Starting /dee2/code/volunteer_pipeline.sh SRR5933782 current disk space = 3056803319808 free memory = 1491202764 SRR5933782 SRAfilesize 32808b5f50bd9ff38b50a6a9514c5410 SRR5933782.sra SRR5933782.sra file validated SRR5933782 is paired end SRR5933782 is conventional basespace SRR5933782 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.1275 2.0 2.0 32.0 2.0 32.0 2 28.00625 32.0 27.0 32.0 12.0 32.0 3 32.93625 32.0 32.0 32.0 32.0 37.0 4 35.8925 37.0 37.0 37.0 32.0 37.0 5 35.83125 37.0 37.0 37.0 32.0 37.0 6 39.3175 41.0 41.0 41.0 37.0 41.0 7 39.54375 41.0 41.0 41.0 37.0 41.0 8 39.84625 41.0 41.0 41.0 37.0 41.0 9 39.9435 41.0 41.0 41.0 37.0 41.0 10-14 39.906600000000005 41.0 41.0 41.0 37.0 41.0 15-19 39.865249999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.78075 41.0 41.0 41.0 37.0 41.0 25-29 39.393350000000005 41.0 41.0 41.0 36.0 41.0 30-34 39.6283 41.0 41.0 41.0 37.0 41.0 35-39 39.2253 41.0 41.0 41.0 36.0 41.0 40-44 39.378299999999996 41.0 41.0 41.0 36.0 41.0 45-49 39.3781 41.0 41.0 41.0 37.0 41.0 50-54 39.1092 41.0 40.2 41.0 35.0 41.0 55-59 38.740050000000004 41.0 39.4 41.0 35.0 41.0 60-64 39.2194 41.0 41.0 41.0 36.0 41.0 65-69 39.12395 41.0 41.0 41.0 37.0 41.0 70-74 39.192049999999995 41.0 41.0 41.0 37.0 41.0 75-79 38.7883 41.0 39.4 41.0 34.0 41.0 80-84 38.691700000000004 41.0 40.2 41.0 33.0 41.0 85-89 38.4989 41.0 38.6 41.0 34.0 41.0 90-94 38.81675 41.0 40.2 41.0 34.0 41.0 95-99 38.9439 41.0 41.0 41.0 35.0 41.0 100-104 38.40915 41.0 38.6 41.0 32.0 41.0 105-109 38.60755 41.0 39.4 41.0 33.0 41.0 110-114 38.34895 41.0 37.8 41.0 32.0 41.0 115-119 37.277550000000005 41.0 36.0 41.0 28.0 41.0 120-124 36.458749999999995 40.2 36.0 41.0 24.0 41.0 125-129 34.371050000000004 38.6 32.0 41.0 18.0 41.0 130-134 34.717499999999994 39.4 33.0 41.0 19.0 41.0 135-139 33.5744 38.6 29.0 41.0 16.0 41.0 140-144 33.87675 38.4 30.0 41.0 19.0 41.0 145-149 29.326599999999996 32.0 21.0 38.4 12.0 40.2 150 28.965 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 5.0 24 10.0 25 9.0 26 22.0 27 16.0 28 33.0 29 41.0 30 42.0 31 89.0 32 100.0 33 126.0 34 165.0 35 211.0 36 290.0 37 413.0 38 640.0 39 1105.0 40 679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.61651762230405 15.412940557601262 19.305628616517623 36.664913203577065 2 24.425 27.1 34.925 13.55 3 22.125 30.3 27.200000000000003 20.375 4 23.055763940985248 34.63365841460365 22.13053263315829 20.180045011252815 5 22.3 37.75 22.8 17.150000000000002 6 16.650000000000002 39.65 24.2 19.5 7 14.625 16.525000000000002 46.425 22.425 8 18.2 21.875 29.625 30.3 9 21.025 23.95 28.525 26.5 10-14 19.73 30.435000000000002 28.335 21.5 15-19 21.02 28.415000000000003 28.79 21.775 20-24 20.195 30.259999999999998 27.68 21.865000000000002 25-29 20.785 29.315 27.744999999999997 22.155 30-34 20.87 29.145 28.144999999999996 21.84 35-39 21.285 29.544999999999998 27.71 21.46 40-44 21.335 29.265 27.485 21.915000000000003 45-49 21.89 28.365000000000002 28.095 21.65 50-54 21.3 28.965000000000003 28.165000000000003 21.57 55-59 21.224999999999998 29.03 27.465 22.28 60-64 20.74 28.815 28.26 22.185 65-69 21.224999999999998 28.895 28.26 21.62 70-74 21.425 28.895 27.865000000000002 21.815 75-79 21.27 29.104999999999997 27.415 22.21 80-84 21.935 28.904999999999998 27.32 21.84 85-89 22.075 28.58 28.01 21.335 90-94 21.205 28.599999999999998 28.7 21.495 95-99 21.060000000000002 28.765 28.625 21.55 100-104 21.505 28.51 28.02 21.965 105-109 21.535 28.79 28.139999999999997 21.535 110-114 21.735 28.99 28.144999999999996 21.13 115-119 21.3 28.325 28.465 21.91 120-124 21.654999999999998 28.63 27.800000000000004 21.915000000000003 125-129 21.05 28.349999999999998 28.63 21.97 130-134 21.965 28.525 27.63 21.88 135-139 20.979999999999997 28.59 29.17 21.26 140-144 21.61 28.03 28.634999999999998 21.725 145-149 21.95 28.015 29.805 20.23 150 21.825 29.375 28.449999999999996 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 2.0 19 1.5 20 1.0 21 1.5 22 2.0 23 2.0 24 5.0 25 8.5 26 11.5 27 14.5 28 19.0 29 27.0 30 30.5 31 36.0 32 43.0 33 60.5 34 94.0 35 105.5 36 110.0 37 136.0 38 164.0 39 197.0 40 234.5 41 241.0 42 257.5 43 272.0 44 262.5 45 247.0 46 228.0 47 199.0 48 172.0 49 167.0 50 140.5 51 101.0 52 75.5 53 67.0 54 64.0 55 49.0 56 34.0 57 26.0 58 16.0 59 17.0 60 14.0 61 7.0 62 6.5 63 3.5 64 1.5 65 2.0 66 2.5 67 3.5 68 3.5 69 2.0 70 0.5 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 52.47500000000001 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.42070072211821 87.325 2 6.178122492645093 11.55 3 0.4011767852366943 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.5875 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.725 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATT 10 7.278829E-4 302.05264 1 GATTGAA 10 0.0070502195 143.475 4 TGAAAGT 10 0.0070502195 143.475 7 >>END_MODULE SRR5933782 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933782_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.6925 12.0 2.0 32.0 2.0 32.0 2 30.64 32.0 32.0 32.0 27.0 32.0 3 32.78 32.0 32.0 37.0 32.0 37.0 4 34.24875 37.0 32.0 37.0 32.0 37.0 5 35.16375 37.0 37.0 37.0 32.0 37.0 6 37.39625 41.0 37.0 41.0 32.0 41.0 7 35.87725 41.0 37.0 41.0 22.0 41.0 8 39.1395 41.0 41.0 41.0 37.0 41.0 9 39.3045 41.0 41.0 41.0 37.0 41.0 10-14 39.2233 41.0 41.0 41.0 37.0 41.0 15-19 38.94935 41.0 40.2 41.0 34.0 41.0 20-24 38.51465 41.0 39.4 41.0 32.0 41.0 25-29 38.138400000000004 41.0 37.8 41.0 32.0 41.0 30-34 38.21039999999999 41.0 37.8 41.0 31.0 41.0 35-39 38.1879 41.0 37.8 41.0 31.0 41.0 40-44 39.0127 41.0 40.2 41.0 35.0 41.0 45-49 39.276250000000005 41.0 41.0 41.0 37.0 41.0 50-54 38.8665 41.0 41.0 41.0 35.0 41.0 55-59 38.337450000000004 41.0 38.6 41.0 33.0 41.0 60-64 37.77565 41.0 37.0 41.0 30.0 41.0 65-69 36.18535000000001 41.0 36.0 41.0 22.0 41.0 70-74 36.43075 41.0 36.0 41.0 25.0 41.0 75-79 36.683499999999995 40.2 35.0 41.0 28.0 41.0 80-84 36.22175 40.2 35.0 41.0 25.0 41.0 85-89 35.65615 40.2 34.0 41.0 23.0 41.0 90-94 34.21565 37.0 30.0 41.0 18.0 41.0 95-99 34.73049999999999 37.0 32.0 41.0 20.0 41.0 100-104 35.336850000000005 37.8 34.0 41.0 23.0 41.0 105-109 33.6323 37.0 31.0 41.0 16.0 41.0 110-114 33.509499999999996 37.0 30.0 41.0 18.0 41.0 115-119 31.1398 35.0 25.0 41.0 12.0 41.0 120-124 29.244400000000002 32.0 22.0 37.8 12.0 41.0 125-129 29.37885 31.0 21.0 40.2 12.0 41.0 130-134 26.9831 28.0 18.0 37.0 12.0 41.0 135-139 23.578750000000003 25.0 12.0 33.0 12.0 38.6 140-144 20.7687 17.0 12.0 28.0 11.2 37.0 145-149 21.254499999999997 20.0 12.0 29.0 11.2 36.0 150 17.87425 12.0 12.0 22.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 3.0 18 3.0 19 8.0 20 14.0 21 21.0 22 15.0 23 30.0 24 34.0 25 58.0 26 73.0 27 93.0 28 117.0 29 141.0 30 190.0 31 225.0 32 270.0 33 335.0 34 423.0 35 384.0 36 435.0 37 496.0 38 400.0 39 192.0 40 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.49328692192939 17.75236200895077 20.437593237195426 33.31675783192441 2 24.075 27.85 33.125 14.95 3 22.13053263315829 31.257814453613403 25.63140785196299 20.980245061265315 4 22.175 36.175000000000004 20.8 20.849999999999998 5 22.825 37.974999999999994 22.55 16.650000000000002 6 16.075 39.25 25.224999999999998 19.45 7 15.299999999999999 16.3 45.6 22.8 8 20.150000000000002 22.0 28.15 29.7 9 20.349999999999998 24.0 29.549999999999997 26.1 10-14 21.04 30.085 27.43 21.445 15-19 20.91 27.85 28.765 22.475 20-24 21.395 29.345 27.675 21.584999999999997 25-29 20.96 29.659999999999997 27.815 21.565 30-34 20.395 29.69 27.975 21.94 35-39 21.310000000000002 29.37 27.889999999999997 21.43 40-44 21.555 29.325000000000003 27.26 21.86 45-49 20.919999999999998 29.134999999999998 28.225 21.72 50-54 21.82 28.68 27.48 22.02 55-59 21.57 28.705000000000002 27.894999999999996 21.83 60-64 21.215 28.485 28.155 22.145 65-69 21.240000000000002 29.965000000000003 27.250000000000004 21.545 70-74 22.065 29.48 27.055 21.4 75-79 21.51 29.14 27.495000000000005 21.855 80-84 21.93 29.15 27.93 20.990000000000002 85-89 21.305 29.544999999999998 27.450000000000003 21.7 90-94 22.055 29.244999999999997 27.705000000000002 20.995 95-99 21.485000000000003 29.235 27.685 21.595 100-104 21.645 28.475 28.134999999999998 21.745 105-109 21.855 28.95 28.115000000000002 21.08 110-114 21.935 28.915000000000003 27.68 21.47 115-119 22.24 29.220000000000002 27.755000000000003 20.785 120-124 22.065 28.939999999999998 27.61 21.385 125-129 22.314999999999998 28.595 28.355000000000004 20.735 130-134 22.515 28.685 27.855 20.945 135-139 22.770000000000003 28.57 27.845 20.815 140-144 22.52 28.735 28.43 20.315 145-149 22.975 28.835 28.48 19.71 150 23.625 29.299999999999997 31.5 15.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 1.5 18 2.0 19 0.5 20 3.0 21 5.0 22 4.0 23 2.5 24 3.0 25 9.0 26 13.0 27 20.0 28 23.5 29 21.5 30 31.5 31 41.5 32 52.0 33 60.5 34 71.0 35 96.5 36 108.5 37 123.5 38 157.0 39 189.0 40 217.5 41 248.5 42 257.5 43 249.5 44 247.0 45 253.0 46 241.0 47 212.5 48 191.0 49 167.0 50 136.0 51 117.0 52 96.5 53 78.0 54 60.5 55 38.0 56 35.0 57 27.0 58 22.0 59 16.5 60 11.5 61 8.5 62 4.5 63 3.5 64 2.0 65 0.5 66 3.0 67 4.0 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 49.725 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97078353253652 88.44999999999999 2 5.816733067729084 10.95 3 0.21248339973439576 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTGT 15 0.0033293117 182.25397 1 GTGTTAA 10 0.0070428792 143.525 4 TGTTAAA 10 0.0070428792 143.525 5 TGTGTTA 10 0.0070428792 143.525 3 GTTAAAA 10 0.0070428792 143.525 6 GGGAAAA 20 0.0062391567 28.704998 70-74 AAAAAAA 75 0.001337041 19.136667 9 >>END_MODULE Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428912 spots for SRR5933782.sra Written 1428912 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra Read 1428897 spots for SRR5933782.sra Written 1428897 spots for SRR5933782.sra SRR ids: ['SRR5933782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_rmx2v1 SRR5933782.sra spots: 28577955 blocks: [[1, 1428897], [1428898, 2857794], [2857795, 4286691], [4286692, 5715588], [5715589, 7144485], [7144486, 8573382], [8573383, 10002279], [10002280, 11431176], [11431177, 12860073], [12860074, 14288970], [14288971, 15717867], [15717868, 17146764], [17146765, 18575661], [18575662, 20004558], [20004559, 21433455], [21433456, 22862352], [22862353, 24291249], [24291250, 25720146], [25720147, 27149043], [27149044, 28577955]] SRR5933782 file size 9606614 SRR5933782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933782 SRR5933782_1.fastq SRR5933782_2.fastq Input file: SRR5933782_1.fastq Paired file: SRR5933782_2.fastq trimmed: SRR5933782-trimmed-pair1.fastq, SRR5933782-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:31:34 2025 >> started Mon Feb 10 19:32:05 2025 >> done (31.074s) 28577955 read pairs processed; of these: 282 ( 0.00%) short read pairs filtered out after trimming by size control 81 ( 0.00%) empty read pairs filtered out after trimming by size control 28577592 (100.00%) read pairs available; of these: 1939472 ( 6.79%) trimmed read pairs available after processing 26638120 (93.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 68 0.00% 20 100 0.00% 21 127 0.00% 22 162 0.00% 23 195 0.00% 24 257 0.00% 25 314 0.00% 26 321 0.00% 27 320 0.00% 28 376 0.00% 29 360 0.00% 30 351 0.00% 31 406 0.00% 32 445 0.00% 33 457 0.00% 34 460 0.00% 35 463 0.00% 36 479 0.00% 37 491 0.00% 38 484 0.00% 39 478 0.00% 40 552 0.00% 41 494 0.00% 42 541 0.00% 43 538 0.00% 44 568 0.00% 45 536 0.00% 46 544 0.00% 47 585 0.00% 48 566 0.00% 49 606 0.00% 50 554 0.00% 51 580 0.00% 52 585 0.00% 53 580 0.00% 54 563 0.00% 55 631 0.00% 56 617 0.00% 57 580 0.00% 58 597 0.00% 59 607 0.00% 60 631 0.00% 61 645 0.00% 62 574 0.00% 63 554 0.00% 64 568 0.00% 65 565 0.00% 66 569 0.00% 67 597 0.00% 68 583 0.00% 69 577 0.00% 70 608 0.00% 71 602 0.00% 72 599 0.00% 73 577 0.00% 74 546 0.00% 75 600 0.00% 76 636 0.00% 77 706 0.00% 78 677 0.00% 79 665 0.00% 80 679 0.00% 81 696 0.00% 82 761 0.00% 83 736 0.00% 84 808 0.00% 85 829 0.00% 86 858 0.00% 87 789 0.00% 88 922 0.00% 89 1014 0.00% 90 1048 0.00% 91 1095 0.00% 92 1140 0.00% 93 1220 0.00% 94 1191 0.00% 95 1388 0.00% 96 1382 0.00% 97 1452 0.01% 98 1579 0.01% 99 1686 0.01% 100 1769 0.01% 101 1857 0.01% 102 1951 0.01% 103 2095 0.01% 104 2126 0.01% 105 2367 0.01% 106 2361 0.01% 107 2494 0.01% 108 2712 0.01% 109 2676 0.01% 110 2778 0.01% 111 3059 0.01% 112 3211 0.01% 113 3399 0.01% 114 3571 0.01% 115 3781 0.01% 116 3830 0.01% 117 4064 0.01% 118 4223 0.01% 119 4496 0.02% 120 4569 0.02% 121 4826 0.02% 122 5204 0.02% 123 5559 0.02% 124 5779 0.02% 125 5799 0.02% 126 6450 0.02% 127 6494 0.02% 128 6918 0.02% 129 7296 0.03% 130 7612 0.03% 131 7769 0.03% 132 8133 0.03% 133 8571 0.03% 134 8818 0.03% 135 9495 0.03% 136 9766 0.03% 137 10258 0.04% 138 10566 0.04% 139 11321 0.04% 140 11422 0.04% 141 12216 0.04% 142 12697 0.04% 143 13412 0.05% 144 13826 0.05% 145 15666 0.05% 146 20403 0.07% 147 39812 0.14% 148 148582 0.52% 149 1389474 4.86% 150 26638120 93.21% 28577592 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=25 prefix-density=0.14 prefix-fanout=3.2 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=335.55 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=30.0 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=3.2 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=369.00 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=29.7 sequence=AAGAAGAAGATG SRR5933782 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 19:51:11 Started mapping on | Feb 10 19:51:11 Finished on | Feb 10 19:57:04 Mapping speed, Million of reads per hour | 291.38 Number of input reads | 28571391 Average input read length | 271 UNIQUE READS: Uniquely mapped reads number | 22764977 Uniquely mapped reads % | 79.68% Average mapped length | 262.52 Number of splices: Total | 16188906 Number of splices: Annotated (sjdb) | 15508813 Number of splices: GT/AG | 15800519 Number of splices: GC/AG | 199899 Number of splices: AT/AC | 12023 Number of splices: Non-canonical | 176465 Mismatch rate per base, % | 2.27% Deletion rate per base | 0.13% Deletion average length | 3.15 Insertion rate per base | 0.09% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1503120 % of reads mapped to multiple loci | 5.26% Number of reads mapped to too many loci | 16994 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.85% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4303294 4303294 4303294 N_multimapping 1503120 1503120 1503120 N_noFeature 593148 11658528 11581891 N_ambiguous 396368 139906 141025 UnstrandedReadsAssigned:21775461 PositiveStrandReadsAssigned:10966543 NegativeStrandReadsAssigned:11042061 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR5933782 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933782-trimmed-pair1.fastq SRR5933782-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,571,391 reads, 22,724,001 reads pseudoaligned [quant] estimated average fragment length: 225.944 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR5933782.ke.tsv 34699 SRR5933782.se.tsv 87100 total ==> SRR5933782.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.06 5784.53 131.293 Potri.005G024800.1.v4.1 1035 810.056 1549 77.8223 Potri.004G059700.1.v4.1 961 736.056 84 4.64447 Potri.007G009000.2.v4.1 1416 1191.06 0 0 Potri.003G141000.2.v4.1 2943 2718.06 672.501 10.0694 Potri.016G087400.1.v4.1 270 65.1407 546.455 341.405 Potri.015G069301.1.v4.1 564 339.147 0 0 Potri.010G195200.1.v4.1 1773 1548.06 135.51 3.56247 Potri.012G127500.1.v4.1 977 752.056 6501 351.801 ==> SRR5933782.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 78 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1069 SRR5933782 completed mapping pipeline successfully