Starting /dee2/code/volunteer_pipeline.sh SRR5933792 current disk space = 3056272879616 free memory = 1096099048 SRR5933792 SRAfilesize ac579b0dcd5f05def3c31b2e9e32782e SRR5933792.sra SRR5933792.sra file validated SRR5933792 is paired end SRR5933792 is conventional basespace SRR5933792 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.16875 32.0 2.0 32.0 2.0 32.0 2 27.695 32.0 27.0 32.0 12.0 32.0 3 33.205 32.0 32.0 37.0 32.0 37.0 4 35.90625 37.0 37.0 37.0 32.0 37.0 5 35.6225 37.0 37.0 37.0 32.0 37.0 6 39.232 41.0 41.0 41.0 37.0 41.0 7 39.50625 41.0 41.0 41.0 37.0 41.0 8 39.8335 41.0 41.0 41.0 37.0 41.0 9 39.9955 41.0 41.0 41.0 37.0 41.0 10-14 39.88615 41.0 41.0 41.0 37.0 41.0 15-19 39.84929999999999 41.0 41.0 41.0 37.0 41.0 20-24 39.72025 41.0 41.0 41.0 37.0 41.0 25-29 39.34935 41.0 41.0 41.0 36.0 41.0 30-34 39.60985 41.0 41.0 41.0 37.0 41.0 35-39 39.1575 41.0 41.0 41.0 36.0 41.0 40-44 39.39985 41.0 41.0 41.0 36.0 41.0 45-49 39.32825 41.0 41.0 41.0 37.0 41.0 50-54 38.9899 41.0 40.2 41.0 34.0 41.0 55-59 38.652550000000005 41.0 39.4 41.0 34.0 41.0 60-64 39.1203 41.0 41.0 41.0 35.0 41.0 65-69 39.1188 41.0 41.0 41.0 36.0 41.0 70-74 39.11385 41.0 41.0 41.0 37.0 41.0 75-79 38.811800000000005 41.0 39.4 41.0 33.0 41.0 80-84 38.788799999999995 41.0 40.2 41.0 33.0 41.0 85-89 38.569849999999995 41.0 38.6 41.0 34.0 41.0 90-94 38.808949999999996 41.0 40.2 41.0 34.0 41.0 95-99 39.0103 41.0 41.0 41.0 35.0 41.0 100-104 38.495 41.0 39.4 41.0 32.0 41.0 105-109 38.6162 41.0 40.2 41.0 33.0 41.0 110-114 38.35455 41.0 37.8 41.0 32.0 41.0 115-119 37.27235 41.0 36.0 41.0 29.0 41.0 120-124 36.550349999999995 40.2 36.0 41.0 27.0 41.0 125-129 34.54855 39.4 32.0 41.0 18.0 41.0 130-134 34.716300000000004 39.4 33.0 41.0 18.0 41.0 135-139 33.48265 38.6 29.0 41.0 16.0 41.0 140-144 33.90015 39.4 29.0 41.0 18.0 41.0 145-149 29.23395 32.0 21.0 38.4 12.0 40.2 150 29.0095 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 2.0 23 5.0 24 11.0 25 9.0 26 19.0 27 29.0 28 28.0 29 43.0 30 60.0 31 79.0 32 94.0 33 125.0 34 176.0 35 209.0 36 278.0 37 388.0 38 576.0 39 1086.0 40 780.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.714532871972317 17.17128027681661 19.76643598615917 33.3477508650519 2 26.674999999999997 26.325 33.0 14.000000000000002 3 24.325 29.549999999999997 25.75 20.375 4 24.95 34.675 20.375 20.0 5 22.625 38.25 22.15 16.975 6 16.55 38.75 25.474999999999998 19.225 7 16.2 16.7 44.275 22.825 8 18.425 22.3 29.4 29.875 9 22.125 24.575 28.025 25.275 10-14 20.200000000000003 30.525000000000002 27.935 21.34 15-19 21.84 27.965 28.144999999999996 22.05 20-24 21.605 29.035 27.485 21.875 25-29 21.365000000000002 28.694999999999997 28.265 21.675 30-34 22.0 28.634999999999998 27.650000000000002 21.715 35-39 21.535 28.34 27.650000000000002 22.475 40-44 21.445 28.87 27.77 21.915000000000003 45-49 21.64 28.794999999999998 27.685 21.88 50-54 21.795 29.085 27.515 21.605 55-59 21.45 28.68 27.98 21.89 60-64 21.54 29.065 27.900000000000002 21.495 65-69 22.575 28.449999999999996 27.389999999999997 21.584999999999997 70-74 21.709999999999997 29.095 27.439999999999998 21.755 75-79 21.3 28.9 27.794999999999998 22.005 80-84 21.89 29.145 27.36 21.605 85-89 21.775 28.705000000000002 27.389999999999997 22.13 90-94 22.255 28.689999999999998 27.245 21.81 95-99 21.349999999999998 28.78 27.87 22.0 100-104 21.560000000000002 28.194999999999997 28.310000000000002 21.935 105-109 21.5 28.575 27.975 21.95 110-114 22.555 28.485 27.775 21.185000000000002 115-119 22.245 27.92 28.065 21.77 120-124 21.42 27.815 28.199999999999996 22.564999999999998 125-129 21.695 27.889999999999997 28.625 21.790000000000003 130-134 21.795 28.34 28.37 21.495 135-139 22.175 28.449999999999996 28.175 21.2 140-144 22.39 27.985 28.060000000000002 21.565 145-149 21.555 28.13 29.335 20.979999999999997 150 22.650000000000002 28.925 27.55 20.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 2.5 12 2.5 13 0.5 14 0.0 15 0.5 16 3.5 17 5.0 18 2.0 19 0.5 20 2.5 21 4.5 22 5.0 23 6.0 24 6.5 25 7.5 26 10.5 27 10.0 28 19.0 29 27.5 30 26.0 31 33.5 32 48.0 33 63.0 34 79.0 35 96.0 36 119.5 37 143.0 38 165.5 39 179.0 40 191.0 41 200.5 42 222.5 43 250.0 44 249.0 45 231.5 46 227.5 47 229.5 48 196.0 49 163.0 50 136.5 51 115.5 52 97.0 53 77.0 54 62.0 55 49.5 56 40.5 57 27.0 58 24.5 59 22.5 60 15.0 61 15.5 62 15.5 63 11.5 64 8.0 65 11.0 66 11.0 67 5.0 68 5.5 69 4.0 70 3.0 71 3.5 72 2.0 73 2.0 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 42.199999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6973861492859 86.0 2 6.8714632174616 12.75 3 0.37725680409593104 1.05 4 0.05389382915656157 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.0875 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.21250000000000002 0.0 0.0 0.0 0.0 120-121 0.2375 0.0 0.0 0.0 0.0 122-123 0.2875 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.7875 0.0 0.0 0.0 0.0 138 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933792 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.54125 32.0 2.0 32.0 2.0 32.0 2 30.525 32.0 32.0 32.0 27.0 32.0 3 32.83625 32.0 32.0 37.0 32.0 37.0 4 34.3 37.0 32.0 37.0 32.0 37.0 5 35.0675 37.0 37.0 37.0 32.0 37.0 6 37.2795 41.0 37.0 41.0 32.0 41.0 7 35.57575 41.0 32.0 41.0 22.0 41.0 8 38.8825 41.0 37.0 41.0 37.0 41.0 9 39.07525 41.0 41.0 41.0 37.0 41.0 10-14 38.99665 41.0 41.0 41.0 36.0 41.0 15-19 38.88415 41.0 40.2 41.0 34.0 41.0 20-24 38.404450000000004 41.0 39.4 41.0 32.0 41.0 25-29 38.02035 41.0 37.8 41.0 31.0 41.0 30-34 38.0152 41.0 37.8 41.0 30.0 41.0 35-39 38.0711 41.0 37.8 41.0 31.0 41.0 40-44 38.84155 41.0 40.2 41.0 35.0 41.0 45-49 39.1233 41.0 41.0 41.0 37.0 41.0 50-54 38.707499999999996 41.0 41.0 41.0 33.0 41.0 55-59 38.14025 41.0 37.8 41.0 31.0 41.0 60-64 37.555099999999996 41.0 37.0 41.0 28.0 41.0 65-69 36.1066 41.0 36.0 41.0 22.0 41.0 70-74 36.3426 41.0 36.0 41.0 23.0 41.0 75-79 36.33165 40.2 35.0 41.0 24.0 41.0 80-84 36.08795 41.0 35.0 41.0 24.0 41.0 85-89 35.6558 41.0 34.0 41.0 23.0 41.0 90-94 34.1098 37.0 30.0 41.0 18.0 41.0 95-99 34.379949999999994 37.0 31.0 41.0 18.0 41.0 100-104 34.9716 37.0 32.0 41.0 22.0 41.0 105-109 33.58285 37.0 31.0 41.0 14.0 41.0 110-114 33.57170000000001 37.0 31.0 41.0 16.0 41.0 115-119 31.1347 35.0 25.0 41.0 12.0 41.0 120-124 29.26385 32.0 22.0 38.6 12.0 41.0 125-129 29.25435 31.0 21.0 39.4 12.0 41.0 130-134 27.087699999999995 29.0 18.0 37.0 12.0 41.0 135-139 23.6529 25.0 12.0 33.0 11.2 38.6 140-144 20.8627 17.0 12.0 29.0 9.6 37.0 145-149 21.266 18.0 12.0 29.0 11.2 36.0 150 18.15825 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 5.0 18 5.0 19 8.0 20 11.0 21 18.0 22 24.0 23 39.0 24 55.0 25 70.0 26 72.0 27 116.0 28 106.0 29 139.0 30 169.0 31 227.0 32 271.0 33 314.0 34 374.0 35 380.0 36 470.0 37 469.0 38 394.0 39 225.0 40 36.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.411300373909434 16.659742417947655 18.238471125882842 34.69048608226007 2 24.775 26.474999999999998 33.15 15.6 3 24.575 28.9 23.625 22.900000000000002 4 23.799999999999997 36.425000000000004 19.7 20.075000000000003 5 22.775000000000002 37.525 22.75 16.950000000000003 6 16.950000000000003 38.9 24.925 19.225 7 14.424999999999999 17.299999999999997 46.050000000000004 22.225 8 21.2 22.325 27.625 28.849999999999998 9 21.525 22.55 28.375 27.55 10-14 20.48 30.45 27.715 21.355 15-19 21.075 27.71 29.275000000000002 21.94 20-24 20.94 29.549999999999997 27.62 21.89 25-29 21.3 29.189999999999998 27.775 21.735 30-34 21.43 29.220000000000002 27.785 21.565 35-39 21.64 29.354999999999997 27.834999999999997 21.17 40-44 21.029999999999998 28.99 27.944999999999997 22.035 45-49 21.404999999999998 28.58 27.944999999999997 22.07 50-54 21.41 28.945 27.839999999999996 21.805 55-59 21.265 29.235 27.605 21.895 60-64 21.07 28.705000000000002 27.839999999999996 22.384999999999998 65-69 21.495 29.160000000000004 28.065 21.279999999999998 70-74 21.715 28.994999999999997 27.62 21.67 75-79 21.88 28.18 27.950000000000003 21.990000000000002 80-84 21.404999999999998 29.020000000000003 28.13 21.445 85-89 21.584999999999997 29.099999999999998 27.345000000000002 21.97 90-94 21.805 28.375 28.38 21.44 95-99 21.575 28.765 27.755000000000003 21.905 100-104 21.4 28.044999999999998 28.225 22.33 105-109 22.335 28.54 27.955000000000002 21.17 110-114 22.17 28.335 27.88 21.615000000000002 115-119 21.884999999999998 29.14 27.644999999999996 21.33 120-124 22.095000000000002 28.34 27.975 21.59 125-129 22.06 28.294999999999998 27.57 22.075 130-134 22.439999999999998 28.194999999999997 28.249999999999996 21.115000000000002 135-139 22.925 27.775 28.384999999999998 20.915 140-144 23.685000000000002 28.405 28.74 19.17 145-149 22.655 28.76 28.04 20.544999999999998 150 23.849999999999998 28.499999999999996 32.175 15.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 2.5 16 3.5 17 3.0 18 2.5 19 3.5 20 3.0 21 4.0 22 4.5 23 4.5 24 9.5 25 10.0 26 10.0 27 12.0 28 15.5 29 23.5 30 31.0 31 40.5 32 53.0 33 69.0 34 88.0 35 102.5 36 123.0 37 146.5 38 166.5 39 200.0 40 213.0 41 203.5 42 208.0 43 242.0 44 253.5 45 230.0 46 212.5 47 195.5 48 187.5 49 168.0 50 130.5 51 101.0 52 87.0 53 78.5 54 69.0 55 53.0 56 46.0 57 41.0 58 25.0 59 16.0 60 12.0 61 11.0 62 12.5 63 12.0 64 8.0 65 7.0 66 8.0 67 6.0 68 4.0 69 2.5 70 2.0 71 2.5 72 3.0 73 2.5 74 2.0 75 1.5 76 1.0 77 1.0 78 0.5 79 1.0 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 39.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0775422591897 86.725 2 6.5736517306144355 12.25 3 0.29514354708881135 0.8250000000000001 4 0.053662463107056614 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2125 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 0.8375 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATGG 10 0.0070318864 143.6 3 GAGCAAA 10 0.0070318864 143.6 2 AATACTT 10 0.0070318864 143.6 2 >>END_MODULE Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232481 spots for SRR5933792.sra Written 1232481 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra Read 1232470 spots for SRR5933792.sra Written 1232470 spots for SRR5933792.sra SRR ids: ['SRR5933792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lbnm9mkr SRR5933792.sra spots: 24649411 blocks: [[1, 1232470], [1232471, 2464940], [2464941, 3697410], [3697411, 4929880], [4929881, 6162350], [6162351, 7394820], [7394821, 8627290], [8627291, 9859760], [9859761, 11092230], [11092231, 12324700], [12324701, 13557170], [13557171, 14789640], [14789641, 16022110], [16022111, 17254580], [17254581, 18487050], [18487051, 19719520], [19719521, 20951990], [20951991, 22184460], [22184461, 23416930], [23416931, 24649411]] SRR5933792 file size 8283032 SRR5933792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933792 SRR5933792_1.fastq SRR5933792_2.fastq Input file: SRR5933792_1.fastq Paired file: SRR5933792_2.fastq trimmed: SRR5933792-trimmed-pair1.fastq, SRR5933792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:10:52 2025 >> started Mon Feb 10 20:11:18 2025 >> done (26.744s) 24649411 read pairs processed; of these: 220 ( 0.00%) short read pairs filtered out after trimming by size control 67 ( 0.00%) empty read pairs filtered out after trimming by size control 24649124 (100.00%) read pairs available; of these: 1813569 ( 7.36%) trimmed read pairs available after processing 22835555 (92.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 45 0.00% 19 61 0.00% 20 63 0.00% 21 97 0.00% 22 124 0.00% 23 204 0.00% 24 200 0.00% 25 254 0.00% 26 288 0.00% 27 293 0.00% 28 311 0.00% 29 322 0.00% 30 368 0.00% 31 366 0.00% 32 386 0.00% 33 370 0.00% 34 393 0.00% 35 416 0.00% 36 392 0.00% 37 425 0.00% 38 446 0.00% 39 421 0.00% 40 434 0.00% 41 484 0.00% 42 439 0.00% 43 459 0.00% 44 448 0.00% 45 485 0.00% 46 455 0.00% 47 465 0.00% 48 469 0.00% 49 530 0.00% 50 523 0.00% 51 550 0.00% 52 563 0.00% 53 550 0.00% 54 485 0.00% 55 510 0.00% 56 524 0.00% 57 497 0.00% 58 512 0.00% 59 571 0.00% 60 531 0.00% 61 514 0.00% 62 522 0.00% 63 463 0.00% 64 544 0.00% 65 498 0.00% 66 516 0.00% 67 518 0.00% 68 523 0.00% 69 514 0.00% 70 581 0.00% 71 481 0.00% 72 480 0.00% 73 572 0.00% 74 543 0.00% 75 555 0.00% 76 540 0.00% 77 629 0.00% 78 581 0.00% 79 661 0.00% 80 624 0.00% 81 636 0.00% 82 636 0.00% 83 681 0.00% 84 709 0.00% 85 734 0.00% 86 780 0.00% 87 755 0.00% 88 798 0.00% 89 874 0.00% 90 943 0.00% 91 913 0.00% 92 1046 0.00% 93 1068 0.00% 94 1142 0.00% 95 1188 0.00% 96 1218 0.00% 97 1342 0.01% 98 1374 0.01% 99 1486 0.01% 100 1504 0.01% 101 1659 0.01% 102 1722 0.01% 103 2029 0.01% 104 1960 0.01% 105 2001 0.01% 106 2193 0.01% 107 2106 0.01% 108 2328 0.01% 109 2503 0.01% 110 2548 0.01% 111 2719 0.01% 112 2789 0.01% 113 2976 0.01% 114 3161 0.01% 115 3477 0.01% 116 3534 0.01% 117 3573 0.01% 118 3798 0.02% 119 3954 0.02% 120 4270 0.02% 121 4348 0.02% 122 4493 0.02% 123 4927 0.02% 124 5262 0.02% 125 5241 0.02% 126 5488 0.02% 127 5703 0.02% 128 6056 0.02% 129 6275 0.03% 130 6680 0.03% 131 6897 0.03% 132 7247 0.03% 133 7493 0.03% 134 7867 0.03% 135 7971 0.03% 136 8825 0.04% 137 9061 0.04% 138 9358 0.04% 139 9565 0.04% 140 9925 0.04% 141 10521 0.04% 142 11250 0.05% 143 11859 0.05% 144 12696 0.05% 145 14200 0.06% 146 19107 0.08% 147 38914 0.16% 148 147110 0.60% 149 1306515 5.30% 150 22835555 92.64% 24649124 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=18 prefix-density=0.26 prefix-fanout=2.9 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=13.43 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.6 sequence=AAGGCCAAGATCCAGGACAAGGA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.0 sequence=CAAGGTAAGAGTTCATGGCCAGAGCTTCTTGGAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=16.53 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.2 sequence=CCAACAAAGCAGT SRR5933792 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:12:57 Started mapping on | Feb 10 20:12:57 Finished on | Feb 10 20:21:14 Mapping speed, Million of reads per hour | 178.54 Number of input reads | 24649124 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 17663140 Uniquely mapped reads % | 71.66% Average mapped length | 276.41 Number of splices: Total | 12896129 Number of splices: Annotated (sjdb) | 12225098 Number of splices: GT/AG | 12546962 Number of splices: GC/AG | 160529 Number of splices: AT/AC | 8658 Number of splices: Non-canonical | 179980 Mismatch rate per base, % | 2.31% Deletion rate per base | 0.15% Deletion average length | 3.27 Insertion rate per base | 0.10% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1546699 % of reads mapped to multiple loci | 6.27% Number of reads mapped to too many loci | 29325 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.39% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5439285 5439285 5439285 N_multimapping 1546699 1546699 1546699 N_noFeature 610925 9090652 9073889 N_ambiguous 408444 149570 152558 UnstrandedReadsAssigned:16643771 PositiveStrandReadsAssigned:8422918 NegativeStrandReadsAssigned:8436693 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR5933792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933792-trimmed-pair1.fastq SRR5933792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,649,124 reads, 17,653,348 reads pseudoaligned [quant] estimated average fragment length: 240.424 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR5933792.ke.tsv 34699 SRR5933792.se.tsv 87100 total ==> SRR5933792.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.58 4237.37 114.296 Potri.005G024800.1.v4.1 1035 795.576 2129 128.381 Potri.004G059700.1.v4.1 961 721.587 2 0.132968 Potri.007G009000.2.v4.1 1416 1176.58 0 0 Potri.003G141000.2.v4.1 2943 2703.58 493.233 8.75224 Potri.016G087400.1.v4.1 270 56.3069 261.397 222.712 Potri.015G069301.1.v4.1 564 324.738 0 0 Potri.010G195200.1.v4.1 1773 1533.58 455 14.2335 Potri.012G127500.1.v4.1 977 737.582 2218 144.264 ==> SRR5933792.se.tsv <== Potri.001G166300.v4.1 9 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 27 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 12 Potri.001G452600.v4.1 491 SRR5933792 completed mapping pipeline successfully