Starting /dee2/code/volunteer_pipeline.sh SRR5933785 current disk space = 3057019146240 free memory = 1160865344 SRR5933785 SRAfilesize a31daef54185232fbc880c6b6d62a8ac SRR5933785.sra SRR5933785.sra file validated SRR5933785 is paired end SRR5933785 is conventional basespace SRR5933785 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.005 32.0 2.0 32.0 2.0 32.0 2 27.8 32.0 27.0 32.0 12.0 32.0 3 33.02125 32.0 32.0 37.0 32.0 37.0 4 35.8725 37.0 37.0 37.0 32.0 37.0 5 35.71125 37.0 37.0 37.0 32.0 37.0 6 39.173 41.0 41.0 41.0 37.0 41.0 7 39.60675 41.0 41.0 41.0 37.0 41.0 8 39.81025 41.0 41.0 41.0 37.0 41.0 9 40.02125 41.0 41.0 41.0 37.0 41.0 10-14 39.89425 41.0 41.0 41.0 37.0 41.0 15-19 39.89235 41.0 41.0 41.0 37.0 41.0 20-24 39.769600000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.39375 41.0 40.2 41.0 36.0 41.0 30-34 39.6562 41.0 41.0 41.0 37.0 41.0 35-39 39.258250000000004 41.0 41.0 41.0 36.0 41.0 40-44 39.49975 41.0 41.0 41.0 36.0 41.0 45-49 39.4293 41.0 41.0 41.0 37.0 41.0 50-54 39.0943 41.0 41.0 41.0 35.0 41.0 55-59 38.77245 41.0 39.4 41.0 34.0 41.0 60-64 39.258849999999995 41.0 41.0 41.0 36.0 41.0 65-69 39.0443 41.0 41.0 41.0 35.0 41.0 70-74 39.193799999999996 41.0 41.0 41.0 37.0 41.0 75-79 38.87485 41.0 39.4 41.0 34.0 41.0 80-84 38.8159 41.0 40.2 41.0 34.0 41.0 85-89 38.560950000000005 41.0 38.6 41.0 34.0 41.0 90-94 38.76365 41.0 40.2 41.0 33.0 41.0 95-99 38.88715 41.0 40.2 41.0 35.0 41.0 100-104 38.49065 41.0 38.6 41.0 32.0 41.0 105-109 38.6124 41.0 39.4 41.0 33.0 41.0 110-114 38.3649 41.0 37.8 41.0 32.0 41.0 115-119 37.3032 41.0 36.0 41.0 28.0 41.0 120-124 36.493100000000005 40.2 36.0 41.0 24.0 41.0 125-129 34.501 38.6 32.0 41.0 18.0 41.0 130-134 34.794050000000006 39.4 34.0 41.0 18.0 41.0 135-139 33.5539 38.6 29.0 41.0 16.0 41.0 140-144 33.828250000000004 38.4 29.0 41.0 19.0 41.0 145-149 29.24875 32.0 21.0 38.4 12.0 40.2 150 28.92525 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 4.0 24 5.0 25 12.0 26 16.0 27 28.0 28 37.0 29 38.0 30 54.0 31 72.0 32 114.0 33 126.0 34 147.0 35 216.0 36 271.0 37 396.0 38 629.0 39 1093.0 40 737.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.074245939675173 16.844547563805104 18.329466357308586 36.75174013921114 2 26.174999999999997 27.875 32.125 13.825000000000001 3 21.825 30.475 26.6 21.099999999999998 4 23.674999999999997 35.6 20.45 20.275000000000002 5 22.125 38.875 22.5 16.5 6 16.125 40.775 23.599999999999998 19.5 7 16.025 16.925 44.35 22.7 8 18.375 23.474999999999998 29.325000000000003 28.825 9 20.3 23.25 29.425 27.025 10-14 20.395 30.545 27.3 21.759999999999998 15-19 21.545 27.79 28.299999999999997 22.365 20-24 21.46 28.95 27.655 21.935 25-29 21.349999999999998 29.099999999999998 27.485 22.065 30-34 20.97 30.19 27.205000000000002 21.634999999999998 35-39 21.995 29.03 26.97 22.005 40-44 21.955 28.57 28.000000000000004 21.475 45-49 21.3 28.665000000000003 27.944999999999997 22.09 50-54 21.759999999999998 29.154999999999998 27.54 21.545 55-59 21.310000000000002 28.71 28.305000000000003 21.675 60-64 21.279999999999998 29.12 27.515 22.085 65-69 21.275 28.575 27.900000000000002 22.25 70-74 21.805 28.555000000000003 27.810000000000002 21.83 75-79 21.19 28.939999999999998 28.075 21.795 80-84 21.58 28.57 27.700000000000003 22.15 85-89 21.81 28.849999999999998 28.015 21.325 90-94 22.37 28.294999999999998 27.565 21.77 95-99 21.61 28.735 27.6 22.055 100-104 21.85 28.095 28.000000000000004 22.055 105-109 21.404999999999998 28.815 27.889999999999997 21.89 110-114 21.97 28.560000000000002 27.73 21.740000000000002 115-119 21.67 28.144999999999996 28.575 21.61 120-124 21.705 27.68 28.425 22.189999999999998 125-129 21.41 28.384999999999998 28.494999999999997 21.709999999999997 130-134 22.259999999999998 27.339999999999996 28.444999999999997 21.955 135-139 22.35 28.299999999999997 28.444999999999997 20.905 140-144 21.65 28.075 28.68 21.595 145-149 21.83 28.33 28.815 21.025 150 21.45 28.4 28.625 21.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.5 17 1.0 18 0.5 19 0.0 20 1.5 21 3.5 22 2.5 23 3.0 24 4.5 25 8.5 26 9.5 27 10.5 28 14.5 29 26.5 30 35.5 31 38.0 32 45.0 33 57.0 34 75.5 35 98.0 36 114.5 37 127.5 38 148.0 39 179.5 40 221.5 41 237.0 42 239.0 43 252.0 44 254.5 45 236.0 46 228.0 47 221.0 48 188.0 49 156.0 50 145.0 51 137.5 52 112.0 53 81.0 54 58.0 55 43.0 56 38.5 57 29.0 58 15.5 59 16.0 60 13.5 61 9.0 62 10.0 63 8.0 64 6.5 65 7.5 66 6.0 67 2.5 68 1.5 69 2.5 70 2.5 71 1.5 72 2.0 73 2.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 46.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.42421812349639 87.375 2 6.228281208233093 11.65 3 0.3475006682705159 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGACT 10 0.0070392117 143.55 6 ATCCCTC 10 0.0070392117 143.55 5 >>END_MODULE SRR5933785 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933785_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.36875 32.0 2.0 32.0 2.0 32.0 2 30.61125 32.0 32.0 32.0 27.0 32.0 3 33.0575 32.0 32.0 37.0 32.0 37.0 4 34.515 37.0 32.0 37.0 32.0 37.0 5 35.2625 37.0 37.0 37.0 32.0 37.0 6 37.48475 41.0 37.0 41.0 32.0 41.0 7 35.90675 41.0 37.0 41.0 22.0 41.0 8 39.08425 41.0 37.0 41.0 37.0 41.0 9 39.12575 41.0 41.0 41.0 37.0 41.0 10-14 39.090999999999994 41.0 41.0 41.0 36.0 41.0 15-19 39.04064999999999 41.0 41.0 41.0 35.0 41.0 20-24 38.549400000000006 41.0 39.4 41.0 33.0 41.0 25-29 38.143150000000006 41.0 37.8 41.0 32.0 41.0 30-34 38.34015 41.0 38.6 41.0 33.0 41.0 35-39 38.1981 41.0 37.8 41.0 31.0 41.0 40-44 39.0808 41.0 40.2 41.0 35.0 41.0 45-49 39.272000000000006 41.0 41.0 41.0 37.0 41.0 50-54 38.826049999999995 41.0 41.0 41.0 34.0 41.0 55-59 38.27845 41.0 38.6 41.0 31.0 41.0 60-64 37.71055 41.0 37.0 41.0 30.0 41.0 65-69 36.275600000000004 41.0 37.0 41.0 23.0 41.0 70-74 36.42085 41.0 36.0 41.0 25.0 41.0 75-79 36.514500000000005 40.2 35.0 41.0 26.0 41.0 80-84 36.2347 41.0 35.0 41.0 25.0 41.0 85-89 35.68915 41.0 35.0 41.0 22.0 41.0 90-94 34.2628 38.6 30.0 41.0 18.0 41.0 95-99 34.68085000000001 38.6 32.0 41.0 20.0 41.0 100-104 35.1186 37.8 33.0 41.0 22.0 41.0 105-109 33.680150000000005 37.0 31.0 41.0 12.0 41.0 110-114 33.7325 37.0 31.0 41.0 18.0 41.0 115-119 31.20165 35.0 25.0 41.0 12.0 41.0 120-124 29.36065 32.0 22.0 37.8 12.0 41.0 125-129 29.375700000000002 32.0 21.0 40.2 12.0 41.0 130-134 27.109799999999996 28.0 18.0 37.0 12.0 41.0 135-139 23.727249999999998 25.0 12.0 33.0 12.0 38.6 140-144 20.93415 17.0 12.0 29.0 9.6 37.0 145-149 21.4693 20.0 12.0 29.0 11.2 36.0 150 17.85375 12.0 12.0 22.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 5.0 19 6.0 20 17.0 21 14.0 22 30.0 23 33.0 24 48.0 25 59.0 26 71.0 27 96.0 28 126.0 29 130.0 30 191.0 31 197.0 32 266.0 33 292.0 34 358.0 35 419.0 36 457.0 37 499.0 38 436.0 39 217.0 40 29.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.44227353463588 17.80639431616341 19.893428063943162 34.857904085257545 2 25.1 25.95 34.849999999999994 14.099999999999998 3 22.275 30.3 26.25 21.175 4 23.25 36.05 20.65 20.05 5 24.325 37.35 21.025 17.299999999999997 6 16.950000000000003 38.175 25.15 19.725 7 14.774999999999999 17.275 46.800000000000004 21.15 8 19.475 23.3 28.4 28.825 9 20.275000000000002 22.75 29.975 27.0 10-14 20.794999999999998 30.294999999999998 27.685 21.224999999999998 15-19 21.26 27.800000000000004 28.945 21.995 20-24 20.965 29.57 27.625 21.84 25-29 21.32 29.220000000000002 27.975 21.485000000000003 30-34 21.060000000000002 29.085 27.965 21.89 35-39 20.94 29.065 28.275 21.72 40-44 21.765 28.299999999999997 28.015 21.92 45-49 21.29 28.7 28.175 21.834999999999997 50-54 21.16 28.83 27.98 22.03 55-59 21.435000000000002 29.099999999999998 27.900000000000002 21.565 60-64 21.22 28.625 28.325 21.83 65-69 21.93 28.945 27.47 21.654999999999998 70-74 21.349999999999998 29.294999999999998 27.705000000000002 21.65 75-79 21.38 28.64 28.04 21.94 80-84 21.555 29.67 27.639999999999997 21.135 85-89 22.175 29.13 27.445000000000004 21.25 90-94 21.645 29.125 27.655 21.575 95-99 21.88 28.815 27.93 21.375 100-104 21.0 28.794999999999998 27.625 22.58 105-109 21.65 28.82 27.529999999999998 22.0 110-114 21.93 28.849999999999998 27.750000000000004 21.47 115-119 21.845 29.255 27.36 21.54 120-124 21.625 28.53 27.61 22.235 125-129 22.195 28.96 27.49 21.355 130-134 22.015 29.145 27.61 21.23 135-139 22.415 28.615000000000002 27.685 21.285 140-144 23.724999999999998 28.65 27.939999999999998 19.685 145-149 23.02 28.810000000000002 28.299999999999997 19.869999999999997 150 24.75 27.474999999999998 32.35 15.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.5 18 4.0 19 4.5 20 3.5 21 3.0 22 2.5 23 4.5 24 5.5 25 7.0 26 13.0 27 14.0 28 14.5 29 23.5 30 34.5 31 44.0 32 57.0 33 68.0 34 81.0 35 99.0 36 120.5 37 148.5 38 156.5 39 166.0 40 195.5 41 229.0 42 246.0 43 267.5 44 268.5 45 243.0 46 222.5 47 202.0 48 180.5 49 154.0 50 135.0 51 116.5 52 98.0 53 74.5 54 61.5 55 50.0 56 36.0 57 30.0 58 23.5 59 17.0 60 11.0 61 10.5 62 7.5 63 4.0 64 4.0 65 3.0 66 5.5 67 4.5 68 3.5 69 4.5 70 2.5 71 2.0 72 1.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 43.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.93455706304869 88.275 2 5.719606278265496 10.75 3 0.3458366586858207 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTGC 10 0.0013941582 244.40425 1 >>END_MODULE Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294943 spots for SRR5933785.sra Written 1294943 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra Read 1294925 spots for SRR5933785.sra Written 1294925 spots for SRR5933785.sra SRR ids: ['SRR5933785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6acqrzvr SRR5933785.sra spots: 25898518 blocks: [[1, 1294925], [1294926, 2589850], [2589851, 3884775], [3884776, 5179700], [5179701, 6474625], [6474626, 7769550], [7769551, 9064475], [9064476, 10359400], [10359401, 11654325], [11654326, 12949250], [12949251, 14244175], [14244176, 15539100], [15539101, 16834025], [16834026, 18128950], [18128951, 19423875], [19423876, 20718800], [20718801, 22013725], [22013726, 23308650], [23308651, 24603575], [24603576, 25898518]] SRR5933785 file size 8703874 SRR5933785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933785 SRR5933785_1.fastq SRR5933785_2.fastq Input file: SRR5933785_1.fastq Paired file: SRR5933785_2.fastq trimmed: SRR5933785-trimmed-pair1.fastq, SRR5933785-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:13:15 2025 >> started Mon Feb 10 19:13:43 2025 >> done (28.119s) 25898518 read pairs processed; of these: 372 ( 0.00%) short read pairs filtered out after trimming by size control 64 ( 0.00%) empty read pairs filtered out after trimming by size control 25898082 (100.00%) read pairs available; of these: 1987770 ( 7.68%) trimmed read pairs available after processing 23910312 (92.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 91 0.00% 20 106 0.00% 21 132 0.00% 22 193 0.00% 23 230 0.00% 24 254 0.00% 25 275 0.00% 26 307 0.00% 27 319 0.00% 28 339 0.00% 29 392 0.00% 30 372 0.00% 31 337 0.00% 32 460 0.00% 33 456 0.00% 34 461 0.00% 35 489 0.00% 36 466 0.00% 37 522 0.00% 38 508 0.00% 39 438 0.00% 40 459 0.00% 41 426 0.00% 42 457 0.00% 43 494 0.00% 44 494 0.00% 45 487 0.00% 46 440 0.00% 47 507 0.00% 48 478 0.00% 49 510 0.00% 50 466 0.00% 51 525 0.00% 52 580 0.00% 53 495 0.00% 54 508 0.00% 55 530 0.00% 56 498 0.00% 57 460 0.00% 58 530 0.00% 59 487 0.00% 60 516 0.00% 61 515 0.00% 62 490 0.00% 63 453 0.00% 64 521 0.00% 65 491 0.00% 66 543 0.00% 67 493 0.00% 68 565 0.00% 69 533 0.00% 70 516 0.00% 71 565 0.00% 72 630 0.00% 73 618 0.00% 74 635 0.00% 75 652 0.00% 76 691 0.00% 77 671 0.00% 78 765 0.00% 79 778 0.00% 80 881 0.00% 81 867 0.00% 82 979 0.00% 83 1051 0.00% 84 986 0.00% 85 1205 0.00% 86 1258 0.00% 87 1275 0.00% 88 1417 0.01% 89 1495 0.01% 90 1575 0.01% 91 1625 0.01% 92 1848 0.01% 93 2055 0.01% 94 2182 0.01% 95 2304 0.01% 96 2315 0.01% 97 2588 0.01% 98 2842 0.01% 99 2891 0.01% 100 3024 0.01% 101 3398 0.01% 102 3640 0.01% 103 3915 0.02% 104 4013 0.02% 105 4490 0.02% 106 4605 0.02% 107 4875 0.02% 108 5145 0.02% 109 5361 0.02% 110 5643 0.02% 111 5922 0.02% 112 6284 0.02% 113 6639 0.03% 114 6764 0.03% 115 7318 0.03% 116 7535 0.03% 117 7697 0.03% 118 8245 0.03% 119 8685 0.03% 120 9054 0.03% 121 9541 0.04% 122 9731 0.04% 123 10371 0.04% 124 10948 0.04% 125 11185 0.04% 126 11422 0.04% 127 12225 0.05% 128 12531 0.05% 129 13196 0.05% 130 13452 0.05% 131 13982 0.05% 132 14338 0.06% 133 15072 0.06% 134 15576 0.06% 135 16048 0.06% 136 16897 0.07% 137 17355 0.07% 138 18045 0.07% 139 18964 0.07% 140 19065 0.07% 141 19767 0.08% 142 20767 0.08% 143 21329 0.08% 144 21958 0.08% 145 24119 0.09% 146 28386 0.11% 147 44850 0.17% 148 137619 0.53% 149 1204459 4.65% 150 23910312 92.32% 25898082 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.5 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=606.02 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=33.0 sequence=TTCTTCTTCTTAGAAAATAATTTAGCATGGATTCGGACTTAAGAGGCGTTCAGCCTTTATCCAACAGATGGTAGCTTGACCGCATGGTGGCCTATCGACCAACGGTGGCACCAATTATCTGAATCAACCGTTCCTCTCGTACTGAGTCGAATTACTATTAGAAGAAGACTTTTTTTTTAGTCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGCGGGTGAACAATCCGAACCTTGCCGAATTCTGCTTCGAGCAGTGTAGGAAGAGCCGACATCGAAGAATCAAAAAGTGACGTCGCTCTGAACGCTTGGCCACCACAAGCCAGTTATCCCTATGGTAACTATTCTGACACCTCTATCGCCAAGTAGTGGCTTTTCTACACATTTTTTTTTAAAAGAAAATAAATAAAGGATCGATAGGCCATGCTTTCACAGTTTGTATTCCTACTTGAAAATCAACAAAATCAAATGTAGCTTTTACCCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=29 prefix-density=0.35 prefix-fanout=2.4 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=633.86 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=32.8 sequence=TTCTTCTTCTTAGAAAATAATTTAGCATGGATTCGGACTTAAGAGGCGTTCAGCCTTTATCCAACAGATGGTAGCTTGACCGCATGGTGGCCTATCGACCAACGGTGGCACCAATTATCTGAATCAACCGTTCCTCTCGTACTGAGTCGAATTACTATTAGAAGAAGACTTTTTTTTTAGTCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGCGGGTGAACAATCCGAACCTTGCCGAATTCTGCTTCGAGCAGTGTAGGAAGAGCCGACATCGAAGAATCAAAAAGTGACGTCGCTCTGAACGCTTGGCCACCACAAGCCAGTTATCCCTATGGTAACTATTCTGACACCTCTATCGCCAAGTAGTGGCTTTTCTACACATTTTTTTTTAAAAGAAAATAAATAA SRR5933785 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:14:58 Started mapping on | Feb 10 19:15:01 Finished on | Feb 10 19:25:30 Mapping speed, Million of reads per hour | 148.22 Number of input reads | 25898082 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19915697 Uniquely mapped reads % | 76.90% Average mapped length | 288.71 Number of splices: Total | 18210747 Number of splices: Annotated (sjdb) | 17689525 Number of splices: GT/AG | 17816354 Number of splices: GC/AG | 224694 Number of splices: AT/AC | 15209 Number of splices: Non-canonical | 154490 Mismatch rate per base, % | 2.10% Deletion rate per base | 0.14% Deletion average length | 3.18 Insertion rate per base | 0.09% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1169210 % of reads mapped to multiple loci | 4.51% Number of reads mapped to too many loci | 93918 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.29% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4813175 4813175 4813175 N_multimapping 1169210 1169210 1169210 N_noFeature 457716 10150119 10105214 N_ambiguous 293070 87235 88696 UnstrandedReadsAssigned:19164911 PositiveStrandReadsAssigned:9678343 NegativeStrandReadsAssigned:9721787 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933785 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933785-trimmed-pair1.fastq SRR5933785-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,898,082 reads, 19,540,592 reads pseudoaligned [quant] estimated average fragment length: 244.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR5933785.ke.tsv 34699 SRR5933785.se.tsv 87100 total ==> SRR5933785.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.42 1034 24.2904 Potri.005G024800.1.v4.1 1035 791.422 333 17.5391 Potri.004G059700.1.v4.1 961 717.428 72 4.18336 Potri.007G009000.2.v4.1 1416 1172.42 0 0 Potri.003G141000.2.v4.1 2943 2699.42 640.467 9.89001 Potri.016G087400.1.v4.1 270 55.9171 688 512.878 Potri.015G069301.1.v4.1 564 320.564 0 0 Potri.010G195200.1.v4.1 1773 1529.42 75 2.04411 Potri.012G127500.1.v4.1 977 733.428 2201 125.093 ==> SRR5933785.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 171 SRR5933785 completed mapping pipeline successfully