Starting /dee2/code/volunteer_pipeline.sh SRR5933789 current disk space = 3056248918016 free memory = 1517019264 SRR5933789 SRAfilesize 6bd991b735d7d2ab291c45410132c118 SRR5933789.sra SRR5933789.sra file validated SRR5933789 is paired end SRR5933789 is conventional basespace SRR5933789 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.615 32.0 2.0 32.0 2.0 32.0 2 27.865 32.0 27.0 32.0 12.0 32.0 3 33.0475 32.0 32.0 37.0 32.0 37.0 4 35.81625 37.0 37.0 37.0 32.0 37.0 5 35.74375 37.0 37.0 37.0 32.0 37.0 6 39.3465 41.0 41.0 41.0 37.0 41.0 7 39.55975 41.0 41.0 41.0 37.0 41.0 8 39.84225 41.0 41.0 41.0 37.0 41.0 9 39.99675 41.0 41.0 41.0 37.0 41.0 10-14 39.9541 41.0 41.0 41.0 37.0 41.0 15-19 39.99245 41.0 41.0 41.0 37.0 41.0 20-24 39.857150000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.46595 41.0 40.2 41.0 36.0 41.0 30-34 39.6919 41.0 41.0 41.0 37.0 41.0 35-39 39.37905 41.0 41.0 41.0 37.0 41.0 40-44 39.537699999999994 41.0 41.0 41.0 37.0 41.0 45-49 39.4928 41.0 41.0 41.0 37.0 41.0 50-54 39.25935 41.0 41.0 41.0 37.0 41.0 55-59 38.7772 41.0 40.2 41.0 34.0 41.0 60-64 39.3558 41.0 41.0 41.0 37.0 41.0 65-69 39.19625 41.0 41.0 41.0 37.0 41.0 70-74 39.29965 41.0 41.0 41.0 37.0 41.0 75-79 39.007 41.0 39.4 41.0 34.0 41.0 80-84 38.875150000000005 41.0 40.2 41.0 34.0 41.0 85-89 38.59165 41.0 38.6 41.0 34.0 41.0 90-94 38.8189 41.0 40.2 41.0 33.0 41.0 95-99 38.910849999999996 41.0 41.0 41.0 34.0 41.0 100-104 38.48085 41.0 38.6 41.0 32.0 41.0 105-109 38.785199999999996 41.0 40.2 41.0 33.0 41.0 110-114 38.4948 41.0 37.8 41.0 33.0 41.0 115-119 37.409499999999994 41.0 36.0 41.0 29.0 41.0 120-124 36.6778 40.2 36.0 41.0 28.0 41.0 125-129 34.683949999999996 39.4 32.0 41.0 18.0 41.0 130-134 35.03105000000001 39.4 34.0 41.0 18.0 41.0 135-139 33.582100000000004 38.6 29.0 41.0 16.0 41.0 140-144 33.97595 39.4 31.0 41.0 19.0 41.0 145-149 29.230349999999998 32.0 21.0 38.4 12.0 40.2 150 29.253 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 3.0 22 2.0 23 6.0 24 3.0 25 11.0 26 15.0 27 22.0 28 35.0 29 40.0 30 46.0 31 61.0 32 91.0 33 105.0 34 159.0 35 208.0 36 321.0 37 437.0 38 602.0 39 1050.0 40 782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.298279158699806 17.447418738049713 18.594646271510516 35.65965583173996 2 24.325 26.375 35.85 13.450000000000001 3 22.125 29.2 27.55 21.125 4 23.974999999999998 34.300000000000004 22.325 19.400000000000002 5 22.35 39.0 22.625 16.025 6 18.0 38.025 25.15 18.825 7 15.15 17.05 45.1 22.7 8 19.325 22.725 28.799999999999997 29.15 9 21.325 23.325000000000003 29.099999999999998 26.25 10-14 20.830000000000002 30.64 27.02 21.51 15-19 21.21 27.634999999999998 29.020000000000003 22.134999999999998 20-24 21.315 29.13 28.07 21.485000000000003 25-29 21.615000000000002 29.705 27.215 21.465 30-34 21.285 29.439999999999998 27.825 21.45 35-39 21.5 29.43 27.765 21.305 40-44 21.240000000000002 29.01 27.985 21.765 45-49 21.825 28.849999999999998 27.79 21.535 50-54 21.785 29.035 27.455000000000002 21.725 55-59 21.805 28.804999999999996 27.54 21.85 60-64 21.21 28.975 27.82 21.995 65-69 21.709999999999997 28.82 27.76 21.709999999999997 70-74 21.92 29.015 27.79 21.275 75-79 21.375 29.565 28.125 20.935000000000002 80-84 21.715 28.84 27.41 22.035 85-89 21.94 28.410000000000004 27.445000000000004 22.205 90-94 21.445 28.835 28.225 21.495 95-99 21.63 28.965000000000003 27.415 21.990000000000002 100-104 21.815 28.945 27.755000000000003 21.485000000000003 105-109 21.565 28.07 28.78 21.584999999999997 110-114 21.825 28.58 28.07 21.525 115-119 22.189999999999998 28.92 27.61 21.279999999999998 120-124 21.404999999999998 28.994999999999997 27.6 22.0 125-129 21.48 28.375 27.925 22.220000000000002 130-134 22.009999999999998 28.815 27.96 21.215 135-139 21.54 28.845 28.335 21.279999999999998 140-144 21.78 28.77 28.27 21.18 145-149 21.745 28.425 29.28 20.549999999999997 150 21.325 27.975 28.449999999999996 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 2.0 15 1.5 16 0.5 17 0.5 18 2.0 19 3.5 20 2.5 21 1.0 22 1.5 23 4.5 24 5.0 25 6.0 26 13.5 27 21.0 28 23.0 29 23.5 30 29.5 31 35.5 32 50.0 33 60.5 34 68.5 35 89.0 36 104.5 37 137.5 38 160.0 39 190.5 40 215.0 41 215.0 42 243.0 43 272.5 44 279.5 45 253.5 46 220.5 47 200.0 48 187.0 49 164.5 50 141.0 51 125.0 52 97.5 53 71.0 54 61.0 55 49.0 56 37.0 57 30.0 58 18.0 59 13.0 60 13.5 61 11.5 62 9.0 63 8.0 64 4.5 65 3.0 66 4.0 67 2.5 68 1.5 69 1.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 47.699999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.83405172413794 86.15 2 6.573275862068965 12.2 3 0.5926724137931034 1.6500000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1625 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.575 0.0 0.0 0.0 0.0 134-135 0.5874999999999999 0.0 0.0 0.0 0.0 136-137 0.6625000000000001 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCAC 10 0.0070392117 143.55 6 AAAAAAA 35 0.003748742 20.507143 85-89 >>END_MODULE SRR5933789 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933789_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.98875 32.0 2.0 32.0 2.0 32.0 2 30.615 32.0 32.0 32.0 27.0 32.0 3 32.9675 32.0 32.0 37.0 32.0 37.0 4 34.5725 37.0 32.0 37.0 32.0 37.0 5 34.98375 37.0 37.0 37.0 32.0 37.0 6 37.38875 41.0 37.0 41.0 32.0 41.0 7 35.9385 41.0 37.0 41.0 22.0 41.0 8 38.95675 41.0 37.0 41.0 37.0 41.0 9 39.102 41.0 41.0 41.0 37.0 41.0 10-14 39.08145 41.0 41.0 41.0 35.0 41.0 15-19 38.81795 41.0 39.4 41.0 34.0 41.0 20-24 38.38135 41.0 38.6 41.0 32.0 41.0 25-29 38.0646 41.0 37.8 41.0 31.0 41.0 30-34 38.08149999999999 41.0 37.8 41.0 30.0 41.0 35-39 38.02085 41.0 37.8 41.0 30.0 41.0 40-44 38.883449999999996 41.0 39.4 41.0 35.0 41.0 45-49 39.12575 41.0 41.0 41.0 37.0 41.0 50-54 38.7019 41.0 41.0 41.0 32.0 41.0 55-59 38.164249999999996 41.0 37.8 41.0 31.0 41.0 60-64 37.73055 41.0 37.0 41.0 30.0 41.0 65-69 35.97475 41.0 35.0 41.0 22.0 41.0 70-74 36.43315 41.0 36.0 41.0 26.0 41.0 75-79 36.38635 40.2 35.0 41.0 26.0 41.0 80-84 36.0214 41.0 35.0 41.0 24.0 41.0 85-89 35.51635 41.0 34.0 41.0 22.0 41.0 90-94 34.054050000000004 37.0 30.0 41.0 18.0 41.0 95-99 34.564750000000004 37.0 31.0 41.0 20.0 41.0 100-104 35.0235 37.8 33.0 41.0 20.0 41.0 105-109 33.37499999999999 37.0 31.0 41.0 12.0 41.0 110-114 33.3232 37.0 30.0 41.0 14.0 41.0 115-119 31.00335 35.0 25.0 41.0 12.0 41.0 120-124 29.044900000000002 32.0 22.0 38.6 12.0 41.0 125-129 29.150350000000003 31.0 20.0 39.4 12.0 41.0 130-134 26.808700000000005 28.0 18.0 37.0 12.0 41.0 135-139 23.433100000000003 24.0 12.0 33.0 12.0 39.4 140-144 20.890800000000002 17.0 12.0 29.0 11.2 37.8 145-149 21.22795 20.0 12.0 29.0 11.2 36.0 150 17.838 12.0 12.0 22.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 1.0 17 5.0 18 9.0 19 8.0 20 11.0 21 20.0 22 26.0 23 41.0 24 48.0 25 48.0 26 70.0 27 119.0 28 137.0 29 137.0 30 163.0 31 247.0 32 275.0 33 298.0 34 380.0 35 392.0 36 428.0 37 463.0 38 418.0 39 214.0 40 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.608200455580867 15.307517084282459 20.0 37.08428246013668 2 24.05 26.474999999999998 33.95 15.525 3 23.375 29.775000000000002 25.95 20.9 4 23.200000000000003 35.775 21.525 19.5 5 23.075000000000003 38.4 22.175 16.35 6 16.325 40.150000000000006 23.925 19.6 7 16.150000000000002 16.150000000000002 45.375 22.325 8 18.95 22.5 28.549999999999997 30.0 9 21.4 23.474999999999998 28.4 26.724999999999998 10-14 20.26 30.615 27.439999999999998 21.685 15-19 21.025 28.685 27.615000000000002 22.675 20-24 21.445 29.580000000000002 27.625 21.349999999999998 25-29 21.11 29.494999999999997 27.615000000000002 21.78 30-34 21.07 30.18 27.384999999999998 21.365000000000002 35-39 20.79 29.195 27.98 22.035 40-44 20.23 29.849999999999998 27.644999999999996 22.275 45-49 20.7 29.575000000000003 28.26 21.465 50-54 21.025 28.945 27.779999999999998 22.25 55-59 21.48 29.544999999999998 27.534999999999997 21.44 60-64 21.525 28.955 28.515 21.005 65-69 21.7 29.470000000000002 27.73 21.099999999999998 70-74 21.27 29.37 27.944999999999997 21.415 75-79 21.634999999999998 29.005 28.185 21.175 80-84 21.17 29.099999999999998 28.1 21.63 85-89 21.715 29.595 27.485 21.205 90-94 21.22 29.09 28.349999999999998 21.34 95-99 21.94 29.160000000000004 27.944999999999997 20.955 100-104 21.634999999999998 28.194999999999997 28.04 22.13 105-109 21.3 28.355000000000004 28.310000000000002 22.035 110-114 21.52 28.76 28.155 21.565 115-119 21.945 28.7 27.810000000000002 21.545 120-124 21.975 28.345 27.97 21.709999999999997 125-129 21.790000000000003 29.2 27.939999999999998 21.07 130-134 22.095000000000002 28.4 28.139999999999997 21.365000000000002 135-139 22.38 28.32 27.810000000000002 21.490000000000002 140-144 23.04 28.410000000000004 28.98 19.57 145-149 22.564999999999998 28.050000000000004 28.895 20.49 150 24.325 28.075 32.0 15.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 1.5 17 2.5 18 1.0 19 4.0 20 5.5 21 3.0 22 5.0 23 6.0 24 8.0 25 14.5 26 17.5 27 22.0 28 24.0 29 28.0 30 37.5 31 43.5 32 58.5 33 71.5 34 74.5 35 86.5 36 105.5 37 135.0 38 167.5 39 185.0 40 200.0 41 228.0 42 259.0 43 264.5 44 251.0 45 245.5 46 230.5 47 202.5 48 172.0 49 146.5 50 140.5 51 120.5 52 87.0 53 77.0 54 62.0 55 42.5 56 37.0 57 28.0 58 22.5 59 18.0 60 12.0 61 10.0 62 7.5 63 5.5 64 6.0 65 4.0 66 3.0 67 2.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 45.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.59316604378003 87.64999999999999 2 6.03310197544047 11.3 3 0.37373198077949815 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.0875 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.9125000000000001 0.0 0.0 0.0 0.0 136-137 0.975 0.0 0.0 0.0 0.0 138 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTAC 10 0.0070373793 143.5625 5 GAACCTA 10 0.0070373793 143.5625 4 GGGAACC 10 0.0070373793 143.5625 2 ACCTACC 10 0.0070373793 143.5625 6 GGAACCT 10 0.0070373793 143.5625 3 >>END_MODULE Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304801 spots for SRR5933789.sra Written 1304801 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra Read 1304787 spots for SRR5933789.sra Written 1304787 spots for SRR5933789.sra SRR ids: ['SRR5933789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tlqrt82c SRR5933789.sra spots: 26095754 blocks: [[1, 1304787], [1304788, 2609574], [2609575, 3914361], [3914362, 5219148], [5219149, 6523935], [6523936, 7828722], [7828723, 9133509], [9133510, 10438296], [10438297, 11743083], [11743084, 13047870], [13047871, 14352657], [14352658, 15657444], [15657445, 16962231], [16962232, 18267018], [18267019, 19571805], [19571806, 20876592], [20876593, 22181379], [22181380, 23486166], [23486167, 24790953], [24790954, 26095754]] SRR5933789 file size 8770326 SRR5933789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933789 SRR5933789_1.fastq SRR5933789_2.fastq Input file: SRR5933789_1.fastq Paired file: SRR5933789_2.fastq trimmed: SRR5933789-trimmed-pair1.fastq, SRR5933789-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:09:21 2025 >> started Mon Feb 10 20:09:56 2025 >> done (35.321s) 26095754 read pairs processed; of these: 258 ( 0.00%) short read pairs filtered out after trimming by size control 77 ( 0.00%) empty read pairs filtered out after trimming by size control 26095419 (100.00%) read pairs available; of these: 1776926 ( 6.81%) trimmed read pairs available after processing 24318493 (93.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 66 0.00% 20 101 0.00% 21 109 0.00% 22 154 0.00% 23 217 0.00% 24 265 0.00% 25 263 0.00% 26 242 0.00% 27 271 0.00% 28 320 0.00% 29 333 0.00% 30 373 0.00% 31 401 0.00% 32 355 0.00% 33 366 0.00% 34 404 0.00% 35 425 0.00% 36 433 0.00% 37 448 0.00% 38 499 0.00% 39 430 0.00% 40 482 0.00% 41 462 0.00% 42 458 0.00% 43 461 0.00% 44 490 0.00% 45 482 0.00% 46 503 0.00% 47 503 0.00% 48 538 0.00% 49 550 0.00% 50 566 0.00% 51 522 0.00% 52 620 0.00% 53 573 0.00% 54 541 0.00% 55 546 0.00% 56 614 0.00% 57 527 0.00% 58 536 0.00% 59 546 0.00% 60 566 0.00% 61 540 0.00% 62 524 0.00% 63 520 0.00% 64 503 0.00% 65 598 0.00% 66 546 0.00% 67 504 0.00% 68 541 0.00% 69 517 0.00% 70 504 0.00% 71 518 0.00% 72 564 0.00% 73 568 0.00% 74 572 0.00% 75 559 0.00% 76 585 0.00% 77 646 0.00% 78 572 0.00% 79 742 0.00% 80 682 0.00% 81 614 0.00% 82 700 0.00% 83 755 0.00% 84 765 0.00% 85 762 0.00% 86 816 0.00% 87 817 0.00% 88 853 0.00% 89 886 0.00% 90 935 0.00% 91 975 0.00% 92 966 0.00% 93 1027 0.00% 94 1159 0.00% 95 1193 0.00% 96 1284 0.00% 97 1223 0.00% 98 1298 0.00% 99 1333 0.01% 100 1470 0.01% 101 1512 0.01% 102 1624 0.01% 103 1692 0.01% 104 1868 0.01% 105 1896 0.01% 106 1935 0.01% 107 2048 0.01% 108 2082 0.01% 109 2194 0.01% 110 2218 0.01% 111 2325 0.01% 112 2473 0.01% 113 2679 0.01% 114 2722 0.01% 115 2759 0.01% 116 2950 0.01% 117 3123 0.01% 118 3218 0.01% 119 3384 0.01% 120 3682 0.01% 121 3601 0.01% 122 3731 0.01% 123 3826 0.01% 124 4266 0.02% 125 4463 0.02% 126 4557 0.02% 127 4668 0.02% 128 4768 0.02% 129 5030 0.02% 130 5477 0.02% 131 5647 0.02% 132 5929 0.02% 133 6122 0.02% 134 6355 0.02% 135 6599 0.03% 136 6893 0.03% 137 7143 0.03% 138 7513 0.03% 139 7714 0.03% 140 7935 0.03% 141 8578 0.03% 142 8847 0.03% 143 9286 0.04% 144 9856 0.04% 145 11444 0.04% 146 15607 0.06% 147 35209 0.13% 148 143146 0.55% 149 1325582 5.08% 150 24318493 93.19% 26095419 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.38 fanout-score-rank=23 prefix-density=0.14 prefix-fanout=3.3 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=373.42 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=31.6 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=31 prefix-density=0.11 prefix-fanout=2.4 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=363.89 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=31.6 sequence=TTCTTCTTCTTC SRR5933789 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:11:44 Started mapping on | Feb 10 20:11:47 Finished on | Feb 10 20:20:51 Mapping speed, Million of reads per hour | 172.69 Number of input reads | 26095419 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20339236 Uniquely mapped reads % | 77.94% Average mapped length | 280.38 Number of splices: Total | 15066325 Number of splices: Annotated (sjdb) | 14364341 Number of splices: GT/AG | 14693344 Number of splices: GC/AG | 185708 Number of splices: AT/AC | 11039 Number of splices: Non-canonical | 176234 Mismatch rate per base, % | 2.26% Deletion rate per base | 0.14% Deletion average length | 3.23 Insertion rate per base | 0.09% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1497269 % of reads mapped to multiple loci | 5.74% Number of reads mapped to too many loci | 10221 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.93% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4258916 4258916 4258916 N_multimapping 1497269 1497269 1497269 N_noFeature 533807 10402529 10357535 N_ambiguous 392316 139967 142055 UnstrandedReadsAssigned:19413113 PositiveStrandReadsAssigned:9796740 NegativeStrandReadsAssigned:9839646 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5933789 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933789-trimmed-pair1.fastq SRR5933789-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,095,419 reads, 20,115,606 reads pseudoaligned [quant] estimated average fragment length: 253.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR5933789.ke.tsv 34699 SRR5933789.se.tsv 87100 total ==> SRR5933789.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.62 6106.35 154.065 Potri.005G024800.1.v4.1 1035 782.625 1302 74.1103 Potri.004G059700.1.v4.1 961 708.635 24 1.50872 Potri.007G009000.2.v4.1 1416 1163.62 0 0 Potri.003G141000.2.v4.1 2943 2690.62 634.576 10.5063 Potri.016G087400.1.v4.1 270 51.3311 414 359.286 Potri.015G069301.1.v4.1 564 311.8 0 0 Potri.010G195200.1.v4.1 1773 1520.62 258 7.55821 Potri.012G127500.1.v4.1 977 724.63 5759 354.04 ==> SRR5933789.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 718 SRR5933789 completed mapping pipeline successfully