Starting /dee2/code/volunteer_pipeline.sh SRR5933784 current disk space = 3057361293312 free memory = 1446655988 SRR5933784 SRAfilesize 14b261fa7c643f99703600fe1565a9ab SRR5933784.sra SRR5933784.sra file validated SRR5933784 is paired end SRR5933784 is conventional basespace SRR5933784 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.5575 32.0 2.0 32.0 2.0 32.0 2 27.7675 32.0 27.0 32.0 12.0 32.0 3 33.02 32.0 32.0 37.0 32.0 37.0 4 35.90875 37.0 37.0 37.0 32.0 37.0 5 35.95375 37.0 37.0 37.0 32.0 37.0 6 39.315 41.0 41.0 41.0 37.0 41.0 7 39.6035 41.0 41.0 41.0 37.0 41.0 8 39.77025 41.0 41.0 41.0 37.0 41.0 9 40.081 41.0 41.0 41.0 37.0 41.0 10-14 39.926649999999995 41.0 41.0 41.0 37.0 41.0 15-19 39.91459999999999 41.0 41.0 41.0 37.0 41.0 20-24 39.84675 41.0 41.0 41.0 37.0 41.0 25-29 39.5067 41.0 41.0 41.0 37.0 41.0 30-34 39.74965 41.0 41.0 41.0 37.0 41.0 35-39 39.3095 41.0 41.0 41.0 37.0 41.0 40-44 39.48825 41.0 41.0 41.0 37.0 41.0 45-49 39.45785 41.0 41.0 41.0 37.0 41.0 50-54 39.19575 41.0 41.0 41.0 35.0 41.0 55-59 38.84689999999999 41.0 40.2 41.0 35.0 41.0 60-64 39.37495 41.0 41.0 41.0 37.0 41.0 65-69 39.2699 41.0 41.0 41.0 36.0 41.0 70-74 39.2549 41.0 41.0 41.0 37.0 41.0 75-79 38.92165000000001 41.0 39.4 41.0 34.0 41.0 80-84 38.867999999999995 41.0 40.2 41.0 34.0 41.0 85-89 38.702999999999996 41.0 39.4 41.0 34.0 41.0 90-94 38.865899999999996 41.0 40.2 41.0 33.0 41.0 95-99 39.0536 41.0 41.0 41.0 36.0 41.0 100-104 38.644850000000005 41.0 40.2 41.0 34.0 41.0 105-109 38.795449999999995 41.0 40.2 41.0 33.0 41.0 110-114 38.567449999999994 41.0 37.8 41.0 32.0 41.0 115-119 37.5692 41.0 36.0 41.0 29.0 41.0 120-124 36.7621 40.2 36.0 41.0 28.0 41.0 125-129 34.747749999999996 39.4 32.0 41.0 18.0 41.0 130-134 35.066500000000005 39.4 34.0 41.0 18.0 41.0 135-139 33.8398 38.6 29.0 41.0 18.0 41.0 140-144 34.1335 38.4 31.0 41.0 20.0 41.0 145-149 29.52525 32.0 21.0 38.4 14.0 40.2 150 29.0425 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 2.0 24 3.0 25 12.0 26 12.0 27 25.0 28 34.0 29 44.0 30 50.0 31 60.0 32 82.0 33 105.0 34 148.0 35 195.0 36 320.0 37 414.0 38 653.0 39 1064.0 40 773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.24427480916031 16.50763358778626 20.08587786259542 35.162213740458014 2 25.775 27.025 32.074999999999996 15.125 3 22.8 29.4 25.224999999999998 22.575 4 23.575 37.724999999999994 20.775 17.925 5 23.175 38.7 19.475 18.65 6 16.8 39.75 23.625 19.825 7 15.875 16.825000000000003 43.0 24.3 8 18.75 21.975 28.749999999999996 30.525000000000002 9 21.475 22.075 29.875 26.575 10-14 20.974999999999998 30.154999999999998 27.05 21.82 15-19 21.125 28.4 28.194999999999997 22.28 20-24 20.89 29.705 27.165 22.24 25-29 21.46 29.095 27.355 22.09 30-34 20.775 29.095 27.650000000000002 22.48 35-39 21.14 28.915000000000003 27.355 22.59 40-44 22.0 28.175 27.965 21.86 45-49 20.615 29.37 28.13 21.884999999999998 50-54 21.755 28.335 27.605 22.305 55-59 21.755 28.825 27.474999999999998 21.945 60-64 21.235 28.78 28.04 21.945 65-69 21.634999999999998 27.985 27.96 22.42 70-74 22.095000000000002 28.685 27.72 21.5 75-79 21.57 27.810000000000002 28.185 22.435 80-84 21.45 28.384999999999998 27.584999999999997 22.58 85-89 22.105 28.139999999999997 27.705000000000002 22.05 90-94 21.11 28.410000000000004 27.67 22.81 95-99 21.855 28.189999999999998 27.92 22.035 100-104 21.43 27.935 27.650000000000002 22.985 105-109 22.720000000000002 27.85 27.12 22.31 110-114 22.040000000000003 28.335 27.41 22.215 115-119 21.72 28.185 27.825 22.27 120-124 22.025 28.04 27.47 22.465 125-129 22.68 27.37 27.965 21.985 130-134 21.95 28.08 27.615000000000002 22.355 135-139 22.005 27.905 28.475 21.615000000000002 140-144 21.735 28.57 27.939999999999998 21.755 145-149 22.09 28.215 29.065 20.630000000000003 150 22.1 27.275 27.224999999999998 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 2.0 22 3.5 23 3.5 24 4.5 25 6.0 26 7.5 27 13.5 28 14.5 29 16.5 30 23.5 31 33.0 32 43.5 33 55.5 34 69.0 35 86.5 36 106.5 37 138.5 38 166.5 39 176.0 40 200.0 41 219.5 42 244.5 43 272.0 44 260.5 45 235.5 46 228.0 47 228.5 48 203.5 49 175.0 50 157.5 51 126.5 52 97.0 53 81.5 54 67.5 55 42.0 56 32.5 57 33.5 58 25.5 59 21.0 60 17.0 61 13.0 62 8.5 63 7.5 64 7.5 65 4.5 66 3.0 67 1.5 68 0.5 69 1.5 70 2.0 71 1.5 72 1.0 73 1.5 74 2.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 47.599999999999994 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.54149986655992 87.625 2 6.164931945556445 11.55 3 0.29356818788364025 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGATC 10 0.0070410464 143.53749 2 >>END_MODULE SRR5933784 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933784_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.11125 32.0 2.0 32.0 2.0 32.0 2 30.74125 32.0 32.0 32.0 32.0 32.0 3 33.005 32.0 32.0 37.0 32.0 37.0 4 34.65375 37.0 32.0 37.0 32.0 37.0 5 35.12 37.0 37.0 37.0 32.0 37.0 6 37.75625 41.0 37.0 41.0 32.0 41.0 7 36.0105 41.0 37.0 41.0 22.0 41.0 8 39.1445 41.0 41.0 41.0 37.0 41.0 9 39.1315 41.0 41.0 41.0 37.0 41.0 10-14 39.16955 41.0 41.0 41.0 36.0 41.0 15-19 39.0725 41.0 41.0 41.0 35.0 41.0 20-24 38.64165 41.0 39.4 41.0 34.0 41.0 25-29 38.2884 41.0 38.6 41.0 33.0 41.0 30-34 38.3531 41.0 37.8 41.0 32.0 41.0 35-39 38.21175 41.0 37.8 41.0 31.0 41.0 40-44 39.0307 41.0 40.2 41.0 35.0 41.0 45-49 39.261250000000004 41.0 41.0 41.0 37.0 41.0 50-54 38.9209 41.0 41.0 41.0 35.0 41.0 55-59 38.365750000000006 41.0 38.6 41.0 32.0 41.0 60-64 37.91735 41.0 37.0 41.0 30.0 41.0 65-69 36.2726 41.0 37.0 41.0 22.0 41.0 70-74 36.6009 41.0 36.0 41.0 25.0 41.0 75-79 36.60385 40.2 35.0 41.0 26.0 41.0 80-84 36.30385 41.0 35.0 41.0 25.0 41.0 85-89 35.80355000000001 41.0 35.0 41.0 23.0 41.0 90-94 34.402699999999996 38.6 30.0 41.0 18.0 41.0 95-99 34.8518 38.6 32.0 41.0 21.0 41.0 100-104 35.2492 37.8 33.0 41.0 22.0 41.0 105-109 33.80335 37.0 31.0 41.0 16.0 41.0 110-114 33.6909 37.0 30.0 41.0 16.0 41.0 115-119 31.43845 35.0 26.0 41.0 12.0 41.0 120-124 29.58315 32.0 22.0 38.6 12.0 41.0 125-129 29.51385 31.0 22.0 40.2 12.0 41.0 130-134 27.3998 28.0 18.0 37.0 12.0 41.0 135-139 23.8171 25.0 12.0 33.0 11.2 38.6 140-144 20.9219 17.0 12.0 29.0 9.6 37.8 145-149 21.5514 20.0 12.0 30.0 11.2 36.0 150 18.286 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 5.0 19 11.0 20 8.0 21 9.0 22 25.0 23 31.0 24 41.0 25 57.0 26 69.0 27 96.0 28 110.0 29 134.0 30 188.0 31 216.0 32 239.0 33 311.0 34 369.0 35 435.0 36 466.0 37 511.0 38 426.0 39 204.0 40 36.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.009049773755656 16.063348416289593 20.407239819004523 35.52036199095023 2 26.400000000000002 25.2 33.900000000000006 14.499999999999998 3 23.549999999999997 27.650000000000002 26.025 22.775000000000002 4 23.525 35.075 21.3 20.1 5 22.775000000000002 37.175000000000004 22.375 17.675 6 16.35 38.125 25.5 20.025000000000002 7 15.174999999999999 17.45 44.7 22.675 8 19.75 21.45 28.475 30.325000000000003 9 20.65 22.7 29.525000000000002 27.125 10-14 20.355 30.814999999999998 27.48 21.349999999999998 15-19 21.42 27.41 28.794999999999998 22.375 20-24 21.81 29.28 27.46 21.45 25-29 21.834999999999997 29.160000000000004 27.555000000000003 21.45 30-34 21.445 29.104999999999997 27.32 22.13 35-39 22.1 29.25 27.185 21.465 40-44 21.98 28.685 27.55 21.785 45-49 21.695 28.565 27.644999999999996 22.095000000000002 50-54 21.935 28.499999999999996 27.744999999999997 21.82 55-59 21.115000000000002 29.32 27.565 22.0 60-64 21.875 28.205000000000002 27.700000000000003 22.220000000000002 65-69 21.555 29.925 27.084999999999997 21.435000000000002 70-74 22.125 29.445 27.12 21.310000000000002 75-79 22.495 28.62 27.065 21.82 80-84 21.87 28.749999999999996 27.779999999999998 21.6 85-89 22.02 28.775000000000002 27.889999999999997 21.315 90-94 22.03 28.205000000000002 28.01 21.755 95-99 22.575 28.470000000000002 27.12 21.834999999999997 100-104 22.35 28.335 27.615000000000002 21.7 105-109 21.86 28.255000000000003 28.000000000000004 21.884999999999998 110-114 21.92 28.165000000000003 27.800000000000004 22.115000000000002 115-119 21.98 29.4 27.474999999999998 21.145 120-124 21.5 28.645 27.865000000000002 21.990000000000002 125-129 22.305 28.52 27.58 21.595 130-134 22.985 28.71 27.355 20.95 135-139 22.925 28.849999999999998 27.165 21.060000000000002 140-144 23.880000000000003 27.785 28.694999999999997 19.64 145-149 23.044999999999998 28.025 28.595 20.335 150 26.400000000000002 27.125 31.3 15.174999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 4.0 23 5.0 24 6.0 25 6.0 26 7.0 27 15.0 28 22.0 29 27.5 30 31.0 31 32.5 32 42.0 33 65.0 34 83.5 35 93.0 36 107.5 37 119.5 38 145.0 39 173.5 40 211.5 41 231.0 42 239.5 43 258.5 44 253.0 45 248.0 46 227.0 47 195.5 48 179.0 49 171.0 50 160.0 51 134.0 52 104.0 53 78.5 54 63.5 55 52.0 56 45.5 57 37.0 58 24.5 59 19.0 60 14.5 61 12.0 62 11.5 63 9.5 64 6.0 65 5.5 66 4.0 67 3.0 68 1.5 69 1.0 70 2.0 71 2.0 72 1.5 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 44.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.16600371254309 88.775 2 5.595332802970034 10.549999999999999 3 0.23866348448687352 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACTT 10 0.0070355474 143.57501 7 >>END_MODULE Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344211 spots for SRR5933784.sra Written 1344211 spots for SRR5933784.sra Read 1344222 spots for SRR5933784.sra Written 1344222 spots for SRR5933784.sra SRR ids: ['SRR5933784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hkt6h4jo SRR5933784.sra spots: 26884231 blocks: [[1, 1344211], [1344212, 2688422], [2688423, 4032633], [4032634, 5376844], [5376845, 6721055], [6721056, 8065266], [8065267, 9409477], [9409478, 10753688], [10753689, 12097899], [12097900, 13442110], [13442111, 14786321], [14786322, 16130532], [16130533, 17474743], [17474744, 18818954], [18818955, 20163165], [20163166, 21507376], [21507377, 22851587], [22851588, 24195798], [24195799, 25540009], [25540010, 26884231]] SRR5933784 file size 9035975 SRR5933784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933784 SRR5933784_1.fastq SRR5933784_2.fastq Input file: SRR5933784_1.fastq Paired file: SRR5933784_2.fastq trimmed: SRR5933784-trimmed-pair1.fastq, SRR5933784-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:49:57 2025 >> started Mon Feb 10 18:50:40 2025 >> done (43.373s) 26884231 read pairs processed; of these: 204 ( 0.00%) short read pairs filtered out after trimming by size control 62 ( 0.00%) empty read pairs filtered out after trimming by size control 26883965 (100.00%) read pairs available; of these: 1989118 ( 7.40%) trimmed read pairs available after processing 24894847 (92.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 39 0.00% 20 55 0.00% 21 74 0.00% 22 113 0.00% 23 138 0.00% 24 193 0.00% 25 208 0.00% 26 219 0.00% 27 223 0.00% 28 275 0.00% 29 241 0.00% 30 281 0.00% 31 293 0.00% 32 303 0.00% 33 296 0.00% 34 310 0.00% 35 331 0.00% 36 341 0.00% 37 338 0.00% 38 354 0.00% 39 326 0.00% 40 384 0.00% 41 338 0.00% 42 357 0.00% 43 395 0.00% 44 377 0.00% 45 416 0.00% 46 376 0.00% 47 417 0.00% 48 448 0.00% 49 422 0.00% 50 414 0.00% 51 427 0.00% 52 448 0.00% 53 407 0.00% 54 405 0.00% 55 474 0.00% 56 450 0.00% 57 430 0.00% 58 453 0.00% 59 464 0.00% 60 443 0.00% 61 445 0.00% 62 459 0.00% 63 423 0.00% 64 429 0.00% 65 465 0.00% 66 504 0.00% 67 484 0.00% 68 519 0.00% 69 489 0.00% 70 523 0.00% 71 480 0.00% 72 545 0.00% 73 572 0.00% 74 514 0.00% 75 544 0.00% 76 551 0.00% 77 628 0.00% 78 632 0.00% 79 698 0.00% 80 621 0.00% 81 718 0.00% 82 732 0.00% 83 816 0.00% 84 836 0.00% 85 914 0.00% 86 941 0.00% 87 975 0.00% 88 1028 0.00% 89 1078 0.00% 90 1168 0.00% 91 1250 0.00% 92 1280 0.00% 93 1375 0.01% 94 1518 0.01% 95 1527 0.01% 96 1659 0.01% 97 1767 0.01% 98 1900 0.01% 99 2099 0.01% 100 2160 0.01% 101 2340 0.01% 102 2574 0.01% 103 2700 0.01% 104 2775 0.01% 105 2980 0.01% 106 3210 0.01% 107 3351 0.01% 108 3475 0.01% 109 3668 0.01% 110 3757 0.01% 111 4176 0.02% 112 4468 0.02% 113 4711 0.02% 114 4819 0.02% 115 5219 0.02% 116 5262 0.02% 117 5541 0.02% 118 5721 0.02% 119 6130 0.02% 120 6354 0.02% 121 6545 0.02% 122 7000 0.03% 123 7422 0.03% 124 7819 0.03% 125 7910 0.03% 126 8377 0.03% 127 8695 0.03% 128 9085 0.03% 129 9525 0.04% 130 10046 0.04% 131 10472 0.04% 132 10557 0.04% 133 11423 0.04% 134 11600 0.04% 135 12245 0.05% 136 13029 0.05% 137 13245 0.05% 138 13684 0.05% 139 14343 0.05% 140 14927 0.06% 141 15497 0.06% 142 16367 0.06% 143 16894 0.06% 144 17630 0.07% 145 19392 0.07% 146 23872 0.09% 147 44003 0.16% 148 151371 0.56% 149 1342904 5.00% 150 24894847 92.60% 26883965 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=24 prefix-density=0.44 prefix-fanout=2.5 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=100.23 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=18.0 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=2.6 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=117.13 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=19.3 sequence=GCTGCTGCTGCT SRR5933784 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:52:31 Started mapping on | Feb 10 18:52:31 Finished on | Feb 10 19:00:45 Mapping speed, Million of reads per hour | 195.92 Number of input reads | 26883965 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21653843 Uniquely mapped reads % | 80.55% Average mapped length | 281.38 Number of splices: Total | 19196548 Number of splices: Annotated (sjdb) | 18646560 Number of splices: GT/AG | 18782892 Number of splices: GC/AG | 232920 Number of splices: AT/AC | 15536 Number of splices: Non-canonical | 165200 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.13% Deletion average length | 3.17 Insertion rate per base | 0.09% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1247761 % of reads mapped to multiple loci | 4.64% Number of reads mapped to too many loci | 13581 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.55% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3982363 3982363 3982363 N_multimapping 1247761 1247761 1247761 N_noFeature 500341 11042947 10983361 N_ambiguous 333934 103148 104033 UnstrandedReadsAssigned:20819568 PositiveStrandReadsAssigned:10507748 NegativeStrandReadsAssigned:10566449 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5933784 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933784-trimmed-pair1.fastq SRR5933784-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,883,965 reads, 21,132,356 reads pseudoaligned [quant] estimated average fragment length: 242.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR5933784.ke.tsv 34699 SRR5933784.se.tsv 87100 total ==> SRR5933784.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.69 1059.42 22.6614 Potri.005G024800.1.v4.1 1035 793.69 370 17.7166 Potri.004G059700.1.v4.1 961 719.695 79 4.17165 Potri.007G009000.2.v4.1 1416 1174.69 0 0 Potri.003G141000.2.v4.1 2943 2701.69 640.27 9.0065 Potri.016G087400.1.v4.1 270 56.9576 782.309 521.982 Potri.015G069301.1.v4.1 564 322.803 0 0 Potri.010G195200.1.v4.1 1773 1531.69 91 2.25787 Potri.012G127500.1.v4.1 977 735.69 2302 118.916 ==> SRR5933784.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 4 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 183 SRR5933784 completed mapping pipeline successfully