Starting /dee2/code/volunteer_pipeline.sh SRR5933783 current disk space = 3057145901056 free memory = 1062792056 SRR5933783 SRAfilesize ee4ec846091f5899162e16b3ed0f518e SRR5933783.sra SRR5933783.sra file validated SRR5933783 is paired end SRR5933783 is conventional basespace SRR5933783 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933783_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.31625 2.0 2.0 32.0 2.0 32.0 2 28.05 32.0 27.0 32.0 12.0 32.0 3 32.86 32.0 32.0 32.0 32.0 37.0 4 35.81375 37.0 37.0 37.0 32.0 37.0 5 35.85625 37.0 37.0 37.0 32.0 37.0 6 39.35425 41.0 41.0 41.0 37.0 41.0 7 39.6465 41.0 41.0 41.0 37.0 41.0 8 39.84525 41.0 41.0 41.0 37.0 41.0 9 40.07275 41.0 41.0 41.0 37.0 41.0 10-14 39.9919 41.0 41.0 41.0 37.0 41.0 15-19 39.91005 41.0 41.0 41.0 37.0 41.0 20-24 39.77565 41.0 41.0 41.0 37.0 41.0 25-29 39.48545 41.0 41.0 41.0 37.0 41.0 30-34 39.70334999999999 41.0 41.0 41.0 37.0 41.0 35-39 39.319649999999996 41.0 41.0 41.0 36.0 41.0 40-44 39.5108 41.0 41.0 41.0 36.0 41.0 45-49 39.464 41.0 41.0 41.0 37.0 41.0 50-54 39.09225 41.0 40.2 41.0 35.0 41.0 55-59 38.8695 41.0 40.2 41.0 35.0 41.0 60-64 39.28365 41.0 41.0 41.0 36.0 41.0 65-69 39.05095 41.0 41.0 41.0 36.0 41.0 70-74 39.25455 41.0 41.0 41.0 37.0 41.0 75-79 38.91175 41.0 39.4 41.0 34.0 41.0 80-84 38.790049999999994 41.0 40.2 41.0 34.0 41.0 85-89 38.539100000000005 41.0 38.6 41.0 34.0 41.0 90-94 38.694849999999995 41.0 39.4 41.0 33.0 41.0 95-99 38.857499999999995 41.0 41.0 41.0 35.0 41.0 100-104 38.45495 41.0 38.6 41.0 33.0 41.0 105-109 38.566449999999996 41.0 39.4 41.0 33.0 41.0 110-114 38.43395 41.0 37.0 41.0 32.0 41.0 115-119 37.3887 41.0 36.0 41.0 29.0 41.0 120-124 36.5167 40.2 36.0 41.0 28.0 41.0 125-129 34.4653 38.6 32.0 41.0 18.0 41.0 130-134 34.751999999999995 39.4 33.0 41.0 19.0 41.0 135-139 33.547450000000005 38.6 29.0 41.0 16.0 41.0 140-144 33.83605 38.4 29.0 41.0 19.0 41.0 145-149 29.04005 32.0 21.0 38.4 12.0 40.2 150 28.6995 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 3.0 23 4.0 24 5.0 25 9.0 26 12.0 27 15.0 28 37.0 29 45.0 30 58.0 31 67.0 32 85.0 33 130.0 34 152.0 35 229.0 36 298.0 37 416.0 38 670.0 39 1126.0 40 635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.19708788351534 17.368694747789913 19.96879875195008 35.46541861674467 2 24.925 24.474999999999998 35.85 14.75 3 22.15 28.449999999999996 26.974999999999998 22.425 4 23.325000000000003 35.199999999999996 20.25 21.224999999999998 5 23.200000000000003 36.075 23.474999999999998 17.25 6 15.575 38.85 24.15 21.425 7 14.875 15.525 46.125 23.474999999999998 8 18.05 23.325000000000003 28.95 29.675 9 22.525000000000002 21.075 29.349999999999998 27.05 10-14 20.415 29.995 27.875 21.715 15-19 20.72 28.275 28.595 22.41 20-24 21.349999999999998 29.585 27.675 21.39 25-29 21.685 28.845 27.46 22.009999999999998 30-34 20.560000000000002 29.110000000000003 28.060000000000002 22.27 35-39 20.544999999999998 29.470000000000002 28.09 21.895 40-44 21.25 29.244999999999997 27.944999999999997 21.560000000000002 45-49 21.43 28.575 28.275 21.72 50-54 21.44 29.515 27.485 21.560000000000002 55-59 20.775 28.58 28.499999999999996 22.145 60-64 21.365000000000002 28.57 28.27 21.795 65-69 21.990000000000002 28.52 27.900000000000002 21.59 70-74 20.965 29.365000000000002 28.13 21.54 75-79 21.16 28.425 28.205000000000002 22.21 80-84 21.385 27.845 28.249999999999996 22.52 85-89 21.64 28.970000000000002 27.91 21.48 90-94 22.025 28.275 28.544999999999998 21.154999999999998 95-99 21.86 29.185 27.884999999999998 21.07 100-104 21.775 28.315 28.310000000000002 21.6 105-109 21.94 27.85 28.285 21.925 110-114 21.305 28.535 27.865000000000002 22.295 115-119 21.69 28.115000000000002 28.16 22.035 120-124 21.990000000000002 28.050000000000004 28.105000000000004 21.855 125-129 21.64 28.205000000000002 28.64 21.515 130-134 21.985 27.92 28.634999999999998 21.46 135-139 21.58 27.88 28.96 21.58 140-144 21.115000000000002 28.575 29.17 21.14 145-149 21.855 28.375 29.095 20.674999999999997 150 21.3 27.925 30.075000000000003 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 2.0 19 3.5 20 4.5 21 4.0 22 5.5 23 8.0 24 7.5 25 9.5 26 13.0 27 16.0 28 20.5 29 27.0 30 32.5 31 47.5 32 56.5 33 53.5 34 63.0 35 82.5 36 118.5 37 146.5 38 161.5 39 193.0 40 221.5 41 245.5 42 257.0 43 242.0 44 231.5 45 249.5 46 239.5 47 199.5 48 173.0 49 153.5 50 133.5 51 113.0 52 93.5 53 79.0 54 61.5 55 44.5 56 40.5 57 33.5 58 23.5 59 16.0 60 12.5 61 10.0 62 11.0 63 10.5 64 6.0 65 4.0 66 4.0 67 2.5 68 0.5 69 1.0 70 1.0 71 0.5 72 2.0 73 1.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 51.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 93.99574920297556 88.44999999999999 2 5.738575982996812 10.8 3 0.2656748140276302 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.3625 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.4375 0.0 0.0 0.0 0.0 132-133 0.5 0.0 0.0 0.0 0.0 134-135 0.55 0.0 0.0 0.0 0.0 136-137 0.575 0.0 0.0 0.0 0.0 138 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933783 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933783_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.9275 12.0 2.0 32.0 2.0 32.0 2 30.76375 32.0 32.0 32.0 32.0 32.0 3 32.89625 32.0 32.0 37.0 32.0 37.0 4 34.71375 37.0 32.0 37.0 32.0 37.0 5 35.32125 37.0 37.0 37.0 32.0 37.0 6 37.76575 41.0 37.0 41.0 32.0 41.0 7 36.1125 41.0 37.0 41.0 22.0 41.0 8 39.1025 41.0 41.0 41.0 37.0 41.0 9 39.299 41.0 41.0 41.0 37.0 41.0 10-14 39.28475 41.0 41.0 41.0 37.0 41.0 15-19 39.1473 41.0 41.0 41.0 35.0 41.0 20-24 38.6992 41.0 39.4 41.0 35.0 41.0 25-29 38.504149999999996 41.0 38.6 41.0 33.0 41.0 30-34 38.52329999999999 41.0 38.6 41.0 34.0 41.0 35-39 38.340500000000006 41.0 38.6 41.0 32.0 41.0 40-44 39.12375 41.0 41.0 41.0 36.0 41.0 45-49 39.36255 41.0 41.0 41.0 37.0 41.0 50-54 38.92235 41.0 41.0 41.0 35.0 41.0 55-59 38.4754 41.0 38.6 41.0 32.0 41.0 60-64 37.8899 41.0 37.0 41.0 30.0 41.0 65-69 36.412800000000004 41.0 37.0 41.0 24.0 41.0 70-74 36.6971 41.0 36.0 41.0 26.0 41.0 75-79 36.754450000000006 40.2 35.0 41.0 27.0 41.0 80-84 36.51595 41.0 35.0 41.0 25.0 41.0 85-89 35.98479999999999 41.0 35.0 41.0 24.0 41.0 90-94 34.477149999999995 37.8 30.0 41.0 18.0 41.0 95-99 35.0022 38.6 33.0 41.0 22.0 41.0 100-104 35.51745 38.6 34.0 41.0 23.0 41.0 105-109 33.941050000000004 37.0 31.0 41.0 16.0 41.0 110-114 33.9024 37.0 31.0 41.0 18.0 41.0 115-119 31.4971 36.0 26.0 41.0 12.0 41.0 120-124 29.625999999999998 32.0 22.0 39.4 12.0 41.0 125-129 29.9064 33.0 23.0 40.2 12.0 41.0 130-134 27.395049999999998 30.0 18.0 37.0 12.0 41.0 135-139 23.9542 25.0 12.0 33.0 12.0 38.6 140-144 21.313399999999998 17.0 12.0 29.0 12.0 37.8 145-149 21.8359 20.0 12.0 30.0 11.2 37.0 150 18.3675 12.0 12.0 27.0 12.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 6.0 19 3.0 20 9.0 21 14.0 22 21.0 23 36.0 24 41.0 25 46.0 26 73.0 27 82.0 28 92.0 29 133.0 30 159.0 31 222.0 32 271.0 33 304.0 34 365.0 35 444.0 36 476.0 37 498.0 38 416.0 39 242.0 40 43.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.062346588119787 18.065783014236622 19.587628865979383 33.28424153166421 2 24.9 26.6 33.5 15.0 3 22.6 30.049999999999997 25.874999999999996 21.475 4 23.625 35.725 21.875 18.775 5 22.45 37.75 22.7 17.1 6 15.875 40.675 23.875 19.575 7 15.1 17.4 46.025 21.475 8 20.200000000000003 22.5 28.675 28.625 9 23.325000000000003 23.200000000000003 28.175 25.3 10-14 20.4 30.470000000000002 27.800000000000004 21.33 15-19 21.19 28.27 28.52 22.02 20-24 20.9 29.349999999999998 27.92 21.83 25-29 21.45 29.604999999999997 27.834999999999997 21.11 30-34 21.01 29.925 27.560000000000002 21.505 35-39 21.245 29.425 27.955000000000002 21.375 40-44 21.790000000000003 28.705000000000002 27.79 21.715 45-49 21.12 29.599999999999998 27.839999999999996 21.44 50-54 21.88 28.804999999999996 27.395000000000003 21.92 55-59 21.525 29.37 27.815 21.29 60-64 21.404999999999998 28.485 28.139999999999997 21.97 65-69 21.665 29.580000000000002 27.355 21.4 70-74 21.81 29.215000000000003 27.305 21.67 75-79 21.44 29.439999999999998 27.625 21.495 80-84 22.12 29.160000000000004 27.92 20.8 85-89 21.759999999999998 29.205 27.325 21.709999999999997 90-94 22.45 28.73 27.565 21.255 95-99 21.805 28.735 27.3 22.16 100-104 21.365000000000002 28.955 28.105000000000004 21.575 105-109 21.735 29.26 27.245 21.759999999999998 110-114 22.225 29.349999999999998 27.1 21.325 115-119 21.815 28.810000000000002 27.700000000000003 21.675 120-124 21.63 28.865000000000002 28.04 21.465 125-129 22.065 28.715000000000003 28.055000000000003 21.165 130-134 22.105 29.25 27.815 20.830000000000002 135-139 22.52 28.810000000000002 27.755000000000003 20.915 140-144 23.625 28.999999999999996 28.065 19.31 145-149 22.245 29.080000000000002 28.835 19.84 150 24.725 27.775 31.45 16.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 2.0 22 2.0 23 4.5 24 6.0 25 7.5 26 13.5 27 14.5 28 16.0 29 27.0 30 38.5 31 48.5 32 54.5 33 61.5 34 77.5 35 103.5 36 114.5 37 132.0 38 163.0 39 182.5 40 224.5 41 251.0 42 236.5 43 241.0 44 263.5 45 241.5 46 212.0 47 204.5 48 194.0 49 172.0 50 138.0 51 120.0 52 99.0 53 74.0 54 53.0 55 37.0 56 38.5 57 30.5 58 20.5 59 20.0 60 12.0 61 7.5 62 8.0 63 5.0 64 4.0 65 4.5 66 3.0 67 2.0 68 1.0 69 0.5 70 2.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content fail #Base N-Count 1 49.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.39005027785127 89.17500000000001 2 5.3717914792273085 10.15 3 0.23815824292140775 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.5375 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.675 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.725 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426010 spots for SRR5933783.sra Written 1426010 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra Read 1426004 spots for SRR5933783.sra Written 1426004 spots for SRR5933783.sra SRR ids: ['SRR5933783.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6g483j7 SRR5933783.sra spots: 28520086 blocks: [[1, 1426004], [1426005, 2852008], [2852009, 4278012], [4278013, 5704016], [5704017, 7130020], [7130021, 8556024], [8556025, 9982028], [9982029, 11408032], [11408033, 12834036], [12834037, 14260040], [14260041, 15686044], [15686045, 17112048], [17112049, 18538052], [18538053, 19964056], [19964057, 21390060], [21390061, 22816064], [22816065, 24242068], [24242069, 25668072], [25668073, 27094076], [27094077, 28520086]] SRR5933783 file size 9587117 SRR5933783 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933783 SRR5933783_1.fastq SRR5933783_2.fastq Input file: SRR5933783_1.fastq Paired file: SRR5933783_2.fastq trimmed: SRR5933783-trimmed-pair1.fastq, SRR5933783-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:06:29 2025 >> started Mon Feb 10 19:07:00 2025 >> done (31.001s) 28520086 read pairs processed; of these: 262 ( 0.00%) short read pairs filtered out after trimming by size control 68 ( 0.00%) empty read pairs filtered out after trimming by size control 28519756 (100.00%) read pairs available; of these: 1961332 ( 6.88%) trimmed read pairs available after processing 26558424 (93.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 72 0.00% 19 79 0.00% 20 75 0.00% 21 114 0.00% 22 156 0.00% 23 195 0.00% 24 257 0.00% 25 251 0.00% 26 256 0.00% 27 312 0.00% 28 325 0.00% 29 281 0.00% 30 384 0.00% 31 391 0.00% 32 370 0.00% 33 371 0.00% 34 389 0.00% 35 458 0.00% 36 486 0.00% 37 440 0.00% 38 487 0.00% 39 479 0.00% 40 527 0.00% 41 481 0.00% 42 529 0.00% 43 510 0.00% 44 507 0.00% 45 540 0.00% 46 515 0.00% 47 543 0.00% 48 508 0.00% 49 542 0.00% 50 549 0.00% 51 537 0.00% 52 572 0.00% 53 602 0.00% 54 606 0.00% 55 565 0.00% 56 517 0.00% 57 567 0.00% 58 581 0.00% 59 565 0.00% 60 614 0.00% 61 588 0.00% 62 563 0.00% 63 553 0.00% 64 526 0.00% 65 584 0.00% 66 572 0.00% 67 557 0.00% 68 579 0.00% 69 568 0.00% 70 558 0.00% 71 596 0.00% 72 627 0.00% 73 647 0.00% 74 610 0.00% 75 617 0.00% 76 668 0.00% 77 686 0.00% 78 760 0.00% 79 797 0.00% 80 786 0.00% 81 762 0.00% 82 767 0.00% 83 819 0.00% 84 975 0.00% 85 946 0.00% 86 989 0.00% 87 971 0.00% 88 1107 0.00% 89 1133 0.00% 90 1182 0.00% 91 1242 0.00% 92 1357 0.00% 93 1432 0.01% 94 1476 0.01% 95 1647 0.01% 96 1677 0.01% 97 1823 0.01% 98 1845 0.01% 99 1937 0.01% 100 2053 0.01% 101 2139 0.01% 102 2390 0.01% 103 2420 0.01% 104 2609 0.01% 105 2684 0.01% 106 2782 0.01% 107 2989 0.01% 108 3142 0.01% 109 3348 0.01% 110 3391 0.01% 111 3647 0.01% 112 3884 0.01% 113 3953 0.01% 114 4208 0.01% 115 4421 0.02% 116 4591 0.02% 117 4904 0.02% 118 5044 0.02% 119 5310 0.02% 120 5423 0.02% 121 5784 0.02% 122 6078 0.02% 123 6387 0.02% 124 6633 0.02% 125 6951 0.02% 126 7245 0.03% 127 7786 0.03% 128 7700 0.03% 129 8283 0.03% 130 8714 0.03% 131 9122 0.03% 132 9401 0.03% 133 9975 0.03% 134 10340 0.04% 135 10865 0.04% 136 11358 0.04% 137 11776 0.04% 138 12367 0.04% 139 12692 0.04% 140 13309 0.05% 141 13942 0.05% 142 14299 0.05% 143 15305 0.05% 144 16229 0.06% 145 17714 0.06% 146 22243 0.08% 147 41325 0.14% 148 147420 0.52% 149 1360123 4.77% 150 26558424 93.12% 28519756 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=39 prefix-density=0.09 prefix-fanout=2.6 sequence=CCAGACCAGCAGAGGTTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=150.41 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=19.8 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=39 prefix-density=0.10 prefix-fanout=2.4 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=382.39 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=32.0 sequence=AAGAAGAAGATG SRR5933783 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 19:27:08 Started mapping on | Feb 10 19:27:08 Finished on | Feb 10 19:33:58 Mapping speed, Million of reads per hour | 250.37 Number of input reads | 28514094 Average input read length | 275 UNIQUE READS: Uniquely mapped reads number | 22226458 Uniquely mapped reads % | 77.95% Average mapped length | 266.03 Number of splices: Total | 15423660 Number of splices: Annotated (sjdb) | 14712892 Number of splices: GT/AG | 15042987 Number of splices: GC/AG | 185552 Number of splices: AT/AC | 11176 Number of splices: Non-canonical | 183945 Mismatch rate per base, % | 2.29% Deletion rate per base | 0.14% Deletion average length | 3.18 Insertion rate per base | 0.10% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1524472 % of reads mapped to multiple loci | 5.35% Number of reads mapped to too many loci | 16542 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.47% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4763211 4763211 4763211 N_multimapping 1524472 1524472 1524472 N_noFeature 637357 11399566 11343061 N_ambiguous 416562 148951 149167 UnstrandedReadsAssigned:21172539 PositiveStrandReadsAssigned:10677941 NegativeStrandReadsAssigned:10734230 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR5933783 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933783-trimmed-pair1.fastq SRR5933783-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,514,094 reads, 22,293,743 reads pseudoaligned [quant] estimated average fragment length: 226.639 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR5933783.ke.tsv 34699 SRR5933783.se.tsv 87100 total ==> SRR5933783.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.36 5862.76 134.466 Potri.005G024800.1.v4.1 1035 809.361 1903 96.6568 Potri.004G059700.1.v4.1 961 735.361 24 1.34167 Potri.007G009000.2.v4.1 1416 1190.36 1 0.0345348 Potri.003G141000.2.v4.1 2943 2717.36 599 9.06182 Potri.016G087400.1.v4.1 270 64.1293 429 275.002 Potri.015G069301.1.v4.1 564 338.471 0 0 Potri.010G195200.1.v4.1 1773 1547.36 448.786 11.9229 Potri.012G127500.1.v4.1 977 751.361 9151 500.675 ==> SRR5933783.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 11 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 9 Potri.001G452600.v4.1 529 SRR5933783 completed mapping pipeline successfully