Starting /dee2/code/volunteer_pipeline.sh SRR5933786 current disk space = 3056415707136 free memory = 1580027896 SRR5933786 SRAfilesize 11f3244dd4f78a54cc6a3abeae271bea SRR5933786.sra SRR5933786.sra file validated SRR5933786 is paired end SRR5933786 is conventional basespace SRR5933786 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14125 32.0 32.0 32.0 32.0 32.0 2 29.105 32.0 32.0 32.0 12.0 32.0 3 34.65125 37.0 32.0 37.0 32.0 37.0 4 36.2925 37.0 37.0 37.0 37.0 37.0 5 35.79625 37.0 37.0 37.0 32.0 37.0 6 37.98375 41.0 37.0 41.0 32.0 41.0 7 34.649 37.0 32.0 41.0 12.0 41.0 8 38.05025 41.0 37.0 41.0 32.0 41.0 9 39.22375 41.0 37.0 41.0 37.0 41.0 10-14 38.459050000000005 41.0 39.4 41.0 34.0 41.0 15-19 37.10295 41.0 36.8 41.0 27.0 41.0 20-24 37.95355 41.0 37.8 41.0 30.0 41.0 25-29 36.2334 40.2 33.8 41.0 24.0 41.0 30-34 38.3175 41.0 38.6 41.0 33.0 41.0 35-39 34.829899999999995 38.4 30.0 41.0 22.0 41.0 40-44 31.968799999999998 35.0 25.0 40.2 14.0 41.0 45-49 28.0409 29.0 19.0 37.8 12.0 41.0 50-54 25.067899999999998 26.0 14.0 36.0 12.0 40.2 55-59 26.75555 28.0 19.0 36.6 14.0 39.4 60-64 27.47565 27.0 20.0 35.6 16.0 39.4 65-69 26.86975 29.0 16.0 36.8 12.0 41.0 70-74 24.97705 25.0 12.0 35.0 12.0 41.0 75-79 22.80885 22.0 14.0 31.0 12.0 36.8 80-84 25.52165 26.0 14.0 36.0 12.0 40.2 85-89 28.936899999999998 31.0 22.0 37.4 18.0 40.2 90-94 30.0 32.0 21.0 40.2 16.0 41.0 95-99 23.616750000000003 24.0 14.0 33.0 12.0 37.8 100-104 23.78825 22.0 16.0 34.0 12.0 38.6 105-109 21.89065 20.0 12.0 29.0 12.0 37.0 110-114 20.408549999999998 18.0 12.0 26.0 12.0 35.0 115-119 21.25675 20.0 12.0 30.0 12.0 37.0 120-124 17.391399999999997 12.0 12.0 24.0 8.8 30.0 125-129 16.256149999999998 12.0 12.0 22.0 8.0 28.0 130-134 15.32895 12.0 12.0 22.0 8.0 25.0 135-139 14.83415 12.0 12.0 18.0 8.0 22.0 140-144 14.44905 12.0 12.0 16.0 8.0 22.0 145-149 15.440300000000002 12.0 12.0 22.0 8.0 25.0 150 15.405 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 17 1.0 18 7.0 19 25.0 20 90.0 21 169.0 22 324.0 23 454.0 24 467.0 25 429.0 26 390.0 27 344.0 28 320.0 29 287.0 30 293.0 31 220.0 32 113.0 33 44.0 34 17.0 35 5.0 36 0.0 37 0.0 38 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.91466530403679 16.428206438426162 17.884517118037813 34.77261113949923 2 27.175 27.150000000000002 30.875000000000004 14.799999999999999 3 24.15 30.775000000000002 23.875 21.2 4 23.36168084042021 35.842921460730366 20.31015507753877 20.485242621310658 5 23.974999999999998 36.449999999999996 22.625 16.950000000000003 6 16.225 38.85 25.35 19.575 7 16.3 16.025 45.525 22.15 8 20.474999999999998 21.2 29.299999999999997 29.025000000000002 9 21.025 24.575 28.225 26.174999999999997 10-14 20.810000000000002 30.55 27.150000000000002 21.490000000000002 15-19 21.25 28.84 27.665 22.245 20-24 21.325 29.485 26.790000000000003 22.400000000000002 25-29 21.698018811286772 29.822893736241745 27.06623974384631 21.412847708625176 30-34 20.96 29.145 27.800000000000004 22.095000000000002 35-39 21.634999999999998 28.65 27.860000000000003 21.855 40-44 21.59 28.799999999999997 28.060000000000002 21.55 45-49 22.685 28.355000000000004 28.244999999999997 20.715 50-54 22.88 28.415000000000003 28.54 20.165 55-59 23.169999999999998 27.705000000000002 29.175 19.950000000000003 60-64 22.545 27.560000000000002 29.165000000000003 20.73 65-69 21.775 28.194999999999997 28.599999999999998 21.43 70-74 22.355 27.884999999999998 27.985 21.775 75-79 22.525000000000002 28.15 29.37 19.955000000000002 80-84 21.745 28.485 28.17 21.6 85-89 22.869999999999997 28.749999999999996 27.994999999999997 20.385 90-94 22.0 28.59 28.749999999999996 20.66 95-99 21.875 28.084999999999997 29.049999999999997 20.990000000000002 100-104 22.215 28.249999999999996 28.985 20.549999999999997 105-109 22.605 27.725 29.445 20.225 110-114 21.95 29.28 29.255 19.515 115-119 22.28 27.92 27.985 21.815 120-124 22.884999999999998 27.68 30.595 18.84 125-129 23.150000000000002 27.195000000000004 30.005 19.650000000000002 130-134 23.29 27.12 30.564999999999998 19.025 135-139 23.025000000000002 27.49 30.425 19.06 140-144 23.02 27.389999999999997 30.945 18.645 145-149 23.595 26.575 29.89 19.939999999999998 150 22.650000000000002 26.75 30.675 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.5 18 2.5 19 2.0 20 2.0 21 2.5 22 2.5 23 1.5 24 3.5 25 8.5 26 11.0 27 14.0 28 22.0 29 25.5 30 33.5 31 47.0 32 56.0 33 66.0 34 73.5 35 88.5 36 112.0 37 135.0 38 154.0 39 181.0 40 206.0 41 214.0 42 225.5 43 229.0 44 240.5 45 249.5 46 239.5 47 209.5 48 180.5 49 163.5 50 155.0 51 137.5 52 98.0 53 83.5 54 68.0 55 47.0 56 33.5 57 31.0 58 24.5 59 13.5 60 17.0 61 17.0 62 14.5 63 9.5 64 5.5 65 5.0 66 3.5 67 3.5 68 4.5 69 3.5 70 2.0 71 1.0 72 3.0 73 5.0 74 3.0 75 1.0 76 1.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.06 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06221315655279 96.15 2 1.8867924528301887 3.6999999999999997 3 0.05099439061703213 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.1 0.0 0.0 0.0 0.0 132-133 0.1 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.1 0.0 0.0 0.0 0.0 138 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAATCA 10 0.0069754543 143.9875 3 >>END_MODULE SRR5933786 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933786_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.10625 32.0 32.0 32.0 27.0 32.0 2 31.31625 32.0 32.0 32.0 32.0 32.0 3 34.73375 37.0 32.0 37.0 32.0 37.0 4 35.57625 37.0 37.0 37.0 32.0 37.0 5 34.83125 37.0 37.0 37.0 32.0 37.0 6 36.40175 41.0 37.0 41.0 27.0 41.0 7 33.9255 37.0 32.0 41.0 12.0 41.0 8 38.47875 41.0 37.0 41.0 32.0 41.0 9 38.606 41.0 37.0 41.0 32.0 41.0 10-14 38.5156 41.0 40.2 41.0 34.0 41.0 15-19 37.14095 40.2 35.0 41.0 27.0 41.0 20-24 37.9404 41.0 38.6 41.0 31.0 41.0 25-29 38.6178 41.0 38.6 41.0 32.0 41.0 30-34 38.669349999999994 41.0 40.2 41.0 33.0 41.0 35-39 38.999849999999995 41.0 41.0 41.0 35.0 41.0 40-44 38.6322 41.0 40.2 41.0 32.0 41.0 45-49 38.258399999999995 41.0 38.6 41.0 31.0 41.0 50-54 38.5168 41.0 39.4 41.0 32.0 41.0 55-59 37.8658 41.0 37.0 41.0 30.0 41.0 60-64 36.85865 41.0 37.0 41.0 26.0 41.0 65-69 36.9923 41.0 37.0 41.0 27.0 41.0 70-74 36.675650000000005 41.0 37.0 41.0 23.0 41.0 75-79 34.620400000000004 38.6 32.0 41.0 21.0 41.0 80-84 36.5558 41.0 36.0 41.0 25.0 41.0 85-89 35.182849999999995 39.4 33.0 41.0 20.0 41.0 90-94 33.4304 37.0 31.0 41.0 12.0 41.0 95-99 35.13275 39.4 32.0 41.0 20.0 41.0 100-104 31.756500000000006 34.8 25.0 40.2 16.0 41.0 105-109 29.533299999999997 33.0 20.0 38.6 14.0 41.0 110-114 29.6361 32.0 24.0 38.6 12.0 41.0 115-119 26.3825 28.0 16.0 37.8 12.0 41.0 120-124 27.46725 29.0 19.0 37.0 12.0 41.0 125-129 25.5462 26.0 14.0 36.0 12.0 40.2 130-134 25.62565 27.0 14.0 36.0 12.0 41.0 135-139 26.230349999999998 27.0 16.0 37.0 12.0 41.0 140-144 25.579449999999998 27.0 14.0 37.0 12.0 41.0 145-149 25.39565 27.0 12.0 36.0 12.0 41.0 150 25.20225 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 4.0 18 13.0 19 7.0 20 10.0 21 28.0 22 18.0 23 42.0 24 51.0 25 80.0 26 90.0 27 104.0 28 155.0 29 187.0 30 226.0 31 225.0 32 320.0 33 318.0 34 323.0 35 351.0 36 384.0 37 386.0 38 386.0 39 234.0 40 55.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.762198253723675 17.05187467899332 19.517205957883924 34.66872110939907 2 26.3 26.025 32.05 15.625 3 23.474999999999998 30.775000000000002 24.6 21.15 4 24.525 35.775 20.625 19.075 5 23.95 36.5 21.325 18.224999999999998 6 16.400000000000002 39.2 25.1 19.3 7 16.650000000000002 16.5 43.824999999999996 23.025000000000002 8 20.075000000000003 23.525 27.500000000000004 28.9 9 20.225 22.475 30.95 26.35 10-14 20.945 30.509999999999998 27.52 21.025 15-19 21.665 27.665 27.955000000000002 22.715 20-24 21.26 29.165000000000003 27.315 22.259999999999998 25-29 20.755000000000003 28.754999999999995 28.189999999999998 22.3 30-34 21.025 29.205 28.110000000000003 21.66 35-39 20.79 28.96 27.925 22.325 40-44 21.645 28.64 28.144999999999996 21.57 45-49 21.235 28.804999999999996 28.134999999999998 21.825 50-54 21.475 28.365000000000002 28.43 21.73 55-59 21.535 28.84 28.065 21.560000000000002 60-64 22.31 28.605000000000004 27.375 21.709999999999997 65-69 21.375 29.145 27.125 22.355 70-74 21.925 28.83 27.375 21.87 75-79 22.470000000000002 28.595 27.534999999999997 21.4 80-84 22.035 28.084999999999997 27.71 22.17 85-89 21.855 28.494999999999997 28.16 21.490000000000002 90-94 22.08 28.675 27.134999999999998 22.11 95-99 21.69 28.375 27.505000000000003 22.43 100-104 22.015 28.549999999999997 27.07 22.365 105-109 22.285 27.92 27.33 22.465 110-114 22.1 27.605 27.33 22.965 115-119 22.825 26.745 27.994999999999997 22.435 120-124 22.365 27.994999999999997 27.605 22.035 125-129 23.200000000000003 27.744999999999997 27.045 22.009999999999998 130-134 23.080000000000002 27.18 27.500000000000004 22.24 135-139 22.689999999999998 27.185 27.615000000000002 22.509999999999998 140-144 22.5 27.62 27.165 22.715 145-149 22.79 28.244999999999997 26.810000000000002 22.155 150 23.150000000000002 28.299999999999997 26.875 21.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 1.0 10 1.0 11 0.5 12 1.5 13 2.0 14 1.5 15 1.0 16 0.5 17 3.0 18 5.0 19 3.5 20 2.5 21 2.0 22 2.0 23 3.5 24 4.5 25 5.0 26 10.5 27 12.5 28 14.5 29 22.0 30 31.5 31 39.5 32 47.5 33 56.0 34 62.0 35 79.5 36 104.0 37 120.0 38 134.5 39 154.5 40 198.5 41 217.5 42 238.5 43 262.0 44 248.5 45 241.0 46 233.0 47 233.0 48 218.0 49 177.5 50 140.0 51 123.0 52 115.5 53 90.0 54 67.5 55 57.5 56 47.0 57 30.5 58 15.5 59 14.5 60 15.0 61 12.5 62 8.0 63 8.5 64 9.5 65 6.5 66 2.5 67 2.0 68 3.0 69 5.5 70 6.0 71 4.0 72 3.5 73 1.5 74 2.0 75 3.5 76 2.0 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52121529596647 91.175 2 4.190675746464118 8.0 3 0.2881089575694081 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.7875 0.0 0.0 0.0 0.0 136-137 0.8625 0.0 0.0 0.0 0.0 138 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra Read 1198661 spots for SRR5933786.sra Written 1198661 spots for SRR5933786.sra Read 1198642 spots for SRR5933786.sra Written 1198642 spots for SRR5933786.sra SRR ids: ['SRR5933786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fh7pwmac SRR5933786.sra spots: 23972859 blocks: [[1, 1198642], [1198643, 2397284], [2397285, 3595926], [3595927, 4794568], [4794569, 5993210], [5993211, 7191852], [7191853, 8390494], [8390495, 9589136], [9589137, 10787778], [10787779, 11986420], [11986421, 13185062], [13185063, 14383704], [14383705, 15582346], [15582347, 16780988], [16780989, 17979630], [17979631, 19178272], [19178273, 20376914], [20376915, 21575556], [21575557, 22774198], [22774199, 23972859]] SRR5933786 file size 8055092 SRR5933786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933786 SRR5933786_1.fastq SRR5933786_2.fastq Input file: SRR5933786_1.fastq Paired file: SRR5933786_2.fastq trimmed: SRR5933786-trimmed-pair1.fastq, SRR5933786-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:56:05 2025 >> started Mon Feb 10 19:56:31 2025 >> done (25.868s) 23972859 read pairs processed; of these: 271 ( 0.00%) short read pairs filtered out after trimming by size control 78 ( 0.00%) empty read pairs filtered out after trimming by size control 23972510 (100.00%) read pairs available; of these: 1497356 ( 6.25%) trimmed read pairs available after processing 22475154 (93.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 50 0.00% 19 51 0.00% 20 70 0.00% 21 75 0.00% 22 93 0.00% 23 131 0.00% 24 144 0.00% 25 166 0.00% 26 216 0.00% 27 210 0.00% 28 227 0.00% 29 209 0.00% 30 244 0.00% 31 259 0.00% 32 264 0.00% 33 292 0.00% 34 300 0.00% 35 276 0.00% 36 302 0.00% 37 279 0.00% 38 342 0.00% 39 327 0.00% 40 350 0.00% 41 344 0.00% 42 354 0.00% 43 313 0.00% 44 351 0.00% 45 346 0.00% 46 358 0.00% 47 387 0.00% 48 409 0.00% 49 431 0.00% 50 391 0.00% 51 408 0.00% 52 435 0.00% 53 451 0.00% 54 366 0.00% 55 422 0.00% 56 456 0.00% 57 437 0.00% 58 449 0.00% 59 430 0.00% 60 456 0.00% 61 438 0.00% 62 467 0.00% 63 442 0.00% 64 456 0.00% 65 421 0.00% 66 452 0.00% 67 458 0.00% 68 471 0.00% 69 500 0.00% 70 510 0.00% 71 541 0.00% 72 477 0.00% 73 489 0.00% 74 527 0.00% 75 516 0.00% 76 568 0.00% 77 615 0.00% 78 677 0.00% 79 668 0.00% 80 641 0.00% 81 685 0.00% 82 784 0.00% 83 793 0.00% 84 816 0.00% 85 939 0.00% 86 1053 0.00% 87 1002 0.00% 88 1073 0.00% 89 1114 0.00% 90 1170 0.00% 91 1279 0.01% 92 1385 0.01% 93 1482 0.01% 94 1569 0.01% 95 1675 0.01% 96 1795 0.01% 97 1788 0.01% 98 2018 0.01% 99 2012 0.01% 100 2177 0.01% 101 2420 0.01% 102 2486 0.01% 103 2677 0.01% 104 2813 0.01% 105 2875 0.01% 106 3155 0.01% 107 3126 0.01% 108 3194 0.01% 109 3612 0.02% 110 3773 0.02% 111 3865 0.02% 112 4213 0.02% 113 4362 0.02% 114 4587 0.02% 115 4907 0.02% 116 5083 0.02% 117 5264 0.02% 118 5575 0.02% 119 5654 0.02% 120 6022 0.03% 121 6442 0.03% 122 6636 0.03% 123 6917 0.03% 124 7245 0.03% 125 7759 0.03% 126 8089 0.03% 127 8460 0.04% 128 8782 0.04% 129 9133 0.04% 130 9416 0.04% 131 9838 0.04% 132 10450 0.04% 133 10685 0.04% 134 11378 0.05% 135 11665 0.05% 136 12191 0.05% 137 12875 0.05% 138 13122 0.05% 139 13869 0.06% 140 14538 0.06% 141 15068 0.06% 142 15770 0.07% 143 16303 0.07% 144 17276 0.07% 145 18837 0.08% 146 21910 0.09% 147 33506 0.14% 148 100131 0.42% 149 929588 3.88% 150 22475154 93.75% 23972510 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.78 fanout-score-rank=21 prefix-density=0.16 prefix-fanout=3.4 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=91.11 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.4 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=34 prefix-density=0.12 prefix-fanout=2.3 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=96.63 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=16.5 sequence=GCTGCTGCTGCT SRR5933786 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:58:02 Started mapping on | Feb 10 19:58:06 Finished on | Feb 10 20:06:01 Mapping speed, Million of reads per hour | 181.69 Number of input reads | 23972510 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18438800 Uniquely mapped reads % | 76.92% Average mapped length | 280.54 Number of splices: Total | 13605199 Number of splices: Annotated (sjdb) | 12746866 Number of splices: GT/AG | 13219203 Number of splices: GC/AG | 175241 Number of splices: AT/AC | 9883 Number of splices: Non-canonical | 200872 Mismatch rate per base, % | 2.23% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1541271 % of reads mapped to multiple loci | 6.43% Number of reads mapped to too many loci | 44088 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.63% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3992441 3992441 3992441 N_multimapping 1541271 1541271 1541271 N_noFeature 549120 9461528 9428848 N_ambiguous 421059 162924 163656 UnstrandedReadsAssigned:17468621 PositiveStrandReadsAssigned:8814348 NegativeStrandReadsAssigned:8846296 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933786 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933786-trimmed-pair1.fastq SRR5933786-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,972,510 reads, 18,151,416 reads pseudoaligned [quant] estimated average fragment length: 239.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR5933786.ke.tsv 34699 SRR5933786.se.tsv 87100 total ==> SRR5933786.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.91 4989.42 131.636 Potri.005G024800.1.v4.1 1035 796.915 1744 102.768 Potri.004G059700.1.v4.1 961 722.92 37 2.40345 Potri.007G009000.2.v4.1 1416 1177.91 0 0 Potri.003G141000.2.v4.1 2943 2704.91 389.503 6.7621 Potri.016G087400.1.v4.1 270 57.8591 310 251.602 Potri.015G069301.1.v4.1 564 326.172 0 0 Potri.010G195200.1.v4.1 1773 1534.91 158 4.83389 Potri.012G127500.1.v4.1 977 738.92 2643 167.967 ==> SRR5933786.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 159 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2567 SRR5933786 completed mapping pipeline successfully