Starting /dee2/code/volunteer_pipeline.sh SRR5933787 current disk space = 3056973324288 free memory = 1235429828 SRR5933787 SRAfilesize c522625f90bf3f25693764ee5512ac3f SRR5933787.sra SRR5933787.sra file validated SRR5933787 is paired end SRR5933787 is conventional basespace SRR5933787 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.25375 32.0 2.0 32.0 2.0 32.0 2 27.58625 32.0 27.0 32.0 12.0 32.0 3 33.09125 32.0 32.0 37.0 32.0 37.0 4 35.84875 37.0 37.0 37.0 32.0 37.0 5 35.80875 37.0 37.0 37.0 32.0 37.0 6 39.21275 41.0 41.0 41.0 37.0 41.0 7 39.6265 41.0 41.0 41.0 37.0 41.0 8 39.79125 41.0 41.0 41.0 37.0 41.0 9 39.997 41.0 41.0 41.0 37.0 41.0 10-14 39.90835 41.0 41.0 41.0 37.0 41.0 15-19 39.89735 41.0 41.0 41.0 37.0 41.0 20-24 39.755700000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.377599999999994 41.0 41.0 41.0 36.0 41.0 30-34 39.602850000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.266 41.0 41.0 41.0 36.0 41.0 40-44 39.4267 41.0 41.0 41.0 36.0 41.0 45-49 39.4142 41.0 41.0 41.0 37.0 41.0 50-54 39.08445 41.0 41.0 41.0 35.0 41.0 55-59 38.76655 41.0 39.4 41.0 34.0 41.0 60-64 39.1676 41.0 41.0 41.0 35.0 41.0 65-69 39.12925 41.0 41.0 41.0 36.0 41.0 70-74 39.15925 41.0 41.0 41.0 37.0 41.0 75-79 38.82625 41.0 39.4 41.0 34.0 41.0 80-84 38.83669999999999 41.0 40.2 41.0 35.0 41.0 85-89 38.523849999999996 41.0 38.6 41.0 34.0 41.0 90-94 38.78605 41.0 40.2 41.0 33.0 41.0 95-99 38.91995000000001 41.0 41.0 41.0 35.0 41.0 100-104 38.53065 41.0 39.4 41.0 31.0 41.0 105-109 38.662349999999996 41.0 40.2 41.0 33.0 41.0 110-114 38.32935 41.0 37.8 41.0 32.0 41.0 115-119 37.3522 41.0 36.0 41.0 29.0 41.0 120-124 36.6275 40.2 36.0 41.0 26.0 41.0 125-129 34.520799999999994 38.6 32.0 41.0 18.0 41.0 130-134 34.83135 39.4 34.0 41.0 18.0 41.0 135-139 33.717499999999994 38.6 29.0 41.0 16.0 41.0 140-144 33.84625 38.4 30.0 41.0 19.0 41.0 145-149 29.314099999999996 32.0 21.0 38.4 12.0 41.0 150 29.087 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 3.0 23 4.0 24 6.0 25 10.0 26 20.0 27 24.0 28 31.0 29 45.0 30 68.0 31 74.0 32 75.0 33 111.0 34 154.0 35 227.0 36 282.0 37 431.0 38 640.0 39 1025.0 40 768.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.37528604118993 18.03203661327231 20.137299771167047 33.45537757437071 2 25.900000000000002 25.874999999999996 33.675 14.549999999999999 3 22.25 31.125000000000004 25.6 21.025 4 24.075 35.225 21.6 19.1 5 23.9 36.425000000000004 22.8 16.875 6 16.75 39.300000000000004 23.575 20.375 7 15.075 16.75 46.1 22.075 8 20.200000000000003 22.375 28.749999999999996 28.675 9 21.375 23.474999999999998 29.349999999999998 25.8 10-14 21.32 30.325000000000003 27.205000000000002 21.15 15-19 22.040000000000003 27.82 28.225 21.915000000000003 20-24 21.535 29.220000000000002 27.355 21.89 25-29 21.95 28.375 27.555000000000003 22.12 30-34 21.3 29.459999999999997 27.279999999999998 21.959999999999997 35-39 21.905 28.62 27.345000000000002 22.13 40-44 22.05 29.160000000000004 26.51 22.28 45-49 21.525 28.33 28.13 22.015 50-54 21.185000000000002 29.165000000000003 27.555000000000003 22.095000000000002 55-59 21.93 28.625 27.700000000000003 21.745 60-64 22.325 28.244999999999997 27.865000000000002 21.565 65-69 22.259999999999998 28.54 27.555000000000003 21.645 70-74 21.845 28.549999999999997 27.51 22.095000000000002 75-79 21.695 28.78 27.355 22.17 80-84 22.33 28.095 27.794999999999998 21.78 85-89 22.15 28.57 27.994999999999997 21.285 90-94 22.015 28.585 27.744999999999997 21.654999999999998 95-99 21.605 28.235 27.93 22.23 100-104 21.785 29.095 26.6 22.52 105-109 22.36 27.865000000000002 27.915 21.86 110-114 22.145 28.134999999999998 27.865000000000002 21.855 115-119 21.705 27.525 28.325 22.445 120-124 22.305 27.675 27.794999999999998 22.225 125-129 22.08 27.96 27.615000000000002 22.345000000000002 130-134 21.865000000000002 28.17 28.044999999999998 21.92 135-139 22.06 28.194999999999997 27.935 21.81 140-144 21.97 28.194999999999997 28.294999999999998 21.54 145-149 22.259999999999998 28.18 28.660000000000004 20.9 150 23.400000000000002 28.15 27.800000000000004 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 3.0 24 4.0 25 7.0 26 7.5 27 9.0 28 12.5 29 18.5 30 27.0 31 37.0 32 49.5 33 60.5 34 70.0 35 84.5 36 96.5 37 121.5 38 160.5 39 181.5 40 197.5 41 225.0 42 245.5 43 256.0 44 262.5 45 252.0 46 246.5 47 233.0 48 200.0 49 170.5 50 148.5 51 124.0 52 98.0 53 89.0 54 72.0 55 48.5 56 34.5 57 24.0 58 23.0 59 21.5 60 18.0 61 13.0 62 7.5 63 9.0 64 8.5 65 4.5 66 3.0 67 3.5 68 3.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 45.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58974358974359 87.6 2 6.036324786324786 11.3 3 0.3205128205128205 0.8999999999999999 4 0.05341880341880342 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.38749999999999996 0.0 0.0 0.0 0.0 122-123 0.48750000000000004 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGAT 25 8.6446395E-5 153.13333 1 TTGGATG 20 3.7327886E-4 107.671875 2 >>END_MODULE SRR5933787 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933787_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.5975 32.0 2.0 32.0 2.0 32.0 2 30.6825 32.0 32.0 32.0 27.0 32.0 3 33.0575 32.0 32.0 37.0 32.0 37.0 4 34.39875 37.0 32.0 37.0 32.0 37.0 5 35.16125 37.0 37.0 37.0 32.0 37.0 6 37.43275 41.0 37.0 41.0 32.0 41.0 7 35.54925 41.0 32.0 41.0 22.0 41.0 8 38.99575 41.0 37.0 41.0 37.0 41.0 9 39.091 41.0 41.0 41.0 37.0 41.0 10-14 38.94905 41.0 40.2 41.0 36.0 41.0 15-19 38.89215 41.0 40.2 41.0 34.0 41.0 20-24 38.44625 41.0 39.4 41.0 32.0 41.0 25-29 38.035199999999996 41.0 37.8 41.0 32.0 41.0 30-34 38.04215000000001 41.0 38.6 41.0 29.0 41.0 35-39 38.132099999999994 41.0 37.8 41.0 31.0 41.0 40-44 38.9893 41.0 40.2 41.0 35.0 41.0 45-49 39.11665 41.0 41.0 41.0 37.0 41.0 50-54 38.66925 41.0 41.0 41.0 32.0 41.0 55-59 38.0558 41.0 37.8 41.0 31.0 41.0 60-64 37.525800000000004 41.0 37.0 41.0 30.0 41.0 65-69 35.9981 41.0 35.0 41.0 22.0 41.0 70-74 36.318400000000004 41.0 36.0 41.0 25.0 41.0 75-79 36.4465 40.2 35.0 41.0 26.0 41.0 80-84 35.99445 41.0 35.0 41.0 24.0 41.0 85-89 35.4919 40.2 34.0 41.0 23.0 41.0 90-94 34.08015 37.0 30.0 41.0 18.0 41.0 95-99 34.36385 37.0 31.0 41.0 18.0 41.0 100-104 34.976 37.0 33.0 41.0 20.0 41.0 105-109 33.442750000000004 37.0 31.0 41.0 12.0 41.0 110-114 33.28099999999999 37.0 30.0 41.0 12.0 41.0 115-119 30.8682 35.0 25.0 41.0 12.0 41.0 120-124 29.184749999999998 32.0 22.0 37.8 12.0 41.0 125-129 29.327350000000003 31.0 20.0 40.2 12.0 41.0 130-134 26.737399999999997 28.0 18.0 37.0 12.0 41.0 135-139 23.6681 25.0 12.0 33.0 12.0 38.6 140-144 20.86925 17.0 12.0 29.0 9.6 37.0 145-149 21.23535 18.0 12.0 29.0 10.4 36.0 150 17.873 12.0 12.0 22.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 4.0 18 3.0 19 21.0 20 13.0 21 17.0 22 25.0 23 36.0 24 61.0 25 56.0 26 73.0 27 98.0 28 120.0 29 166.0 30 188.0 31 213.0 32 245.0 33 311.0 34 354.0 35 419.0 36 433.0 37 478.0 38 425.0 39 196.0 40 42.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.8926528816542 16.80598328200616 19.92960844698636 35.371755389353275 2 23.95 26.85 33.775 15.425 3 22.975 28.175 26.35 22.5 4 24.125 34.55 20.7 20.625 5 22.05 38.3 22.775000000000002 16.875 6 17.1 38.3 24.65 19.950000000000003 7 15.9 16.5 45.925 21.675 8 18.95 22.05 28.499999999999996 30.5 9 20.625 23.549999999999997 30.775000000000002 25.05 10-14 20.855 30.84 26.619999999999997 21.685 15-19 21.45 28.470000000000002 27.955000000000002 22.125 20-24 21.545 28.99 27.515 21.95 25-29 21.335 29.215000000000003 27.495000000000005 21.955 30-34 21.355 29.595 27.744999999999997 21.305 35-39 21.555 28.845 27.91 21.69 40-44 21.634999999999998 28.59 28.13 21.645 45-49 21.625 28.494999999999997 28.455000000000002 21.425 50-54 21.67 28.835 27.92 21.575 55-59 21.815 28.994999999999997 27.345000000000002 21.845 60-64 21.57 29.294999999999998 28.03 21.105 65-69 20.955 29.304999999999996 28.08 21.66 70-74 21.61 29.04 27.97 21.38 75-79 21.310000000000002 28.78 27.700000000000003 22.21 80-84 21.595 29.080000000000002 27.485 21.84 85-89 22.08 28.64 27.35 21.93 90-94 22.275 28.79 27.435 21.5 95-99 22.05 28.499999999999996 27.584999999999997 21.865000000000002 100-104 21.715 28.884999999999998 27.189999999999998 22.21 105-109 21.85 28.945 27.084999999999997 22.12 110-114 21.490000000000002 28.935 27.534999999999997 22.040000000000003 115-119 22.02 28.865000000000002 27.565 21.55 120-124 21.645 28.389999999999997 28.49 21.475 125-129 22.259999999999998 28.655 27.83 21.255 130-134 22.215 28.82 27.415 21.55 135-139 22.75 29.38 27.24 20.630000000000003 140-144 23.965 28.715000000000003 27.57 19.75 145-149 22.939999999999998 28.395 28.499999999999996 20.165 150 24.224999999999998 27.650000000000002 32.300000000000004 15.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 1.5 18 0.5 19 1.0 20 1.0 21 2.0 22 3.5 23 4.5 24 4.0 25 3.5 26 6.5 27 16.5 28 20.0 29 18.5 30 26.0 31 41.5 32 50.0 33 59.5 34 68.5 35 88.0 36 115.0 37 143.0 38 178.5 39 201.5 40 223.5 41 232.0 42 243.5 43 240.0 44 243.0 45 240.5 46 223.5 47 233.5 48 207.5 49 159.5 50 128.0 51 111.5 52 101.5 53 73.5 54 48.0 55 48.0 56 44.0 57 29.0 58 19.5 59 15.5 60 12.0 61 16.0 62 13.0 63 8.5 64 9.0 65 3.5 66 2.5 67 2.0 68 2.0 69 2.0 70 0.5 71 1.5 72 1.5 73 0.5 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content fail #Base N-Count 1 43.175000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68816067653277 89.575 2 4.941860465116279 9.35 3 0.34355179704016914 0.975 4 0.026427061310782242 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra Read 1205703 spots for SRR5933787.sra Written 1205703 spots for SRR5933787.sra SRR ids: ['SRR5933787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_876uqw0t SRR5933787.sra spots: 24114060 blocks: [[1, 1205703], [1205704, 2411406], [2411407, 3617109], [3617110, 4822812], [4822813, 6028515], [6028516, 7234218], [7234219, 8439921], [8439922, 9645624], [9645625, 10851327], [10851328, 12057030], [12057031, 13262733], [13262734, 14468436], [14468437, 15674139], [15674140, 16879842], [16879843, 18085545], [18085546, 19291248], [19291249, 20496951], [20496952, 21702654], [21702655, 22908357], [22908358, 24114060]] SRR5933787 file size 8102665 SRR5933787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933787 SRR5933787_1.fastq SRR5933787_2.fastq Input file: SRR5933787_1.fastq Paired file: SRR5933787_2.fastq trimmed: SRR5933787-trimmed-pair1.fastq, SRR5933787-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:15:21 2025 >> started Mon Feb 10 19:15:47 2025 >> done (25.845s) 24114060 read pairs processed; of these: 253 ( 0.00%) short read pairs filtered out after trimming by size control 86 ( 0.00%) empty read pairs filtered out after trimming by size control 24113721 (100.00%) read pairs available; of these: 1753923 ( 7.27%) trimmed read pairs available after processing 22359798 (92.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 56 0.00% 20 83 0.00% 21 96 0.00% 22 127 0.00% 23 186 0.00% 24 200 0.00% 25 233 0.00% 26 253 0.00% 27 253 0.00% 28 306 0.00% 29 272 0.00% 30 305 0.00% 31 329 0.00% 32 316 0.00% 33 350 0.00% 34 343 0.00% 35 376 0.00% 36 394 0.00% 37 396 0.00% 38 411 0.00% 39 408 0.00% 40 413 0.00% 41 408 0.00% 42 419 0.00% 43 398 0.00% 44 381 0.00% 45 403 0.00% 46 443 0.00% 47 484 0.00% 48 459 0.00% 49 442 0.00% 50 456 0.00% 51 475 0.00% 52 458 0.00% 53 483 0.00% 54 451 0.00% 55 449 0.00% 56 492 0.00% 57 447 0.00% 58 462 0.00% 59 412 0.00% 60 464 0.00% 61 522 0.00% 62 442 0.00% 63 457 0.00% 64 479 0.00% 65 462 0.00% 66 495 0.00% 67 464 0.00% 68 496 0.00% 69 442 0.00% 70 479 0.00% 71 490 0.00% 72 490 0.00% 73 477 0.00% 74 499 0.00% 75 514 0.00% 76 513 0.00% 77 542 0.00% 78 593 0.00% 79 612 0.00% 80 598 0.00% 81 639 0.00% 82 629 0.00% 83 661 0.00% 84 734 0.00% 85 761 0.00% 86 737 0.00% 87 799 0.00% 88 825 0.00% 89 878 0.00% 90 945 0.00% 91 975 0.00% 92 1052 0.00% 93 1116 0.00% 94 1182 0.00% 95 1232 0.01% 96 1212 0.01% 97 1508 0.01% 98 1430 0.01% 99 1579 0.01% 100 1608 0.01% 101 1777 0.01% 102 1910 0.01% 103 2045 0.01% 104 2100 0.01% 105 2236 0.01% 106 2367 0.01% 107 2436 0.01% 108 2631 0.01% 109 2792 0.01% 110 2936 0.01% 111 3123 0.01% 112 3175 0.01% 113 3308 0.01% 114 3509 0.01% 115 3769 0.02% 116 3844 0.02% 117 4091 0.02% 118 4328 0.02% 119 4563 0.02% 120 4764 0.02% 121 4903 0.02% 122 5228 0.02% 123 5489 0.02% 124 5813 0.02% 125 5985 0.02% 126 6092 0.03% 127 6582 0.03% 128 6625 0.03% 129 7102 0.03% 130 7454 0.03% 131 7612 0.03% 132 8041 0.03% 133 8452 0.04% 134 8607 0.04% 135 9225 0.04% 136 9540 0.04% 137 9933 0.04% 138 10467 0.04% 139 10906 0.05% 140 11037 0.05% 141 11627 0.05% 142 12326 0.05% 143 12626 0.05% 144 13440 0.06% 145 14974 0.06% 146 19183 0.08% 147 37081 0.15% 148 136922 0.57% 149 1233339 5.11% 150 22359798 92.73% 24113721 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=29 prefix-density=0.62 prefix-fanout=2.4 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=239.26 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=25.5 sequence=TCTTCTTCATTATCCTTTCATTCTTAACACTTCAAGCTGAATCGGTAGTAAAAGAGGGATGTGAAGAAGAAACAAGCTCTTGCAATGACAAAGCTAAAGCTTTAACCCTAAAGATAATAGCCATAGTCTCTATCTTGGTTACTAGCATGATAGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=33 prefix-density=0.58 prefix-fanout=2.4 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=221.53 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=23.9 sequence=TCTTCTTCATTATCCTTTCATTCTTAACACTTCAAGCTGAATCGGTAGTAAAAGAGGGATGTGAAGAAGAAACAAGCTCTTGCAATGACAAAGCTAAAGCTTTAACCCTAAAGATAATAGCCATAGTCTCTATCTTGGTTACTAGCATGATAGG SRR5933787 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:17:12 Started mapping on | Feb 10 19:17:13 Finished on | Feb 10 19:24:00 Mapping speed, Million of reads per hour | 213.29 Number of input reads | 24113721 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19388350 Uniquely mapped reads % | 80.40% Average mapped length | 281.46 Number of splices: Total | 17563147 Number of splices: Annotated (sjdb) | 17076483 Number of splices: GT/AG | 17189111 Number of splices: GC/AG | 214710 Number of splices: AT/AC | 13848 Number of splices: Non-canonical | 145478 Mismatch rate per base, % | 2.15% Deletion rate per base | 0.13% Deletion average length | 3.16 Insertion rate per base | 0.09% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1128292 % of reads mapped to multiple loci | 4.68% Number of reads mapped to too many loci | 8558 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.67% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3597081 3597081 3597081 N_multimapping 1128292 1128292 1128292 N_noFeature 421229 9867488 9831143 N_ambiguous 299404 94231 95270 UnstrandedReadsAssigned:18667717 PositiveStrandReadsAssigned:9426631 NegativeStrandReadsAssigned:9461937 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933787 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933787-trimmed-pair1.fastq SRR5933787-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,113,721 reads, 18,889,562 reads pseudoaligned [quant] estimated average fragment length: 246.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR5933787.ke.tsv 34699 SRR5933787.se.tsv 87100 total ==> SRR5933787.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.13 940 20.4635 Potri.005G024800.1.v4.1 1035 789.132 333 16.2796 Potri.004G059700.1.v4.1 961 715.143 53 2.85912 Potri.007G009000.2.v4.1 1416 1170.13 0 0 Potri.003G141000.2.v4.1 2943 2697.13 552.55 7.90348 Potri.016G087400.1.v4.1 270 54.5204 753.343 533.067 Potri.015G069301.1.v4.1 564 318.266 0 0 Potri.010G195200.1.v4.1 1773 1527.13 64 1.61678 Potri.012G127500.1.v4.1 977 731.143 2036 107.43 ==> SRR5933787.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 142 SRR5933787 completed mapping pipeline successfully