2684.29 742.176 13.2818 Potri.016G087400.1.v4.1 270 79.723 1525 918.899 Potri.015G069301.1.v4.1 564 315.657 0 0 Potri.010G195200.1.v4.1 1773 1514.29 31 0.983408 Potri.012G127500.1.v4.1 977 718.334 4473 299.126 ==> SRR5683094.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 250 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR5683094 completed mapping pipeline successfully