Starting /dee2/code/volunteer_pipeline.sh SRR5933790 current disk space = 3056286842880 free memory = 1533048208 SRR5933790 SRAfilesize 3ea7a46c9ba84c940ca3f760a5f65128 SRR5933790.sra SRR5933790.sra file validated SRR5933790 is paired end SRR5933790 is conventional basespace SRR5933790 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.50875 2.0 2.0 32.0 2.0 32.0 2 27.96125 32.0 27.0 32.0 12.0 32.0 3 32.92375 32.0 32.0 37.0 32.0 37.0 4 35.85375 37.0 37.0 37.0 32.0 37.0 5 35.83 37.0 37.0 37.0 32.0 37.0 6 39.44975 41.0 41.0 41.0 37.0 41.0 7 39.548 41.0 41.0 41.0 37.0 41.0 8 39.87725 41.0 41.0 41.0 37.0 41.0 9 39.94525 41.0 41.0 41.0 37.0 41.0 10-14 39.949 41.0 41.0 41.0 37.0 41.0 15-19 39.92495 41.0 41.0 41.0 37.0 41.0 20-24 39.8185 41.0 41.0 41.0 37.0 41.0 25-29 39.43715000000001 41.0 41.0 41.0 36.0 41.0 30-34 39.7255 41.0 41.0 41.0 37.0 41.0 35-39 39.31885 41.0 41.0 41.0 37.0 41.0 40-44 39.463499999999996 41.0 41.0 41.0 36.0 41.0 45-49 39.4813 41.0 41.0 41.0 37.0 41.0 50-54 39.166199999999996 41.0 41.0 41.0 36.0 41.0 55-59 38.78745 41.0 40.2 41.0 35.0 41.0 60-64 39.32655 41.0 41.0 41.0 36.0 41.0 65-69 39.20665 41.0 41.0 41.0 36.0 41.0 70-74 39.31145 41.0 41.0 41.0 37.0 41.0 75-79 38.87305 41.0 39.4 41.0 34.0 41.0 80-84 38.84665 41.0 40.2 41.0 35.0 41.0 85-89 38.60015 41.0 38.6 41.0 34.0 41.0 90-94 38.840599999999995 41.0 40.2 41.0 33.0 41.0 95-99 38.9931 41.0 41.0 41.0 35.0 41.0 100-104 38.5937 41.0 38.6 41.0 34.0 41.0 105-109 38.82495 41.0 40.2 41.0 33.0 41.0 110-114 38.53529999999999 41.0 39.4 41.0 32.0 41.0 115-119 37.4154 41.0 36.0 41.0 29.0 41.0 120-124 36.628750000000004 40.2 36.0 41.0 26.0 41.0 125-129 34.61245 38.6 32.0 41.0 18.0 41.0 130-134 34.92385 39.4 34.0 41.0 18.0 41.0 135-139 33.7423 38.6 29.0 41.0 16.0 41.0 140-144 34.0889 39.4 30.0 41.0 19.0 41.0 145-149 29.359949999999998 32.0 21.0 38.4 12.0 40.2 150 29.1635 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 3.0 23 4.0 24 6.0 25 6.0 26 18.0 27 17.0 28 23.0 29 40.0 30 53.0 31 60.0 32 88.0 33 136.0 34 160.0 35 242.0 36 279.0 37 397.0 38 628.0 39 1082.0 40 755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.832476875642346 16.546762589928058 19.835560123329905 32.785200411099694 2 25.974999999999998 27.0 33.675 13.350000000000001 3 22.7 30.925000000000004 25.5 20.875 4 23.275000000000002 36.0 21.349999999999998 19.375 5 22.525000000000002 38.550000000000004 21.95 16.975 6 15.825 41.099999999999994 24.0 19.075 7 15.950000000000001 17.075000000000003 44.45 22.525000000000002 8 18.3 22.075 29.825000000000003 29.799999999999997 9 21.15 22.85 29.225 26.775 10-14 20.73 30.625000000000004 27.265 21.38 15-19 20.995 28.02 28.515 22.470000000000002 20-24 20.86 29.43 27.67 22.040000000000003 25-29 21.29 28.51 28.32 21.88 30-34 20.919999999999998 30.06 27.284999999999997 21.735 35-39 21.295 29.32 28.044999999999998 21.34 40-44 21.235 28.455000000000002 28.265 22.045 45-49 21.57 28.865000000000002 27.534999999999997 22.03 50-54 21.595 28.555000000000003 27.939999999999998 21.91 55-59 21.34 28.23 28.54 21.89 60-64 21.73 29.12 27.495000000000005 21.654999999999998 65-69 21.395 29.56 27.455000000000002 21.59 70-74 21.69 29.270000000000003 27.55 21.490000000000002 75-79 21.78 28.610000000000003 27.975 21.634999999999998 80-84 21.535 29.310000000000002 27.805000000000003 21.349999999999998 85-89 21.365000000000002 28.65 28.084999999999997 21.9 90-94 21.34 28.93 27.705000000000002 22.025 95-99 21.705 29.21 27.725 21.36 100-104 22.125 28.38 27.83 21.665 105-109 21.645 28.035 28.13 22.189999999999998 110-114 21.94 28.165000000000003 28.449999999999996 21.445 115-119 21.85 28.4 28.13 21.62 120-124 22.24 28.455000000000002 28.21 21.095 125-129 21.545 28.475 28.555000000000003 21.425 130-134 22.24 28.775000000000002 27.57 21.415 135-139 21.97 28.425 28.59 21.015 140-144 22.225 28.025 28.725 21.025 145-149 21.404999999999998 28.884999999999998 29.385 20.325 150 22.2 28.775000000000002 27.500000000000004 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 4.0 19 4.5 20 2.0 21 2.0 22 4.5 23 4.0 24 7.0 25 7.5 26 7.0 27 9.5 28 15.0 29 24.0 30 34.5 31 42.5 32 49.5 33 63.0 34 68.5 35 86.0 36 114.5 37 130.0 38 151.5 39 186.0 40 223.5 41 240.5 42 242.0 43 262.5 44 268.5 45 253.0 46 250.5 47 233.0 48 198.0 49 163.0 50 132.0 51 114.5 52 89.0 53 71.0 54 54.5 55 39.5 56 39.0 57 28.5 58 20.5 59 16.0 60 12.5 61 10.0 62 5.5 63 3.0 64 3.0 65 3.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 51.349999999999994 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.80838003736322 87.875 2 5.684547638110488 10.65 3 0.45369629036562586 1.275 4 0.05337603416066186 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.3125 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.5125 0.0 0.0 0.0 0.0 132-133 0.6000000000000001 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.8500000000000001 0.0 0.0 0.0 0.0 138 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAATG 10 0.0070502195 143.475 7 ATCAAAT 10 0.0070502195 143.475 6 >>END_MODULE SRR5933790 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.98125 12.0 2.0 32.0 2.0 32.0 2 30.68 32.0 32.0 32.0 27.0 32.0 3 32.86125 32.0 32.0 37.0 32.0 37.0 4 34.35 37.0 32.0 37.0 32.0 37.0 5 34.99375 37.0 37.0 37.0 32.0 37.0 6 37.3575 41.0 37.0 41.0 32.0 41.0 7 36.25475 41.0 37.0 41.0 27.0 41.0 8 39.356 41.0 41.0 41.0 37.0 41.0 9 39.415 41.0 41.0 41.0 37.0 41.0 10-14 39.21475 41.0 41.0 41.0 36.0 41.0 15-19 39.0215 41.0 41.0 41.0 35.0 41.0 20-24 38.56155 41.0 40.2 41.0 33.0 41.0 25-29 38.23235 41.0 38.6 41.0 32.0 41.0 30-34 38.32655 41.0 38.6 41.0 33.0 41.0 35-39 38.13695 41.0 37.8 41.0 31.0 41.0 40-44 39.159000000000006 41.0 40.2 41.0 35.0 41.0 45-49 39.3575 41.0 41.0 41.0 37.0 41.0 50-54 38.88985 41.0 41.0 41.0 34.0 41.0 55-59 38.3629 41.0 37.8 41.0 32.0 41.0 60-64 37.755950000000006 41.0 37.0 41.0 30.0 41.0 65-69 36.18965 41.0 35.0 41.0 22.0 41.0 70-74 36.505250000000004 41.0 36.0 41.0 25.0 41.0 75-79 36.7619 40.2 35.0 41.0 28.0 41.0 80-84 36.25055 41.0 35.0 41.0 24.0 41.0 85-89 35.84155 41.0 35.0 41.0 24.0 41.0 90-94 34.318599999999996 37.8 31.0 41.0 18.0 41.0 95-99 34.796899999999994 37.8 33.0 41.0 21.0 41.0 100-104 35.44605 37.8 33.0 41.0 23.0 41.0 105-109 33.75515 37.0 31.0 41.0 16.0 41.0 110-114 33.73235 37.0 31.0 41.0 18.0 41.0 115-119 31.295400000000008 35.0 26.0 41.0 12.0 41.0 120-124 29.587799999999998 32.0 22.0 39.4 12.0 41.0 125-129 29.590249999999997 32.0 21.0 39.4 12.0 41.0 130-134 27.14915 28.0 18.0 37.0 12.0 41.0 135-139 23.527499999999996 25.0 12.0 33.0 11.2 38.6 140-144 20.96845 17.0 12.0 29.0 9.6 37.8 145-149 21.631999999999998 20.0 12.0 30.0 11.2 36.0 150 18.07125 12.0 12.0 22.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 4.0 18 2.0 19 2.0 20 10.0 21 12.0 22 22.0 23 26.0 24 46.0 25 58.0 26 68.0 27 102.0 28 112.0 29 140.0 30 155.0 31 229.0 32 289.0 33 324.0 34 361.0 35 423.0 36 456.0 37 488.0 38 396.0 39 232.0 40 38.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.154594069032573 17.50121536217793 20.466699076324744 35.877491492464756 2 23.974999999999998 26.450000000000003 33.775 15.8 3 22.375 30.475 25.775 21.375 4 21.775 35.699999999999996 22.225 20.3 5 20.95 39.025 22.925 17.1 6 17.349999999999998 38.875 24.05 19.725 7 15.325 16.35 45.550000000000004 22.775000000000002 8 19.175 22.625 28.725 29.475 9 19.950000000000003 23.775 29.049999999999997 27.224999999999998 10-14 20.549999999999997 30.570000000000004 27.54 21.34 15-19 21.0 28.1 28.88 22.02 20-24 21.575 28.985 27.889999999999997 21.55 25-29 20.785 29.68 28.050000000000004 21.485000000000003 30-34 20.61 29.099999999999998 28.365000000000002 21.925 35-39 21.565 29.2 27.66 21.575 40-44 21.145 28.865000000000002 28.24 21.75 45-49 21.14 29.39 27.73 21.740000000000002 50-54 21.395 28.93 27.805000000000003 21.87 55-59 21.515 28.825 27.605 22.055 60-64 21.335 28.93 28.07 21.665 65-69 20.91 29.134999999999998 28.09 21.865000000000002 70-74 20.96 28.939999999999998 28.03 22.07 75-79 21.695 28.605000000000004 27.97 21.73 80-84 21.875 28.804999999999996 27.189999999999998 22.13 85-89 21.4 28.544999999999998 28.02 22.035 90-94 21.215 29.575000000000003 28.015 21.195 95-99 21.135 28.03 28.725 22.11 100-104 21.195 28.095 28.315 22.395 105-109 21.240000000000002 28.660000000000004 28.110000000000003 21.990000000000002 110-114 21.87 28.74 28.07 21.32 115-119 21.990000000000002 28.65 28.044999999999998 21.315 120-124 21.7 28.265 28.875 21.16 125-129 21.755 28.705000000000002 28.110000000000003 21.43 130-134 22.595000000000002 28.74 27.465 21.2 135-139 22.475 27.79 27.589999999999996 22.145 140-144 23.34 28.189999999999998 28.425 20.044999999999998 145-149 22.13 28.360000000000003 28.54 20.97 150 24.075 29.599999999999998 31.85 14.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 2.5 18 4.0 19 2.5 20 2.5 21 5.0 22 4.0 23 2.5 24 3.0 25 7.0 26 10.5 27 13.0 28 15.5 29 20.0 30 33.0 31 42.0 32 53.0 33 74.0 34 98.0 35 101.5 36 107.0 37 130.0 38 160.5 39 188.0 40 199.5 41 232.5 42 252.5 43 253.0 44 267.5 45 279.5 46 245.0 47 198.5 48 187.0 49 158.0 50 123.0 51 115.0 52 92.5 53 65.0 54 50.5 55 44.0 56 41.0 57 27.5 58 16.5 59 11.0 60 10.0 61 9.5 62 9.0 63 5.5 64 4.5 65 6.0 66 3.0 67 0.0 68 2.0 69 3.0 70 1.5 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 48.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20828905419766 88.64999999999999 2 5.313496280552603 10.0 3 0.4782146652497344 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.8125 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATCTC 10 0.0070410464 143.53749 9 >>END_MODULE Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416394 spots for SRR5933790.sra Written 1416394 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra Read 1416384 spots for SRR5933790.sra Written 1416384 spots for SRR5933790.sra SRR ids: ['SRR5933790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h0x38899 SRR5933790.sra spots: 28327690 blocks: [[1, 1416384], [1416385, 2832768], [2832769, 4249152], [4249153, 5665536], [5665537, 7081920], [7081921, 8498304], [8498305, 9914688], [9914689, 11331072], [11331073, 12747456], [12747457, 14163840], [14163841, 15580224], [15580225, 16996608], [16996609, 18412992], [18412993, 19829376], [19829377, 21245760], [21245761, 22662144], [22662145, 24078528], [24078529, 25494912], [25494913, 26911296], [26911297, 28327690]] SRR5933790 file size 9522296 SRR5933790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933790 SRR5933790_1.fastq SRR5933790_2.fastq Input file: SRR5933790_1.fastq Paired file: SRR5933790_2.fastq trimmed: SRR5933790-trimmed-pair1.fastq, SRR5933790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:06:49 2025 >> started Mon Feb 10 20:07:43 2025 >> done (53.657s) 28327690 read pairs processed; of these: 260 ( 0.00%) short read pairs filtered out after trimming by size control 60 ( 0.00%) empty read pairs filtered out after trimming by size control 28327370 (100.00%) read pairs available; of these: 1966359 ( 6.94%) trimmed read pairs available after processing 26361011 (93.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 51 0.00% 19 78 0.00% 20 81 0.00% 21 120 0.00% 22 144 0.00% 23 206 0.00% 24 245 0.00% 25 237 0.00% 26 251 0.00% 27 286 0.00% 28 355 0.00% 29 341 0.00% 30 375 0.00% 31 352 0.00% 32 437 0.00% 33 380 0.00% 34 384 0.00% 35 419 0.00% 36 453 0.00% 37 504 0.00% 38 474 0.00% 39 459 0.00% 40 463 0.00% 41 483 0.00% 42 474 0.00% 43 535 0.00% 44 499 0.00% 45 486 0.00% 46 502 0.00% 47 459 0.00% 48 537 0.00% 49 497 0.00% 50 553 0.00% 51 565 0.00% 52 597 0.00% 53 565 0.00% 54 514 0.00% 55 548 0.00% 56 553 0.00% 57 499 0.00% 58 515 0.00% 59 528 0.00% 60 546 0.00% 61 518 0.00% 62 544 0.00% 63 526 0.00% 64 493 0.00% 65 546 0.00% 66 545 0.00% 67 537 0.00% 68 546 0.00% 69 519 0.00% 70 517 0.00% 71 514 0.00% 72 600 0.00% 73 572 0.00% 74 543 0.00% 75 579 0.00% 76 656 0.00% 77 620 0.00% 78 641 0.00% 79 663 0.00% 80 674 0.00% 81 669 0.00% 82 749 0.00% 83 800 0.00% 84 777 0.00% 85 900 0.00% 86 884 0.00% 87 832 0.00% 88 903 0.00% 89 1076 0.00% 90 1055 0.00% 91 1125 0.00% 92 1086 0.00% 93 1254 0.00% 94 1349 0.00% 95 1477 0.01% 96 1471 0.01% 97 1619 0.01% 98 1702 0.01% 99 1769 0.01% 100 1927 0.01% 101 1957 0.01% 102 2045 0.01% 103 2234 0.01% 104 2400 0.01% 105 2504 0.01% 106 2659 0.01% 107 2752 0.01% 108 2925 0.01% 109 3189 0.01% 110 3214 0.01% 111 3508 0.01% 112 3662 0.01% 113 3816 0.01% 114 4089 0.01% 115 4402 0.02% 116 4525 0.02% 117 4573 0.02% 118 4911 0.02% 119 5039 0.02% 120 5351 0.02% 121 5735 0.02% 122 6056 0.02% 123 6521 0.02% 124 6744 0.02% 125 6802 0.02% 126 7322 0.03% 127 7622 0.03% 128 8019 0.03% 129 8616 0.03% 130 8780 0.03% 131 9288 0.03% 132 9706 0.03% 133 9928 0.04% 134 10554 0.04% 135 11155 0.04% 136 11561 0.04% 137 12183 0.04% 138 12779 0.05% 139 13283 0.05% 140 13700 0.05% 141 14287 0.05% 142 15288 0.05% 143 15809 0.06% 144 17002 0.06% 145 18725 0.07% 146 23180 0.08% 147 42120 0.15% 148 148755 0.53% 149 1362757 4.81% 150 26361011 93.06% 28327370 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=25 prefix-density=0.13 prefix-fanout=3.2 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=687.17 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=33.8 sequence=TTCTTCTTCTTAGAAAATAATTTAGCATGGATTCGGACTTAAGAGGCGTTCAGCCTTTATCCAACAGATGGTAGCTTGACCGCATGGTGGCCTATCGACCAACGGTGGCACCAATTATCTGAATCAACCGTTCCTCTCGTACTGAGTCGAATTACTATTAGAAGAAGACTTTTTTTTTAGTCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGCGGGTGAACAATCCGAACCTTGCCGAATTCTGCTTCGAGCAGTGTAGGAAGAGCCGACATCGAAGAATCAAAAAGTGACGTCGCTCTGAACGCTTGGCCACCACAAGCCAGTTATCCCTATGGTAACTATTCTGACACCTCTATCGCCAAGTAGTGGCTTTTCTACACATTTTTTTTTAAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=28 prefix-density=0.12 prefix-fanout=3.2 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=655.54 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=32.8 sequence=TTCTTCTTCTTAGAAAATAATTTAGCATGGATTCGGACTTAAGAGGCGTTCAGCCTTTATCCAACAGATGGTAGCTTGACCGCATGGTGGCCTATCGACCAACGGTGGCACCAATTATCTGAATCAACCGTTCCTCTCGTACTGAGTCGAATTACTATTAGAAGAAGACTTTTTTTTTAGTCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGCGGGTGAACAATCCGAACCTTGCCGAATTCTGCTTCGAGCAGTGTAGGAAGAGCCGACATCGAAGAATCAAAAAGTGACGTCGCTCTGAACGCTTGGCCACCACAAGCCAGTTATCCCTATGGTAACTATTCTGACACCTCTATCGCCAAGTAGTGGCTTTTCTACACATTTTTTTTTAAAA SRR5933790 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 20:26:04 Started mapping on | Feb 10 20:26:07 Finished on | Feb 10 20:34:12 Mapping speed, Million of reads per hour | 210.22 Number of input reads | 28321671 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 22234193 Uniquely mapped reads % | 78.51% Average mapped length | 269.62 Number of splices: Total | 16118219 Number of splices: Annotated (sjdb) | 15422454 Number of splices: GT/AG | 15722735 Number of splices: GC/AG | 200223 Number of splices: AT/AC | 11998 Number of splices: Non-canonical | 183263 Mismatch rate per base, % | 2.25% Deletion rate per base | 0.14% Deletion average length | 3.18 Insertion rate per base | 0.09% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1613860 % of reads mapped to multiple loci | 5.70% Number of reads mapped to too many loci | 15835 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.25% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4474217 4474217 4474217 N_multimapping 1613860 1613860 1613860 N_noFeature 577978 11360257 11335325 N_ambiguous 426064 155735 155887 UnstrandedReadsAssigned:21230151 PositiveStrandReadsAssigned:10718201 NegativeStrandReadsAssigned:10742981 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933790-trimmed-pair1.fastq SRR5933790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,321,671 reads, 22,153,045 reads pseudoaligned [quant] estimated average fragment length: 228.391 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR5933790.ke.tsv 34699 SRR5933790.se.tsv 87100 total ==> SRR5933790.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.61 7558.59 180.812 Potri.005G024800.1.v4.1 1035 807.609 2300 121.987 Potri.004G059700.1.v4.1 961 733.609 46 2.68584 Potri.007G009000.2.v4.1 1416 1188.61 0 0 Potri.003G141000.2.v4.1 2943 2715.61 681.769 10.7537 Potri.016G087400.1.v4.1 270 62.8892 627 427.05 Potri.015G069301.1.v4.1 564 336.795 0 0 Potri.010G195200.1.v4.1 1773 1545.61 156 4.32327 Potri.012G127500.1.v4.1 977 749.609 4495 256.852 ==> SRR5933790.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1182 SRR5933790 completed mapping pipeline successfully