Starting /dee2/code/volunteer_pipeline.sh SRR5933781 current disk space = 3057236303872 free memory = 1054732264 SRR5933781 SRAfilesize 3d927f387b46ec38307ff2a81a18e715 SRR5933781.sra SRR5933781.sra file validated SRR5933781 is paired end SRR5933781 is conventional basespace SRR5933781 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933781_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.65 2.0 2.0 32.0 2.0 32.0 2 27.7125 32.0 27.0 32.0 12.0 32.0 3 32.89875 32.0 32.0 37.0 32.0 37.0 4 35.8875 37.0 37.0 37.0 32.0 37.0 5 35.78625 37.0 37.0 37.0 32.0 37.0 6 39.268 41.0 41.0 41.0 37.0 41.0 7 39.54825 41.0 41.0 41.0 37.0 41.0 8 39.86275 41.0 41.0 41.0 37.0 41.0 9 40.01 41.0 41.0 41.0 37.0 41.0 10-14 39.9555 41.0 41.0 41.0 37.0 41.0 15-19 39.913050000000005 41.0 41.0 41.0 37.0 41.0 20-24 39.822250000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.4183 41.0 41.0 41.0 36.0 41.0 30-34 39.74375 41.0 41.0 41.0 37.0 41.0 35-39 39.29235 41.0 41.0 41.0 36.0 41.0 40-44 39.47925 41.0 41.0 41.0 36.0 41.0 45-49 39.4604 41.0 41.0 41.0 37.0 41.0 50-54 39.1291 41.0 41.0 41.0 35.0 41.0 55-59 38.75575 41.0 40.2 41.0 34.0 41.0 60-64 39.2891 41.0 41.0 41.0 37.0 41.0 65-69 39.1055 41.0 41.0 41.0 36.0 41.0 70-74 39.2443 41.0 41.0 41.0 37.0 41.0 75-79 38.8872 41.0 39.4 41.0 34.0 41.0 80-84 38.80615 41.0 40.2 41.0 34.0 41.0 85-89 38.59185 41.0 38.6 41.0 34.0 41.0 90-94 38.85785 41.0 40.2 41.0 34.0 41.0 95-99 39.02505 41.0 41.0 41.0 35.0 41.0 100-104 38.61285 41.0 39.4 41.0 33.0 41.0 105-109 38.77745 41.0 41.0 41.0 33.0 41.0 110-114 38.496950000000005 41.0 37.0 41.0 32.0 41.0 115-119 37.4393 41.0 36.0 41.0 29.0 41.0 120-124 36.632850000000005 40.2 36.0 41.0 25.0 41.0 125-129 34.53815 38.6 32.0 41.0 18.0 41.0 130-134 34.908500000000004 39.4 34.0 41.0 19.0 41.0 135-139 33.49555 38.6 29.0 41.0 16.0 41.0 140-144 33.88565 39.4 29.0 41.0 18.0 41.0 145-149 29.232849999999996 32.0 21.0 38.4 14.0 40.2 150 28.89125 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 4.0 24 3.0 25 8.0 26 13.0 27 22.0 28 35.0 29 41.0 30 55.0 31 71.0 32 101.0 33 110.0 34 146.0 35 225.0 36 291.0 37 433.0 38 642.0 39 1115.0 40 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.152284263959388 17.106598984771573 18.426395939086294 34.31472081218274 2 26.075 25.25 33.775 14.899999999999999 3 22.55 29.099999999999998 26.700000000000003 21.65 4 22.975 36.4 21.65 18.975 5 22.925 37.425000000000004 23.3 16.35 6 16.650000000000002 38.1 24.375 20.875 7 13.375 17.525 45.550000000000004 23.549999999999997 8 18.975 22.675 28.1 30.25 9 20.525 22.625 31.574999999999996 25.275 10-14 20.25 30.535 27.71 21.505 15-19 21.14 28.794999999999998 28.155 21.91 20-24 21.07 28.98 27.52 22.43 25-29 21.310000000000002 30.214999999999996 26.56 21.915000000000003 30-34 20.875 29.435 27.634999999999998 22.055 35-39 21.02 29.315 27.894999999999996 21.77 40-44 21.605 28.76 27.805000000000003 21.83 45-49 20.674999999999997 29.630000000000003 27.615000000000002 22.08 50-54 21.2 28.815 27.98 22.005 55-59 21.84 28.535 27.339999999999996 22.285 60-64 20.979999999999997 28.744999999999997 28.865000000000002 21.41 65-69 22.025 28.945 27.284999999999997 21.745 70-74 21.48 28.410000000000004 27.925 22.185 75-79 21.475 28.825 28.32 21.38 80-84 20.755000000000003 29.165000000000003 27.779999999999998 22.3 85-89 21.94 29.04 27.405 21.615000000000002 90-94 21.310000000000002 29.470000000000002 27.57 21.65 95-99 21.825 29.215000000000003 27.57 21.39 100-104 21.41 28.65 28.165000000000003 21.775 105-109 21.875 28.199999999999996 27.794999999999998 22.13 110-114 21.59 28.275 28.144999999999996 21.990000000000002 115-119 22.08 28.455000000000002 27.85 21.615000000000002 120-124 21.46 27.88 28.65 22.009999999999998 125-129 21.465 28.255000000000003 28.785 21.495 130-134 22.0 28.544999999999998 28.134999999999998 21.32 135-139 21.465 28.83 28.465 21.240000000000002 140-144 22.085 27.87 28.16 21.884999999999998 145-149 20.885 28.599999999999998 29.75 20.765 150 21.475 28.999999999999996 28.799999999999997 20.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 3.0 19 2.5 20 2.0 21 2.5 22 3.0 23 4.0 24 3.0 25 1.5 26 6.5 27 13.0 28 17.0 29 24.0 30 31.5 31 38.5 32 54.0 33 78.5 34 89.0 35 95.0 36 106.5 37 125.0 38 164.0 39 186.5 40 204.5 41 242.5 42 266.0 43 267.5 44 248.5 45 237.0 46 239.0 47 225.5 48 184.5 49 144.5 50 138.0 51 122.0 52 90.0 53 76.5 54 59.5 55 46.5 56 42.0 57 26.0 58 13.5 59 11.0 60 13.0 61 10.0 62 7.0 63 6.5 64 4.5 65 3.0 66 2.0 67 3.0 68 3.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 50.74999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.9592662530348 86.15 2 6.177502023199353 11.450000000000001 3 0.8632317237658483 2.4 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.36250000000000004 0.0 0.0 0.0 0.0 126-127 0.44999999999999996 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.6875 0.0 0.0 0.0 0.0 136-137 0.725 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAAAT 10 7.882311E-4 294.33334 1 AATTTCC 10 0.0070483834 143.4875 5 TAAAATT 10 0.0070483834 143.4875 2 ATTGAGT 10 0.0070483834 143.4875 6 ATACACA 10 0.0070483834 143.4875 9 >>END_MODULE SRR5933781 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933781_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.08 27.0 2.0 32.0 2.0 32.0 2 30.685 32.0 32.0 32.0 27.0 32.0 3 32.6525 32.0 32.0 37.0 32.0 37.0 4 34.38 37.0 32.0 37.0 32.0 37.0 5 35.23375 37.0 37.0 37.0 32.0 37.0 6 37.301 41.0 37.0 41.0 32.0 41.0 7 35.832 41.0 37.0 41.0 22.0 41.0 8 39.033 41.0 41.0 41.0 37.0 41.0 9 39.23475 41.0 41.0 41.0 37.0 41.0 10-14 39.07190000000001 41.0 41.0 41.0 36.0 41.0 15-19 38.91805000000001 41.0 39.4 41.0 35.0 41.0 20-24 38.468999999999994 41.0 39.4 41.0 32.0 41.0 25-29 38.066950000000006 41.0 37.8 41.0 31.0 41.0 30-34 38.140100000000004 41.0 37.8 41.0 30.0 41.0 35-39 38.00214999999999 41.0 37.8 41.0 31.0 41.0 40-44 38.928250000000006 41.0 40.2 41.0 35.0 41.0 45-49 39.126149999999996 41.0 41.0 41.0 37.0 41.0 50-54 38.614000000000004 41.0 40.2 41.0 32.0 41.0 55-59 38.148900000000005 41.0 37.8 41.0 31.0 41.0 60-64 37.580349999999996 41.0 37.0 41.0 30.0 41.0 65-69 36.068099999999994 41.0 36.0 41.0 23.0 41.0 70-74 36.3686 41.0 36.0 41.0 25.0 41.0 75-79 36.34995 40.2 35.0 41.0 26.0 41.0 80-84 36.02804999999999 41.0 35.0 41.0 24.0 41.0 85-89 35.61585 41.0 34.0 41.0 22.0 41.0 90-94 34.187650000000005 37.8 30.0 41.0 16.0 41.0 95-99 34.54265 37.0 31.0 41.0 18.0 41.0 100-104 35.114549999999994 37.0 33.0 41.0 20.0 41.0 105-109 33.54225 37.0 31.0 41.0 14.0 41.0 110-114 33.4237 37.0 30.0 41.0 14.0 41.0 115-119 31.0148 35.0 25.0 41.0 12.0 41.0 120-124 29.26345 32.0 22.0 38.6 12.0 41.0 125-129 29.20555 31.0 21.0 40.2 12.0 41.0 130-134 26.761950000000002 28.0 18.0 37.0 12.0 41.0 135-139 23.6303 24.0 12.0 33.0 12.0 38.6 140-144 20.9307 17.0 12.0 29.0 10.4 37.8 145-149 21.41835 20.0 12.0 29.0 11.2 36.0 150 18.124 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 5.0 18 5.0 19 6.0 20 19.0 21 14.0 22 33.0 23 33.0 24 48.0 25 43.0 26 90.0 27 107.0 28 126.0 29 139.0 30 187.0 31 232.0 32 280.0 33 310.0 34 338.0 35 401.0 36 451.0 37 479.0 38 413.0 39 199.0 40 42.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.990356798457086 16.248794599807137 20.154291224686595 33.60655737704918 2 24.575 26.075 34.575 14.774999999999999 3 23.7 30.375000000000004 24.6 21.325 4 23.525 34.5 21.65 20.325 5 21.85 36.875 23.25 18.025 6 15.825 39.225 25.924999999999997 19.025 7 15.049999999999999 16.8 44.725 23.425 8 17.9 22.15 29.975 29.975 9 20.65 21.725 29.7 27.925 10-14 20.59 29.98 27.634999999999998 21.795 15-19 21.33 28.03 28.925 21.715 20-24 20.9 29.555 28.050000000000004 21.495 25-29 21.834999999999997 29.13 28.189999999999998 20.845 30-34 21.135 29.095 28.01 21.759999999999998 35-39 21.43 29.67 27.575 21.325 40-44 21.46 28.910000000000004 28.16 21.47 45-49 21.5 29.04 28.07 21.39 50-54 21.535 28.625 28.215 21.625 55-59 21.575 29.005 28.515 20.905 60-64 21.495 28.849999999999998 28.055000000000003 21.6 65-69 21.560000000000002 29.354999999999997 27.485 21.6 70-74 21.11 29.330000000000002 27.689999999999998 21.87 75-79 21.52 28.389999999999997 28.060000000000002 22.03 80-84 21.029999999999998 29.195 28.43 21.345 85-89 21.37 28.34 28.599999999999998 21.69 90-94 21.68 28.95 28.265 21.105 95-99 21.91 27.935 28.470000000000002 21.685 100-104 21.26 28.535 28.754999999999995 21.45 105-109 21.404999999999998 28.499999999999996 28.43 21.665 110-114 21.759999999999998 28.494999999999997 27.865000000000002 21.88 115-119 21.55 28.439999999999998 28.050000000000004 21.959999999999997 120-124 22.34 28.08 28.875 20.705000000000002 125-129 21.740000000000002 28.845 28.299999999999997 21.115000000000002 130-134 22.345000000000002 29.07 27.415 21.17 135-139 22.48 29.21 27.884999999999998 20.424999999999997 140-144 23.01 28.95 28.64 19.400000000000002 145-149 22.525000000000002 28.215 29.21 20.05 150 24.325 28.425 32.85 14.399999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.5 22 4.0 23 10.0 24 14.5 25 10.0 26 9.5 27 11.0 28 15.5 29 24.5 30 35.5 31 48.0 32 50.0 33 60.5 34 76.5 35 88.5 36 123.5 37 147.0 38 171.0 39 193.5 40 200.5 41 202.0 42 237.5 43 278.0 44 259.0 45 248.0 46 247.0 47 217.5 48 184.5 49 176.5 50 151.5 51 107.5 52 93.0 53 77.0 54 51.5 55 38.0 56 27.5 57 20.0 58 16.0 59 14.5 60 11.0 61 7.5 62 7.5 63 7.0 64 2.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 1.5 72 1.0 73 1.5 74 2.0 75 0.5 76 1.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 48.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.22944653412144 86.75 2 6.072004298764106 11.3 3 0.6985491671144546 1.95 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAT 10 0.0070428792 143.525 5 CTGCATT 10 0.0070428792 143.525 6 CTTCACT 20 0.00787163 136.69048 1 >>END_MODULE Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394474 spots for SRR5933781.sra Written 1394474 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra Read 1394458 spots for SRR5933781.sra Written 1394458 spots for SRR5933781.sra SRR ids: ['SRR5933781.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rx2jb287 SRR5933781.sra spots: 27889176 blocks: [[1, 1394458], [1394459, 2788916], [2788917, 4183374], [4183375, 5577832], [5577833, 6972290], [6972291, 8366748], [8366749, 9761206], [9761207, 11155664], [11155665, 12550122], [12550123, 13944580], [13944581, 15339038], [15339039, 16733496], [16733497, 18127954], [18127955, 19522412], [19522413, 20916870], [20916871, 22311328], [22311329, 23705786], [23705787, 25100244], [25100245, 26494702], [26494703, 27889176]] SRR5933781 file size 9374555 SRR5933781 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933781 SRR5933781_1.fastq SRR5933781_2.fastq Input file: SRR5933781_1.fastq Paired file: SRR5933781_2.fastq trimmed: SRR5933781-trimmed-pair1.fastq, SRR5933781-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:04:13 2025 >> started Mon Feb 10 19:04:44 2025 >> done (31.221s) 27889176 read pairs processed; of these: 282 ( 0.00%) short read pairs filtered out after trimming by size control 81 ( 0.00%) empty read pairs filtered out after trimming by size control 27888813 (100.00%) read pairs available; of these: 1894079 ( 6.79%) trimmed read pairs available after processing 25994734 (93.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 83 0.00% 20 88 0.00% 21 117 0.00% 22 161 0.00% 23 201 0.00% 24 267 0.00% 25 316 0.00% 26 339 0.00% 27 364 0.00% 28 389 0.00% 29 386 0.00% 30 434 0.00% 31 470 0.00% 32 469 0.00% 33 447 0.00% 34 478 0.00% 35 531 0.00% 36 513 0.00% 37 550 0.00% 38 591 0.00% 39 477 0.00% 40 546 0.00% 41 526 0.00% 42 548 0.00% 43 627 0.00% 44 586 0.00% 45 575 0.00% 46 555 0.00% 47 604 0.00% 48 582 0.00% 49 612 0.00% 50 585 0.00% 51 665 0.00% 52 604 0.00% 53 632 0.00% 54 612 0.00% 55 619 0.00% 56 628 0.00% 57 607 0.00% 58 627 0.00% 59 593 0.00% 60 643 0.00% 61 626 0.00% 62 597 0.00% 63 581 0.00% 64 580 0.00% 65 541 0.00% 66 600 0.00% 67 612 0.00% 68 582 0.00% 69 575 0.00% 70 577 0.00% 71 542 0.00% 72 642 0.00% 73 604 0.00% 74 563 0.00% 75 661 0.00% 76 614 0.00% 77 683 0.00% 78 675 0.00% 79 757 0.00% 80 733 0.00% 81 674 0.00% 82 715 0.00% 83 780 0.00% 84 808 0.00% 85 768 0.00% 86 818 0.00% 87 845 0.00% 88 836 0.00% 89 881 0.00% 90 986 0.00% 91 1020 0.00% 92 1076 0.00% 93 1056 0.00% 94 1093 0.00% 95 1136 0.00% 96 1201 0.00% 97 1260 0.00% 98 1376 0.00% 99 1374 0.00% 100 1472 0.01% 101 1568 0.01% 102 1594 0.01% 103 1647 0.01% 104 1852 0.01% 105 1835 0.01% 106 1985 0.01% 107 1970 0.01% 108 2197 0.01% 109 2146 0.01% 110 2479 0.01% 111 2378 0.01% 112 2484 0.01% 113 2688 0.01% 114 2711 0.01% 115 2916 0.01% 116 3086 0.01% 117 3046 0.01% 118 3350 0.01% 119 3451 0.01% 120 3684 0.01% 121 3725 0.01% 122 3987 0.01% 123 4026 0.01% 124 4451 0.02% 125 4484 0.02% 126 4758 0.02% 127 4923 0.02% 128 5158 0.02% 129 5348 0.02% 130 5488 0.02% 131 5869 0.02% 132 6132 0.02% 133 6313 0.02% 134 6643 0.02% 135 7026 0.03% 136 7402 0.03% 137 7807 0.03% 138 7964 0.03% 139 8406 0.03% 140 8868 0.03% 141 8979 0.03% 142 9793 0.04% 143 10184 0.04% 144 10744 0.04% 145 12292 0.04% 146 17050 0.06% 147 37378 0.13% 148 151317 0.54% 149 1415684 5.08% 150 25994734 93.21% 27888813 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=27 prefix-density=0.14 prefix-fanout=3.4 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=367.35 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=32.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=26 prefix-density=0.13 prefix-fanout=3.7 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=396.32 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=33.6 sequence=TTCTTCTTCTTT SRR5933781 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 19:23:08 Started mapping on | Feb 10 19:23:09 Finished on | Feb 10 19:31:08 Mapping speed, Million of reads per hour | 209.55 Number of input reads | 27882164 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 21997785 Uniquely mapped reads % | 78.90% Average mapped length | 269.58 Number of splices: Total | 15429400 Number of splices: Annotated (sjdb) | 14707792 Number of splices: GT/AG | 15044651 Number of splices: GC/AG | 192727 Number of splices: AT/AC | 11256 Number of splices: Non-canonical | 180766 Mismatch rate per base, % | 2.28% Deletion rate per base | 0.14% Deletion average length | 3.19 Insertion rate per base | 0.09% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1607062 % of reads mapped to multiple loci | 5.76% Number of reads mapped to too many loci | 13223 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.10% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4278007 4278007 4278007 N_multimapping 1607062 1607062 1607062 N_noFeature 637120 11277933 11239629 N_ambiguous 422631 152804 154663 UnstrandedReadsAssigned:20938034 PositiveStrandReadsAssigned:10567048 NegativeStrandReadsAssigned:10603493 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR5933781 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933781-trimmed-pair1.fastq SRR5933781-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,882,164 reads, 21,733,323 reads pseudoaligned [quant] estimated average fragment length: 233.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR5933781.ke.tsv 34699 SRR5933781.se.tsv 87100 total ==> SRR5933781.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.08 8143.43 199.485 Potri.005G024800.1.v4.1 1035 802.084 2416 131.716 Potri.004G059700.1.v4.1 961 728.084 32 1.92189 Potri.007G009000.2.v4.1 1416 1183.08 0 0 Potri.003G141000.2.v4.1 2943 2710.08 623.996 10.0684 Potri.016G087400.1.v4.1 270 58.4058 587 439.483 Potri.015G069301.1.v4.1 564 331.22 0 0 Potri.010G195200.1.v4.1 1773 1540.08 298.755 8.48266 Potri.012G127500.1.v4.1 977 744.084 7151 420.248 ==> SRR5933781.se.tsv <== Potri.001G166300.v4.1 6 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 1162 SRR5933781 completed mapping pipeline successfully