Starting /dee2/code/volunteer_pipeline.sh SRR5933791 current disk space = 3056885481472 free memory = 1447853124 SRR5933791 SRAfilesize 9ac8948e84b8d3c14ffc79a41aea7d95 SRR5933791.sra SRR5933791.sra file validated SRR5933791 is paired end SRR5933791 is conventional basespace SRR5933791 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933791_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 14.8275 2.0 2.0 32.0 2.0 32.0 2 28.06375 32.0 27.0 32.0 12.0 32.0 3 32.7875 32.0 32.0 32.0 32.0 37.0 4 35.895 37.0 37.0 37.0 32.0 37.0 5 35.79125 37.0 37.0 37.0 32.0 37.0 6 39.37325 41.0 41.0 41.0 37.0 41.0 7 39.49375 41.0 41.0 41.0 37.0 41.0 8 39.9555 41.0 41.0 41.0 37.0 41.0 9 40.061 41.0 41.0 41.0 37.0 41.0 10-14 39.9895 41.0 41.0 41.0 37.0 41.0 15-19 39.9581 41.0 41.0 41.0 37.0 41.0 20-24 39.8266 41.0 41.0 41.0 37.0 41.0 25-29 39.413050000000005 41.0 41.0 41.0 36.0 41.0 30-34 39.738899999999994 41.0 41.0 41.0 37.0 41.0 35-39 39.40065 41.0 41.0 41.0 37.0 41.0 40-44 39.52205 41.0 41.0 41.0 37.0 41.0 45-49 39.502700000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.25189999999999 41.0 41.0 41.0 35.0 41.0 55-59 38.8548 41.0 40.2 41.0 35.0 41.0 60-64 39.41455 41.0 41.0 41.0 37.0 41.0 65-69 39.34595 41.0 41.0 41.0 37.0 41.0 70-74 39.4005 41.0 41.0 41.0 37.0 41.0 75-79 39.01795 41.0 39.4 41.0 34.0 41.0 80-84 38.881899999999995 41.0 40.2 41.0 35.0 41.0 85-89 38.720299999999995 41.0 38.6 41.0 34.0 41.0 90-94 38.81355 41.0 40.2 41.0 34.0 41.0 95-99 38.993050000000004 41.0 41.0 41.0 35.0 41.0 100-104 38.4859 41.0 38.6 41.0 33.0 41.0 105-109 38.749300000000005 41.0 41.0 41.0 33.0 41.0 110-114 38.56475 41.0 37.8 41.0 32.0 41.0 115-119 37.4975 41.0 37.0 41.0 29.0 41.0 120-124 36.7174 40.2 36.0 41.0 26.0 41.0 125-129 34.5207 38.6 32.0 41.0 18.0 41.0 130-134 34.9925 39.4 34.0 41.0 19.0 41.0 135-139 33.55475 38.6 29.0 41.0 16.0 41.0 140-144 33.92225 38.4 29.0 41.0 19.0 41.0 145-149 29.17825 32.0 21.0 38.4 12.0 40.2 150 28.986 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 3.0 24 5.0 25 9.0 26 15.0 27 26.0 28 33.0 29 27.0 30 47.0 31 74.0 32 88.0 33 125.0 34 143.0 35 219.0 36 289.0 37 436.0 38 651.0 39 1132.0 40 676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.10495963091119 17.87773933102653 19.896193771626297 35.121107266435985 2 24.45 27.925 33.225 14.399999999999999 3 22.025 29.15 26.6 22.225 4 24.425 35.975 19.900000000000002 19.7 5 22.25 37.9 22.650000000000002 17.2 6 15.024999999999999 39.75 24.425 20.8 7 14.975 17.150000000000002 46.25 21.625 8 18.725 22.2 28.249999999999996 30.825000000000003 9 20.275000000000002 23.275000000000002 28.249999999999996 28.199999999999996 10-14 20.155 30.885 27.150000000000002 21.81 15-19 21.085 28.625 27.96 22.33 20-24 21.22 28.410000000000004 28.055000000000003 22.314999999999998 25-29 21.279999999999998 29.310000000000002 27.755000000000003 21.654999999999998 30-34 20.415 28.675 28.07 22.84 35-39 21.515 29.080000000000002 27.279999999999998 22.125 40-44 21.305 29.005 27.76 21.93 45-49 20.93 28.835 28.139999999999997 22.095000000000002 50-54 20.990000000000002 28.895 28.15 21.965 55-59 21.175 28.985 27.51 22.33 60-64 21.85 28.49 27.43 22.23 65-69 21.26 28.884999999999998 27.700000000000003 22.155 70-74 21.240000000000002 28.835 27.98 21.945 75-79 21.55 28.449999999999996 27.955000000000002 22.045 80-84 21.66 28.49 27.68 22.17 85-89 21.59 28.544999999999998 27.189999999999998 22.675 90-94 21.61 28.215 27.994999999999997 22.18 95-99 21.790000000000003 28.52 27.42 22.27 100-104 21.555 29.13 27.805000000000003 21.51 105-109 21.52 28.465 28.305000000000003 21.709999999999997 110-114 21.675 28.165000000000003 28.185 21.975 115-119 21.18 28.73 28.310000000000002 21.78 120-124 21.72 28.57 28.275 21.435000000000002 125-129 21.44 28.715000000000003 28.12 21.725 130-134 21.75 28.155 28.744999999999997 21.349999999999998 135-139 21.69 28.470000000000002 28.48 21.36 140-144 21.77 27.950000000000003 28.965000000000003 21.315 145-149 22.285 27.975 29.74 20.0 150 20.65 29.475 27.85 22.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 1.5 19 1.0 20 1.5 21 2.0 22 1.5 23 2.5 24 6.5 25 7.5 26 7.0 27 12.5 28 18.5 29 25.0 30 29.0 31 37.0 32 46.5 33 65.5 34 79.5 35 78.5 36 112.0 37 140.5 38 163.0 39 188.0 40 200.0 41 228.0 42 239.5 43 247.5 44 275.5 45 267.0 46 244.5 47 208.0 48 174.0 49 161.5 50 137.0 51 112.5 52 98.0 53 90.5 54 67.5 55 50.5 56 40.5 57 27.0 58 19.5 59 17.0 60 11.0 61 6.0 62 9.0 63 7.5 64 2.0 65 4.5 66 4.0 67 2.5 68 3.0 69 1.5 70 1.5 71 2.0 72 3.0 73 2.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 56.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9877627028465 88.325 2 5.613194998669859 10.549999999999999 3 0.39904229848363926 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.6125 0.0 0.0 0.0 0.0 134-135 0.6625000000000001 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTAT 10 0.007055733 143.4375 5 >>END_MODULE SRR5933791 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933791_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 15.6975 2.0 2.0 32.0 2.0 32.0 2 30.66125 32.0 32.0 32.0 32.0 32.0 3 32.69 32.0 32.0 37.0 32.0 37.0 4 34.3225 37.0 32.0 37.0 32.0 37.0 5 35.185 37.0 37.0 37.0 32.0 37.0 6 37.21575 41.0 37.0 41.0 32.0 41.0 7 36.064 41.0 37.0 41.0 22.0 41.0 8 39.177 41.0 41.0 41.0 37.0 41.0 9 39.35975 41.0 41.0 41.0 37.0 41.0 10-14 39.188750000000006 41.0 41.0 41.0 37.0 41.0 15-19 39.05284999999999 41.0 40.2 41.0 35.0 41.0 20-24 38.612649999999995 41.0 39.4 41.0 34.0 41.0 25-29 38.32745 41.0 38.6 41.0 33.0 41.0 30-34 38.400400000000005 41.0 38.6 41.0 33.0 41.0 35-39 38.20715 41.0 37.8 41.0 31.0 41.0 40-44 39.0574 41.0 40.2 41.0 35.0 41.0 45-49 39.231700000000004 41.0 41.0 41.0 37.0 41.0 50-54 38.97195000000001 41.0 41.0 41.0 35.0 41.0 55-59 38.347150000000006 41.0 37.8 41.0 32.0 41.0 60-64 37.88275 41.0 37.0 41.0 31.0 41.0 65-69 36.34185 41.0 37.0 41.0 24.0 41.0 70-74 36.580200000000005 41.0 36.0 41.0 25.0 41.0 75-79 36.70295 40.2 35.0 41.0 27.0 41.0 80-84 36.3001 41.0 35.0 41.0 25.0 41.0 85-89 35.826049999999995 41.0 35.0 41.0 24.0 41.0 90-94 34.266450000000006 37.8 30.0 41.0 18.0 41.0 95-99 34.865899999999996 37.8 32.0 41.0 21.0 41.0 100-104 35.3865 37.8 34.0 41.0 23.0 41.0 105-109 33.6504 37.0 31.0 41.0 14.0 41.0 110-114 33.699 37.0 30.0 41.0 18.0 41.0 115-119 31.1406 35.0 25.0 41.0 12.0 41.0 120-124 29.6539 32.0 22.0 39.4 12.0 41.0 125-129 29.6065 32.0 22.0 40.2 12.0 41.0 130-134 27.059049999999996 28.0 18.0 37.0 12.0 41.0 135-139 23.627250000000004 24.0 12.0 33.0 11.2 38.6 140-144 20.99005 17.0 12.0 29.0 11.2 37.0 145-149 21.4152 20.0 12.0 30.0 11.2 36.0 150 18.03 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 2.0 18 5.0 19 6.0 20 9.0 21 12.0 22 19.0 23 33.0 24 53.0 25 40.0 26 62.0 27 83.0 28 112.0 29 150.0 30 211.0 31 220.0 32 253.0 33 367.0 34 386.0 35 424.0 36 409.0 37 457.0 38 405.0 39 240.0 40 41.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.72 19.306666666666665 19.573333333333334 34.4 2 24.125 26.85 33.5 15.525 3 22.95 29.675 26.400000000000002 20.974999999999998 4 23.25 36.675000000000004 20.525 19.55 5 22.85 37.675 22.325 17.150000000000002 6 15.4 39.7 24.325 20.575 7 14.524999999999999 17.575 45.375 22.525000000000002 8 20.025000000000002 22.525000000000002 28.299999999999997 29.15 9 21.075 24.3 28.449999999999996 26.174999999999997 10-14 20.43 31.105 27.305 21.16 15-19 20.615 28.455000000000002 29.020000000000003 21.91 20-24 20.96 29.48 27.79 21.77 25-29 21.255 29.2 27.925 21.62 30-34 20.919999999999998 29.17 28.744999999999997 21.165 35-39 21.125 29.18 28.015 21.68 40-44 21.240000000000002 28.79 28.675 21.295 45-49 21.355 28.84 27.74 22.065 50-54 21.625 28.549999999999997 28.34 21.485000000000003 55-59 21.465 28.865000000000002 28.28 21.39 60-64 21.395 28.785 28.22 21.6 65-69 21.725 28.785 27.845 21.645 70-74 20.635 28.689999999999998 28.645 22.03 75-79 22.065 28.73 27.47 21.735 80-84 21.5 29.415000000000003 27.83 21.255 85-89 21.834999999999997 28.985 27.565 21.615000000000002 90-94 21.93 28.365000000000002 28.21 21.495 95-99 21.27 28.89 28.52 21.32 100-104 21.565 28.349999999999998 27.985 22.1 105-109 21.965 28.405 27.55 22.08 110-114 21.94 29.065 27.650000000000002 21.345 115-119 21.995 28.455000000000002 28.305000000000003 21.245 120-124 21.865000000000002 28.794999999999998 27.925 21.415 125-129 22.175 28.62 28.28 20.925 130-134 22.439999999999998 28.12 27.805000000000003 21.634999999999998 135-139 22.45 28.970000000000002 27.694999999999997 20.885 140-144 23.16 28.804999999999996 27.92 20.115 145-149 22.634999999999998 28.849999999999998 28.389999999999997 20.125 150 25.674999999999997 28.575 30.75 15.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 3.0 19 3.5 20 2.0 21 4.5 22 5.0 23 4.5 24 6.0 25 8.0 26 10.5 27 11.0 28 14.0 29 21.5 30 35.0 31 53.5 32 62.0 33 68.5 34 83.0 35 99.5 36 123.5 37 143.0 38 169.0 39 203.5 40 228.0 41 231.0 42 231.0 43 243.5 44 251.0 45 248.0 46 235.0 47 214.0 48 185.5 49 157.0 50 128.5 51 99.5 52 82.5 53 67.5 54 48.0 55 42.5 56 36.5 57 24.5 58 21.0 59 18.5 60 15.5 61 12.5 62 9.5 63 6.5 64 4.0 65 5.0 66 4.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 1.5 73 2.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 53.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.96838777660696 90.125 2 4.689146469968388 8.9 3 0.3424657534246575 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATAA 10 0.0070502195 143.475 5 AGGATCT 10 0.0070502195 143.475 2 ATATAAA 10 0.0070502195 143.475 6 >>END_MODULE Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565353 spots for SRR5933791.sra Written 1565353 spots for SRR5933791.sra Read 1565371 spots for SRR5933791.sra Written 1565371 spots for SRR5933791.sra SRR ids: ['SRR5933791.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_flwoq0bm SRR5933791.sra spots: 31307078 blocks: [[1, 1565353], [1565354, 3130706], [3130707, 4696059], [4696060, 6261412], [6261413, 7826765], [7826766, 9392118], [9392119, 10957471], [10957472, 12522824], [12522825, 14088177], [14088178, 15653530], [15653531, 17218883], [17218884, 18784236], [18784237, 20349589], [20349590, 21914942], [21914943, 23480295], [23480296, 25045648], [25045649, 26611001], [26611002, 28176354], [28176355, 29741707], [29741708, 31307078]] SRR5933791 file size 10526094 SRR5933791 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933791 SRR5933791_1.fastq SRR5933791_2.fastq Input file: SRR5933791_1.fastq Paired file: SRR5933791_2.fastq trimmed: SRR5933791-trimmed-pair1.fastq, SRR5933791-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:26:42 2025 >> started Mon Feb 10 19:27:32 2025 >> done (50.300s) 31307078 read pairs processed; of these: 291 ( 0.00%) short read pairs filtered out after trimming by size control 80 ( 0.00%) empty read pairs filtered out after trimming by size control 31306707 (100.00%) read pairs available; of these: 2203126 ( 7.04%) trimmed read pairs available after processing 29103581 (92.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 73 0.00% 20 101 0.00% 21 164 0.00% 22 180 0.00% 23 214 0.00% 24 275 0.00% 25 328 0.00% 26 325 0.00% 27 365 0.00% 28 413 0.00% 29 373 0.00% 30 436 0.00% 31 443 0.00% 32 456 0.00% 33 472 0.00% 34 488 0.00% 35 526 0.00% 36 509 0.00% 37 495 0.00% 38 560 0.00% 39 536 0.00% 40 534 0.00% 41 584 0.00% 42 586 0.00% 43 593 0.00% 44 651 0.00% 45 619 0.00% 46 586 0.00% 47 600 0.00% 48 593 0.00% 49 602 0.00% 50 605 0.00% 51 608 0.00% 52 635 0.00% 53 714 0.00% 54 678 0.00% 55 632 0.00% 56 626 0.00% 57 633 0.00% 58 619 0.00% 59 643 0.00% 60 662 0.00% 61 636 0.00% 62 585 0.00% 63 617 0.00% 64 636 0.00% 65 649 0.00% 66 657 0.00% 67 618 0.00% 68 626 0.00% 69 625 0.00% 70 650 0.00% 71 621 0.00% 72 687 0.00% 73 673 0.00% 74 671 0.00% 75 718 0.00% 76 761 0.00% 77 755 0.00% 78 767 0.00% 79 888 0.00% 80 845 0.00% 81 856 0.00% 82 943 0.00% 83 952 0.00% 84 1029 0.00% 85 1086 0.00% 86 1157 0.00% 87 1182 0.00% 88 1138 0.00% 89 1293 0.00% 90 1343 0.00% 91 1544 0.00% 92 1564 0.00% 93 1692 0.01% 94 1735 0.01% 95 1813 0.01% 96 2064 0.01% 97 2048 0.01% 98 2167 0.01% 99 2275 0.01% 100 2417 0.01% 101 2531 0.01% 102 2717 0.01% 103 2895 0.01% 104 3139 0.01% 105 3373 0.01% 106 3314 0.01% 107 3468 0.01% 108 3776 0.01% 109 4035 0.01% 110 4207 0.01% 111 4504 0.01% 112 4448 0.01% 113 4713 0.02% 114 5033 0.02% 115 5276 0.02% 116 5481 0.02% 117 5668 0.02% 118 6079 0.02% 119 6417 0.02% 120 6599 0.02% 121 6792 0.02% 122 7265 0.02% 123 7507 0.02% 124 8055 0.03% 125 8105 0.03% 126 8562 0.03% 127 9153 0.03% 128 9332 0.03% 129 9597 0.03% 130 10119 0.03% 131 10614 0.03% 132 11053 0.04% 133 11537 0.04% 134 11806 0.04% 135 12590 0.04% 136 12725 0.04% 137 13499 0.04% 138 14371 0.05% 139 14658 0.05% 140 15283 0.05% 141 15655 0.05% 142 16681 0.05% 143 17413 0.06% 144 18313 0.06% 145 19981 0.06% 146 25501 0.08% 147 46007 0.15% 148 163620 0.52% 149 1514888 4.84% 150 29103581 92.96% 31306707 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.16 fanout-score-rank=27 prefix-density=0.14 prefix-fanout=3.6 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=364.40 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=32.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=30 prefix-density=0.10 prefix-fanout=2.4 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=386.33 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=32.7 sequence=AAGAAGAAGAAA SRR5933791 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:29:21 Started mapping on | Feb 10 19:29:22 Finished on | Feb 10 19:39:25 Mapping speed, Million of reads per hour | 186.91 Number of input reads | 31306707 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 24612469 Uniquely mapped reads % | 78.62% Average mapped length | 284.31 Number of splices: Total | 18917826 Number of splices: Annotated (sjdb) | 18082925 Number of splices: GT/AG | 18454476 Number of splices: GC/AG | 233042 Number of splices: AT/AC | 13830 Number of splices: Non-canonical | 216478 Mismatch rate per base, % | 2.22% Deletion rate per base | 0.14% Deletion average length | 3.22 Insertion rate per base | 0.09% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1807283 % of reads mapped to multiple loci | 5.77% Number of reads mapped to too many loci | 132656 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.69% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4886955 4886955 4886955 N_multimapping 1807283 1807283 1807283 N_noFeature 628813 12571014 12531991 N_ambiguous 479398 170728 173059 UnstrandedReadsAssigned:23504258 PositiveStrandReadsAssigned:11870727 NegativeStrandReadsAssigned:11907419 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR5933791 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933791-trimmed-pair1.fastq SRR5933791-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,306,707 reads, 24,418,948 reads pseudoaligned [quant] estimated average fragment length: 248.284 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR5933791.ke.tsv 34699 SRR5933791.se.tsv 87100 total ==> SRR5933791.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.72 7590.59 156.271 Potri.005G024800.1.v4.1 1035 787.716 3005 139.068 Potri.004G059700.1.v4.1 961 713.721 39 1.99199 Potri.007G009000.2.v4.1 1416 1168.72 0 0 Potri.003G141000.2.v4.1 2943 2695.72 715.613 9.67734 Potri.016G087400.1.v4.1 270 53.7968 671 454.692 Potri.015G069301.1.v4.1 564 316.864 0 0 Potri.010G195200.1.v4.1 1773 1525.72 402.505 9.61722 Potri.012G127500.1.v4.1 977 729.716 8675 433.378 ==> SRR5933791.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1280 SRR5933791 completed mapping pipeline successfully