Starting /dee2/code/volunteer_pipeline.sh SRR5933788 current disk space = 3057030828032 free memory = 1076667824 SRR5933788 SRAfilesize ae5a0edc7a9cb8b82e048e160c60e174 SRR5933788.sra SRR5933788.sra file validated SRR5933788 is paired end SRR5933788 is conventional basespace SRR5933788 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933788_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.78625 32.0 2.0 32.0 2.0 32.0 2 27.7575 32.0 27.0 32.0 12.0 32.0 3 33.32125 32.0 32.0 37.0 32.0 37.0 4 35.97125 37.0 37.0 37.0 32.0 37.0 5 35.8425 37.0 37.0 37.0 32.0 37.0 6 39.18325 41.0 41.0 41.0 37.0 41.0 7 39.50575 41.0 41.0 41.0 37.0 41.0 8 39.84625 41.0 41.0 41.0 37.0 41.0 9 39.971 41.0 41.0 41.0 37.0 41.0 10-14 39.915499999999994 41.0 41.0 41.0 37.0 41.0 15-19 39.91700000000001 41.0 41.0 41.0 37.0 41.0 20-24 39.7758 41.0 41.0 41.0 37.0 41.0 25-29 39.4119 41.0 40.2 41.0 36.0 41.0 30-34 39.6779 41.0 41.0 41.0 37.0 41.0 35-39 39.30069999999999 41.0 41.0 41.0 37.0 41.0 40-44 39.40725 41.0 41.0 41.0 36.0 41.0 45-49 39.352850000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.0339 41.0 40.2 41.0 35.0 41.0 55-59 38.7698 41.0 39.4 41.0 35.0 41.0 60-64 39.181099999999994 41.0 41.0 41.0 36.0 41.0 65-69 39.15645 41.0 41.0 41.0 36.0 41.0 70-74 39.11075 41.0 41.0 41.0 37.0 41.0 75-79 38.83965 41.0 39.4 41.0 34.0 41.0 80-84 38.753249999999994 41.0 40.2 41.0 33.0 41.0 85-89 38.41405 41.0 38.6 41.0 31.0 41.0 90-94 38.7859 41.0 40.2 41.0 33.0 41.0 95-99 38.95804999999999 41.0 40.2 41.0 35.0 41.0 100-104 38.5055 41.0 39.4 41.0 33.0 41.0 105-109 38.7196 41.0 39.4 41.0 33.0 41.0 110-114 38.38805 41.0 37.0 41.0 32.0 41.0 115-119 37.349349999999994 41.0 36.0 41.0 29.0 41.0 120-124 36.5817 40.2 36.0 41.0 26.0 41.0 125-129 34.544799999999995 38.6 32.0 41.0 18.0 41.0 130-134 34.86925 39.4 34.0 41.0 18.0 41.0 135-139 33.474199999999996 38.6 29.0 41.0 16.0 41.0 140-144 33.901349999999994 39.4 30.0 41.0 18.0 41.0 145-149 29.253300000000003 31.0 21.0 38.4 12.0 40.2 150 28.91375 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 2.0 24 5.0 25 9.0 26 19.0 27 10.0 28 35.0 29 48.0 30 52.0 31 66.0 32 95.0 33 149.0 34 155.0 35 228.0 36 283.0 37 422.0 38 615.0 39 1090.0 40 713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.51758793969849 16.582914572864322 19.639865996649917 35.25963149078727 2 24.925 25.825 35.075 14.174999999999999 3 22.675 28.775000000000002 26.724999999999998 21.825 4 22.725 36.175000000000004 21.5 19.6 5 22.8 37.025000000000006 22.45 17.724999999999998 6 16.225 39.050000000000004 24.85 19.875 7 15.5 16.125 44.824999999999996 23.549999999999997 8 18.3 22.55 28.525 30.625000000000004 9 20.525 24.224999999999998 28.95 26.3 10-14 20.705000000000002 30.490000000000002 26.935 21.87 15-19 21.22 29.054999999999996 27.61 22.115000000000002 20-24 20.505000000000003 29.435 28.345 21.715 25-29 21.33 29.580000000000002 27.48 21.61 30-34 21.77 29.175 27.47 21.584999999999997 35-39 21.545 28.985 27.495000000000005 21.975 40-44 21.015 29.15 27.584999999999997 22.25 45-49 20.65 29.154999999999998 28.125 22.07 50-54 21.525 28.720000000000002 27.72 22.035 55-59 21.025 28.799999999999997 28.46 21.715 60-64 22.065 28.599999999999998 27.67 21.665 65-69 20.715 29.244999999999997 27.66 22.38 70-74 21.415 29.04 27.38 22.165000000000003 75-79 21.255 28.194999999999997 28.884999999999998 21.665 80-84 21.985 27.915 28.405 21.695 85-89 21.91 28.17 28.02 21.9 90-94 21.560000000000002 28.749999999999996 27.544999999999998 22.145 95-99 21.6 28.4 27.985 22.015 100-104 21.11 29.325000000000003 27.560000000000002 22.005 105-109 21.375 29.035 27.915 21.675 110-114 21.240000000000002 28.485 27.834999999999997 22.439999999999998 115-119 21.385 28.975 28.105000000000004 21.535 120-124 21.555 28.51 27.735 22.2 125-129 21.525 28.28 28.134999999999998 22.06 130-134 21.37 28.345 28.389999999999997 21.895 135-139 21.845 28.005000000000003 28.83 21.32 140-144 21.905 28.249999999999996 28.83 21.015 145-149 21.654999999999998 28.625 29.23 20.49 150 20.65 29.375 28.875 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.5 24 2.0 25 6.0 26 13.0 27 16.0 28 20.5 29 28.0 30 28.0 31 30.0 32 41.5 33 54.0 34 72.0 35 91.0 36 115.5 37 138.5 38 151.5 39 196.5 40 224.5 41 223.0 42 237.5 43 262.0 44 268.0 45 260.0 46 247.0 47 213.5 48 182.5 49 164.0 50 152.5 51 125.0 52 92.5 53 75.5 54 63.5 55 48.5 56 39.0 57 26.5 58 13.5 59 12.0 60 12.5 61 8.0 62 6.0 63 5.0 64 5.0 65 5.0 66 3.5 67 3.0 68 2.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 40.300000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.375 #Duplication Level Percentage of deduplicated Percentage of total 1 92.28687415426252 85.25 2 7.2801082543978355 13.450000000000001 3 0.35182679296346414 0.975 4 0.05412719891745603 0.2 5 0.027063599458728015 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTAAAATGGGCGAATTCATGTCTGACTGGAATGGGGAATTTTCAGCAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.65 0.0 0.0 0.0 0.0 136-137 0.65 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933788 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933788_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.03875 32.0 2.0 32.0 2.0 32.0 2 30.7325 32.0 32.0 32.0 32.0 32.0 3 33.20625 32.0 32.0 37.0 32.0 37.0 4 34.63875 37.0 32.0 37.0 32.0 37.0 5 35.26125 37.0 37.0 37.0 32.0 37.0 6 37.8385 41.0 37.0 41.0 32.0 41.0 7 36.11325 41.0 37.0 41.0 22.0 41.0 8 39.0485 41.0 37.0 41.0 37.0 41.0 9 39.18425 41.0 41.0 41.0 37.0 41.0 10-14 39.106700000000004 41.0 41.0 41.0 36.0 41.0 15-19 38.9388 41.0 41.0 41.0 35.0 41.0 20-24 38.54775 41.0 39.4 41.0 33.0 41.0 25-29 38.314499999999995 41.0 38.6 41.0 32.0 41.0 30-34 38.25505 41.0 37.8 41.0 32.0 41.0 35-39 38.273649999999996 41.0 37.8 41.0 31.0 41.0 40-44 39.1124 41.0 40.2 41.0 35.0 41.0 45-49 39.28875000000001 41.0 41.0 41.0 37.0 41.0 50-54 38.856500000000004 41.0 41.0 41.0 34.0 41.0 55-59 38.36475 41.0 38.6 41.0 31.0 41.0 60-64 37.794650000000004 41.0 37.0 41.0 30.0 41.0 65-69 36.31525 41.0 37.0 41.0 24.0 41.0 70-74 36.7318 41.0 36.0 41.0 25.0 41.0 75-79 36.6545 40.2 35.0 41.0 26.0 41.0 80-84 36.2251 41.0 35.0 41.0 24.0 41.0 85-89 35.90005 41.0 35.0 41.0 24.0 41.0 90-94 34.4392 38.6 30.0 41.0 18.0 41.0 95-99 34.82165 37.8 32.0 41.0 21.0 41.0 100-104 35.29915000000001 38.6 34.0 41.0 22.0 41.0 105-109 33.767700000000005 37.0 31.0 41.0 14.0 41.0 110-114 33.8264 37.0 30.0 41.0 16.0 41.0 115-119 31.6132 35.0 26.0 41.0 12.0 41.0 120-124 29.634949999999996 32.0 22.0 38.6 12.0 41.0 125-129 29.67505 32.0 21.0 40.2 12.0 41.0 130-134 27.3864 28.0 18.0 37.0 12.0 41.0 135-139 24.1738 25.0 12.0 35.0 12.0 39.4 140-144 21.2476 17.0 12.0 29.0 11.2 37.8 145-149 21.6213 18.0 12.0 30.0 12.0 36.0 150 17.96575 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 4.0 19 6.0 20 6.0 21 15.0 22 21.0 23 42.0 24 33.0 25 50.0 26 69.0 27 95.0 28 118.0 29 142.0 30 162.0 31 223.0 32 264.0 33 301.0 34 361.0 35 408.0 36 466.0 37 491.0 38 472.0 39 214.0 40 34.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.418935392117024 16.659894351889477 19.097927671678182 34.82324258431532 2 25.025 26.700000000000003 33.650000000000006 14.625 3 22.575 29.799999999999997 26.174999999999997 21.45 4 24.224999999999998 34.525 21.25 20.0 5 23.474999999999998 37.05 22.35 17.125 6 16.85 39.875 24.15 19.125 7 15.425 17.45 45.1 22.025 8 20.349999999999998 22.15 29.049999999999997 28.449999999999996 9 21.95 22.75 29.7 25.6 10-14 20.745 30.470000000000002 27.54 21.245 15-19 21.060000000000002 28.105000000000004 28.360000000000003 22.475 20-24 21.099999999999998 29.205 28.310000000000002 21.385 25-29 21.19 28.93 28.015 21.865000000000002 30-34 20.9 28.88 28.605000000000004 21.615000000000002 35-39 21.099999999999998 29.175 28.28 21.445 40-44 21.45 29.345 27.525 21.68 45-49 21.13 29.099999999999998 27.88 21.89 50-54 21.349999999999998 29.044999999999998 28.244999999999997 21.36 55-59 21.915000000000003 28.765 28.165000000000003 21.154999999999998 60-64 21.745 28.87 27.810000000000002 21.575 65-69 21.265 29.265 28.044999999999998 21.425 70-74 21.645 29.275000000000002 28.000000000000004 21.08 75-79 21.73 28.405 28.07 21.795 80-84 21.6 28.605000000000004 28.13 21.665 85-89 21.895 28.42 28.23 21.455 90-94 22.17 28.665000000000003 28.199999999999996 20.965 95-99 21.72 28.355000000000004 28.555000000000003 21.37 100-104 21.865000000000002 28.389999999999997 28.000000000000004 21.745 105-109 21.735 28.835 28.155 21.275 110-114 22.564999999999998 27.779999999999998 28.345 21.310000000000002 115-119 21.535 28.439999999999998 28.48 21.545 120-124 21.39 29.035 28.32 21.255 125-129 22.27 28.625 28.23 20.875 130-134 22.75 28.449999999999996 27.83 20.97 135-139 23.044999999999998 27.884999999999998 28.23 20.84 140-144 23.41 28.565 29.21 18.815 145-149 22.689999999999998 28.225 29.294999999999998 19.79 150 24.9 28.95 31.05 15.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 2.0 22 0.5 23 1.0 24 3.0 25 5.5 26 9.0 27 16.5 28 25.0 29 25.0 30 31.0 31 42.0 32 43.0 33 61.0 34 86.0 35 98.0 36 119.5 37 131.5 38 145.5 39 186.5 40 224.0 41 238.5 42 248.5 43 267.5 44 271.5 45 244.0 46 229.5 47 222.5 48 200.5 49 169.5 50 124.5 51 107.5 52 92.0 53 73.5 54 60.5 55 45.5 56 36.0 57 22.5 58 14.0 59 11.0 60 11.0 61 8.5 62 8.5 63 8.0 64 4.0 65 3.5 66 3.0 67 2.0 68 1.5 69 1.0 70 1.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 38.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.02387979608264 86.675 2 6.680976656828548 12.45 3 0.26831231553528306 0.75 4 0.0 0.0 5 0.026831231553528307 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGATAGAAATGGGATAGTTACTTCTTCTAAAACCAGCAAGGGACATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138 0.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGTG 10 0.0070318864 143.6 4 GGTGTTT 10 0.0070318864 143.6 7 >>END_MODULE Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153445 spots for SRR5933788.sra Written 1153445 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra Read 1153439 spots for SRR5933788.sra Written 1153439 spots for SRR5933788.sra SRR ids: ['SRR5933788.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d1oviqiy SRR5933788.sra spots: 23068786 blocks: [[1, 1153439], [1153440, 2306878], [2306879, 3460317], [3460318, 4613756], [4613757, 5767195], [5767196, 6920634], [6920635, 8074073], [8074074, 9227512], [9227513, 10380951], [10380952, 11534390], [11534391, 12687829], [12687830, 13841268], [13841269, 14994707], [14994708, 16148146], [16148147, 17301585], [17301586, 18455024], [18455025, 19608463], [19608464, 20761902], [20761903, 21915341], [21915342, 23068786]] SRR5933788 file size 7750498 SRR5933788 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933788 SRR5933788_1.fastq SRR5933788_2.fastq Input file: SRR5933788_1.fastq Paired file: SRR5933788_2.fastq trimmed: SRR5933788-trimmed-pair1.fastq, SRR5933788-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:11:49 2025 >> started Mon Feb 10 19:12:22 2025 >> done (32.630s) 23068786 read pairs processed; of these: 303 ( 0.00%) short read pairs filtered out after trimming by size control 58 ( 0.00%) empty read pairs filtered out after trimming by size control 23068425 (100.00%) read pairs available; of these: 1528621 ( 6.63%) trimmed read pairs available after processing 21539804 (93.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 61 0.00% 20 92 0.00% 21 130 0.00% 22 131 0.00% 23 179 0.00% 24 216 0.00% 25 224 0.00% 26 269 0.00% 27 256 0.00% 28 341 0.00% 29 304 0.00% 30 329 0.00% 31 350 0.00% 32 362 0.00% 33 366 0.00% 34 360 0.00% 35 381 0.00% 36 422 0.00% 37 434 0.00% 38 443 0.00% 39 376 0.00% 40 445 0.00% 41 407 0.00% 42 426 0.00% 43 442 0.00% 44 504 0.00% 45 476 0.00% 46 523 0.00% 47 500 0.00% 48 460 0.00% 49 505 0.00% 50 455 0.00% 51 502 0.00% 52 510 0.00% 53 482 0.00% 54 505 0.00% 55 476 0.00% 56 517 0.00% 57 475 0.00% 58 486 0.00% 59 510 0.00% 60 468 0.00% 61 509 0.00% 62 467 0.00% 63 504 0.00% 64 453 0.00% 65 462 0.00% 66 493 0.00% 67 506 0.00% 68 498 0.00% 69 446 0.00% 70 501 0.00% 71 497 0.00% 72 451 0.00% 73 491 0.00% 74 464 0.00% 75 543 0.00% 76 465 0.00% 77 620 0.00% 78 593 0.00% 79 630 0.00% 80 605 0.00% 81 617 0.00% 82 660 0.00% 83 668 0.00% 84 659 0.00% 85 701 0.00% 86 723 0.00% 87 750 0.00% 88 775 0.00% 89 797 0.00% 90 859 0.00% 91 856 0.00% 92 911 0.00% 93 982 0.00% 94 1062 0.00% 95 1111 0.00% 96 1118 0.00% 97 1264 0.01% 98 1239 0.01% 99 1304 0.01% 100 1402 0.01% 101 1574 0.01% 102 1560 0.01% 103 1567 0.01% 104 1806 0.01% 105 1788 0.01% 106 1930 0.01% 107 2037 0.01% 108 2176 0.01% 109 2245 0.01% 110 2364 0.01% 111 2494 0.01% 112 2619 0.01% 113 2711 0.01% 114 2748 0.01% 115 2949 0.01% 116 3066 0.01% 117 3351 0.01% 118 3396 0.01% 119 3572 0.02% 120 3855 0.02% 121 4004 0.02% 122 4203 0.02% 123 4196 0.02% 124 4564 0.02% 125 4801 0.02% 126 5013 0.02% 127 5156 0.02% 128 5526 0.02% 129 5695 0.02% 130 5840 0.03% 131 6103 0.03% 132 6412 0.03% 133 6807 0.03% 134 6978 0.03% 135 7305 0.03% 136 7647 0.03% 137 8003 0.03% 138 8344 0.04% 139 8929 0.04% 140 9009 0.04% 141 9311 0.04% 142 9991 0.04% 143 10546 0.05% 144 10852 0.05% 145 12249 0.05% 146 15781 0.07% 147 30758 0.13% 148 116819 0.51% 149 1093155 4.74% 150 21539804 93.37% 23068425 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=27 prefix-density=0.14 prefix-fanout=3.4 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=347.48 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=30.4 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=27 prefix-density=0.12 prefix-fanout=3.1 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=394.68 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=33.3 sequence=TTCTTCTTCTTT SRR5933788 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 19:27:42 Started mapping on | Feb 10 19:27:42 Finished on | Feb 10 19:33:54 Mapping speed, Million of reads per hour | 223.19 Number of input reads | 23063158 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 18395056 Uniquely mapped reads % | 79.76% Average mapped length | 269.70 Number of splices: Total | 12895797 Number of splices: Annotated (sjdb) | 12290705 Number of splices: GT/AG | 12574312 Number of splices: GC/AG | 160652 Number of splices: AT/AC | 9406 Number of splices: Non-canonical | 151427 Mismatch rate per base, % | 2.26% Deletion rate per base | 0.14% Deletion average length | 3.19 Insertion rate per base | 0.09% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1330654 % of reads mapped to multiple loci | 5.77% Number of reads mapped to too many loci | 11064 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.23% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3337967 3337967 3337967 N_multimapping 1330654 1330654 1330654 N_noFeature 528606 9435354 9390294 N_ambiguous 354447 127791 130440 UnstrandedReadsAssigned:17512003 PositiveStrandReadsAssigned:8831911 NegativeStrandReadsAssigned:8874322 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR5933788 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933788-trimmed-pair1.fastq SRR5933788-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,063,158 reads, 18,075,046 reads pseudoaligned [quant] estimated average fragment length: 236.849 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR5933788.ke.tsv 34699 SRR5933788.se.tsv 87100 total ==> SRR5933788.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.15 6670.44 201.09 Potri.005G024800.1.v4.1 1035 799.151 2079 139.767 Potri.004G059700.1.v4.1 961 725.151 50 3.70443 Potri.007G009000.2.v4.1 1416 1180.15 2 0.0910485 Potri.003G141000.2.v4.1 2943 2707.15 508.593 10.0934 Potri.016G087400.1.v4.1 270 59.3004 466 422.191 Potri.015G069301.1.v4.1 564 328.306 0 0 Potri.010G195200.1.v4.1 1773 1537.15 263.808 9.22044 Potri.012G127500.1.v4.1 977 741.151 6063 439.502 ==> SRR5933788.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 115 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 848 SRR5933788 completed mapping pipeline successfully