Starting /dee2/code/volunteer_pipeline.sh SRR5933793 current disk space = 3056520568832 free memory = 1209951364 SRR5933793 SRAfilesize b8511709c06db93af642ab9e01844cea SRR5933793.sra SRR5933793.sra file validated SRR5933793 is paired end SRR5933793 is conventional basespace SRR5933793 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.33375 32.0 2.0 32.0 2.0 32.0 2 27.68375 32.0 27.0 32.0 12.0 32.0 3 33.37375 32.0 32.0 37.0 32.0 37.0 4 35.95875 37.0 37.0 37.0 32.0 37.0 5 35.93 37.0 37.0 37.0 32.0 37.0 6 39.3735 41.0 41.0 41.0 37.0 41.0 7 39.5525 41.0 41.0 41.0 37.0 41.0 8 39.88925 41.0 41.0 41.0 37.0 41.0 9 40.0545 41.0 41.0 41.0 37.0 41.0 10-14 39.964549999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.92915 41.0 41.0 41.0 37.0 41.0 20-24 39.84285 41.0 41.0 41.0 37.0 41.0 25-29 39.374050000000004 41.0 41.0 41.0 36.0 41.0 30-34 39.6727 41.0 41.0 41.0 37.0 41.0 35-39 39.28305 41.0 41.0 41.0 37.0 41.0 40-44 39.4052 41.0 41.0 41.0 36.0 41.0 45-49 39.4357 41.0 41.0 41.0 37.0 41.0 50-54 39.04065 41.0 40.2 41.0 35.0 41.0 55-59 38.788650000000004 41.0 40.2 41.0 34.0 41.0 60-64 39.23485 41.0 41.0 41.0 35.0 41.0 65-69 39.1825 41.0 41.0 41.0 36.0 41.0 70-74 39.23685 41.0 41.0 41.0 37.0 41.0 75-79 38.82275 41.0 39.4 41.0 33.0 41.0 80-84 38.8617 41.0 40.2 41.0 34.0 41.0 85-89 38.584649999999996 41.0 38.6 41.0 34.0 41.0 90-94 38.85865 41.0 40.2 41.0 33.0 41.0 95-99 39.00755 41.0 41.0 41.0 36.0 41.0 100-104 38.62055 41.0 40.2 41.0 32.0 41.0 105-109 38.6997 41.0 40.2 41.0 33.0 41.0 110-114 38.388099999999994 41.0 37.8 41.0 32.0 41.0 115-119 37.4058 41.0 36.0 41.0 29.0 41.0 120-124 36.53945 40.2 36.0 41.0 24.0 41.0 125-129 34.606399999999994 38.6 32.0 41.0 18.0 41.0 130-134 34.93255 39.4 33.0 41.0 19.0 41.0 135-139 33.737649999999995 38.6 29.0 41.0 16.0 41.0 140-144 33.9182 39.4 29.0 41.0 19.0 41.0 145-149 29.160450000000004 32.0 21.0 38.4 12.0 40.2 150 29.264 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 4.0 23 4.0 24 4.0 25 8.0 26 17.0 27 21.0 28 34.0 29 45.0 30 58.0 31 66.0 32 86.0 33 127.0 34 160.0 35 214.0 36 267.0 37 409.0 38 637.0 39 1113.0 40 725.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.573826947912185 17.477399913904435 19.801980198019802 33.146792940163586 2 25.6 26.974999999999998 34.475 12.950000000000001 3 22.6 31.275 25.5 20.625 4 23.674999999999997 36.725 20.3 19.3 5 22.725 38.574999999999996 22.3 16.400000000000002 6 15.75 40.300000000000004 24.45 19.5 7 16.85 16.825000000000003 45.0 21.325 8 19.6 23.025000000000002 29.025000000000002 28.349999999999998 9 20.7 22.675 27.975 28.65 10-14 20.419999999999998 31.235000000000003 27.275 21.07 15-19 21.215 28.610000000000003 28.21 21.965 20-24 21.27 29.865000000000002 27.089999999999996 21.775 25-29 21.175 29.435 27.555000000000003 21.834999999999997 30-34 20.605 29.195 28.34 21.86 35-39 21.310000000000002 29.509999999999998 27.32 21.86 40-44 21.825 28.415000000000003 28.194999999999997 21.565 45-49 21.325 28.74 28.4 21.535 50-54 21.17 29.360000000000003 27.98 21.490000000000002 55-59 20.979999999999997 29.505 28.005000000000003 21.51 60-64 21.375 28.794999999999998 28.165000000000003 21.665 65-69 21.645 28.62 28.455000000000002 21.279999999999998 70-74 21.815 28.565 28.000000000000004 21.62 75-79 21.48 28.62 27.74 22.16 80-84 21.654999999999998 29.2 27.83 21.315 85-89 21.59 28.835 27.534999999999997 22.040000000000003 90-94 21.215 28.92 27.839999999999996 22.025 95-99 21.47 28.285 28.28 21.965 100-104 21.68 28.9 27.855 21.565 105-109 21.105 29.18 28.17 21.545 110-114 21.46 28.904999999999998 28.04 21.595 115-119 21.755 28.549999999999997 28.155 21.54 120-124 22.1 27.74 28.465 21.695 125-129 21.52 28.475 28.675 21.33 130-134 21.555 28.810000000000002 27.66 21.975 135-139 21.68 28.76 28.415000000000003 21.145 140-144 21.815 28.165000000000003 28.54 21.48 145-149 21.529999999999998 28.685 29.34 20.445 150 20.45 29.475 28.625 21.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 1.5 17 3.5 18 4.5 19 6.0 20 6.0 21 4.5 22 4.0 23 5.5 24 6.0 25 9.5 26 11.5 27 11.0 28 18.0 29 25.0 30 31.5 31 45.0 32 59.5 33 72.0 34 94.5 35 102.5 36 126.0 37 146.5 38 165.5 39 188.0 40 185.5 41 214.0 42 238.0 43 241.0 44 243.0 45 231.0 46 223.5 47 208.5 48 184.5 49 155.0 50 128.5 51 115.5 52 94.0 53 77.0 54 56.5 55 45.0 56 39.5 57 30.0 58 26.0 59 19.0 60 16.5 61 17.5 62 14.0 63 8.5 64 5.0 65 6.5 66 6.5 67 4.5 68 4.5 69 3.0 70 2.0 71 1.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 41.925000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24396782841823 86.95 2 6.3002680965147455 11.75 3 0.42895442359249336 1.2 4 0.026809651474530835 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.3625 0.0 0.0 0.0 0.0 130-131 0.44999999999999996 0.0 0.0 0.0 0.0 132-133 0.4875 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAATT 10 0.0070355474 143.57501 7 CTGAAGG 10 0.0070355474 143.57501 7 TTCCACC 10 0.0070355474 143.57501 7 >>END_MODULE SRR5933793 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.655 32.0 2.0 32.0 2.0 32.0 2 30.9 32.0 32.0 32.0 32.0 32.0 3 33.0075 32.0 32.0 37.0 32.0 37.0 4 34.45375 37.0 32.0 37.0 32.0 37.0 5 35.21375 37.0 37.0 37.0 32.0 37.0 6 37.48975 41.0 37.0 41.0 32.0 41.0 7 36.00625 41.0 37.0 41.0 22.0 41.0 8 39.02575 41.0 37.0 41.0 37.0 41.0 9 39.1865 41.0 41.0 41.0 37.0 41.0 10-14 39.1743 41.0 41.0 41.0 36.0 41.0 15-19 39.0154 41.0 40.2 41.0 34.0 41.0 20-24 38.58535 41.0 39.4 41.0 33.0 41.0 25-29 38.23795 41.0 37.8 41.0 32.0 41.0 30-34 38.317750000000004 41.0 38.6 41.0 32.0 41.0 35-39 38.05095 41.0 37.8 41.0 31.0 41.0 40-44 39.0227 41.0 40.2 41.0 35.0 41.0 45-49 39.25455 41.0 41.0 41.0 37.0 41.0 50-54 38.83225 41.0 41.0 41.0 35.0 41.0 55-59 38.30485 41.0 37.8 41.0 32.0 41.0 60-64 37.70855 41.0 37.0 41.0 30.0 41.0 65-69 36.2661 41.0 37.0 41.0 23.0 41.0 70-74 36.47345 41.0 36.0 41.0 26.0 41.0 75-79 36.49535 40.2 35.0 41.0 26.0 41.0 80-84 36.227700000000006 41.0 35.0 41.0 24.0 41.0 85-89 35.8348 41.0 35.0 41.0 23.0 41.0 90-94 34.27610000000001 37.8 30.0 41.0 18.0 41.0 95-99 34.785199999999996 37.0 32.0 41.0 18.0 41.0 100-104 35.443 37.8 34.0 41.0 23.0 41.0 105-109 33.79275 37.0 31.0 41.0 14.0 41.0 110-114 33.8346 37.0 30.0 41.0 18.0 41.0 115-119 31.570450000000005 35.0 26.0 41.0 12.0 41.0 120-124 29.699149999999996 32.0 22.0 38.6 12.0 41.0 125-129 29.790700000000005 33.0 23.0 40.2 12.0 41.0 130-134 27.405899999999995 30.0 18.0 37.0 12.0 41.0 135-139 23.98115 25.0 12.0 34.0 12.0 38.6 140-144 21.083000000000006 17.0 12.0 29.0 11.2 37.8 145-149 21.642950000000003 20.0 12.0 29.0 11.2 36.0 150 18.25125 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 5.0 19 4.0 20 5.0 21 16.0 22 23.0 23 35.0 24 38.0 25 72.0 26 83.0 27 82.0 28 98.0 29 133.0 30 184.0 31 206.0 32 257.0 33 326.0 34 335.0 35 446.0 36 472.0 37 508.0 38 425.0 39 221.0 40 24.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.570480928689882 16.625207296849087 20.398009950248756 35.40630182421227 2 25.825 26.474999999999998 32.975 14.725 3 23.3 30.525000000000002 25.1 21.075 4 23.75 35.975 20.75 19.525000000000002 5 23.849999999999998 38.1 22.5 15.55 6 16.35 38.975 25.5 19.175 7 15.825 16.925 45.975 21.275 8 19.975 21.4 29.575000000000003 29.049999999999997 9 21.099999999999998 22.425 29.5 26.974999999999998 10-14 20.705000000000002 30.225 28.12 20.95 15-19 21.32 28.000000000000004 29.145 21.535 20-24 21.425 29.575000000000003 28.110000000000003 20.89 25-29 20.94 29.75 28.585 20.724999999999998 30-34 21.16 29.665000000000003 28.000000000000004 21.175 35-39 20.96 29.095 28.345 21.6 40-44 20.91 28.48 28.549999999999997 22.06 45-49 21.345 28.349999999999998 28.93 21.375 50-54 21.715 29.185 28.075 21.025 55-59 21.69 29.04 27.650000000000002 21.62 60-64 21.4 28.845 28.084999999999997 21.67 65-69 21.560000000000002 29.409999999999997 28.050000000000004 20.979999999999997 70-74 21.65 29.01 27.775 21.565 75-79 21.475 28.735 28.255000000000003 21.535 80-84 21.759999999999998 28.49 28.82 20.93 85-89 21.51 28.610000000000003 27.889999999999997 21.990000000000002 90-94 21.41 29.054999999999996 28.470000000000002 21.065 95-99 22.1 28.99 28.244999999999997 20.665 100-104 21.709999999999997 28.660000000000004 28.51 21.12 105-109 21.72 29.104999999999997 27.935 21.240000000000002 110-114 21.68 29.415000000000003 27.425 21.48 115-119 21.58 29.5 28.060000000000002 20.86 120-124 21.815 28.305000000000003 28.98 20.9 125-129 21.69 28.884999999999998 28.825 20.599999999999998 130-134 22.29 28.970000000000002 28.415000000000003 20.325 135-139 22.43 28.68 28.54 20.349999999999998 140-144 23.544999999999998 28.21 29.32 18.925 145-149 22.189999999999998 28.77 29.275000000000002 19.765 150 25.35 27.875 32.300000000000004 14.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 2.5 17 3.5 18 1.5 19 1.0 20 1.5 21 3.0 22 5.0 23 4.5 24 10.5 25 13.5 26 15.5 27 22.0 28 23.0 29 31.5 30 47.0 31 53.5 32 62.0 33 66.5 34 76.5 35 95.0 36 106.0 37 137.0 38 170.5 39 191.5 40 211.0 41 222.5 42 232.5 43 250.0 44 271.0 45 255.5 46 221.0 47 193.5 48 161.0 49 153.5 50 129.5 51 94.0 52 83.5 53 70.0 54 63.0 55 51.0 56 34.5 57 30.5 58 22.5 59 17.0 60 15.0 61 9.5 62 8.5 63 10.0 64 8.0 65 6.5 66 7.0 67 4.5 68 2.5 69 1.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 1.0 76 1.0 77 1.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 39.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15515409139213 88.6 2 5.446333687566419 10.25 3 0.37194473963868224 1.05 4 0.026567481402763018 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.45 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.6625000000000001 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAATT 10 0.0070282277 143.625 8 ATGTGGA 10 0.0070282277 143.625 5 TGTGGAC 10 0.0070282277 143.625 6 >>END_MODULE Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146051 spots for SRR5933793.sra Written 1146051 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra Read 1146036 spots for SRR5933793.sra Written 1146036 spots for SRR5933793.sra SRR ids: ['SRR5933793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d04q802g SRR5933793.sra spots: 22920735 blocks: [[1, 1146036], [1146037, 2292072], [2292073, 3438108], [3438109, 4584144], [4584145, 5730180], [5730181, 6876216], [6876217, 8022252], [8022253, 9168288], [9168289, 10314324], [10314325, 11460360], [11460361, 12606396], [12606397, 13752432], [13752433, 14898468], [14898469, 16044504], [16044505, 17190540], [17190541, 18336576], [18336577, 19482612], [19482613, 20628648], [20628649, 21774684], [21774685, 22920735]] SRR5933793 file size 7700617 SRR5933793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933793 SRR5933793_1.fastq SRR5933793_2.fastq Input file: SRR5933793_1.fastq Paired file: SRR5933793_2.fastq trimmed: SRR5933793-trimmed-pair1.fastq, SRR5933793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:48:44 2025 >> started Mon Feb 10 19:49:09 2025 >> done (25.523s) 22920735 read pairs processed; of these: 238 ( 0.00%) short read pairs filtered out after trimming by size control 68 ( 0.00%) empty read pairs filtered out after trimming by size control 22920429 (100.00%) read pairs available; of these: 1537758 ( 6.71%) trimmed read pairs available after processing 21382671 (93.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 49 0.00% 20 88 0.00% 21 124 0.00% 22 145 0.00% 23 194 0.00% 24 232 0.00% 25 278 0.00% 26 298 0.00% 27 291 0.00% 28 340 0.00% 29 346 0.00% 30 369 0.00% 31 388 0.00% 32 402 0.00% 33 400 0.00% 34 433 0.00% 35 429 0.00% 36 420 0.00% 37 467 0.00% 38 465 0.00% 39 430 0.00% 40 463 0.00% 41 488 0.00% 42 456 0.00% 43 473 0.00% 44 558 0.00% 45 464 0.00% 46 502 0.00% 47 553 0.00% 48 506 0.00% 49 519 0.00% 50 572 0.00% 51 511 0.00% 52 494 0.00% 53 533 0.00% 54 521 0.00% 55 536 0.00% 56 532 0.00% 57 479 0.00% 58 540 0.00% 59 550 0.00% 60 574 0.00% 61 496 0.00% 62 544 0.00% 63 496 0.00% 64 499 0.00% 65 531 0.00% 66 527 0.00% 67 539 0.00% 68 537 0.00% 69 505 0.00% 70 493 0.00% 71 538 0.00% 72 555 0.00% 73 546 0.00% 74 537 0.00% 75 527 0.00% 76 567 0.00% 77 595 0.00% 78 578 0.00% 79 689 0.00% 80 608 0.00% 81 591 0.00% 82 633 0.00% 83 683 0.00% 84 718 0.00% 85 788 0.00% 86 739 0.00% 87 780 0.00% 88 774 0.00% 89 810 0.00% 90 914 0.00% 91 945 0.00% 92 1037 0.00% 93 1122 0.00% 94 1050 0.00% 95 1096 0.00% 96 1173 0.01% 97 1190 0.01% 98 1273 0.01% 99 1352 0.01% 100 1508 0.01% 101 1456 0.01% 102 1598 0.01% 103 1581 0.01% 104 1669 0.01% 105 1725 0.01% 106 1803 0.01% 107 1915 0.01% 108 1967 0.01% 109 2064 0.01% 110 2162 0.01% 111 2208 0.01% 112 2326 0.01% 113 2462 0.01% 114 2694 0.01% 115 2810 0.01% 116 2733 0.01% 117 3039 0.01% 118 3045 0.01% 119 3116 0.01% 120 3264 0.01% 121 3484 0.02% 122 3553 0.02% 123 3753 0.02% 124 4072 0.02% 125 4124 0.02% 126 4404 0.02% 127 4554 0.02% 128 4718 0.02% 129 4890 0.02% 130 5050 0.02% 131 5424 0.02% 132 5585 0.02% 133 6000 0.03% 134 6071 0.03% 135 6460 0.03% 136 6659 0.03% 137 6986 0.03% 138 7319 0.03% 139 7403 0.03% 140 7847 0.03% 141 8258 0.04% 142 8574 0.04% 143 9344 0.04% 144 9759 0.04% 145 11201 0.05% 146 15114 0.07% 147 31245 0.14% 148 120360 0.53% 149 1122369 4.90% 150 21382671 93.29% 22920429 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=1.9 sequence=CAAGGTAAGAGTTCATGGCCAGAGCTTCTTGGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=16.88 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.9 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=3.1 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=16.94 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.5 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC SRR5933793 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:50:22 Started mapping on | Feb 10 19:50:22 Finished on | Feb 10 20:03:44 Mapping speed, Million of reads per hour | 102.88 Number of input reads | 22920429 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15907484 Uniquely mapped reads % | 69.40% Average mapped length | 287.04 Number of splices: Total | 11388330 Number of splices: Annotated (sjdb) | 10669734 Number of splices: GT/AG | 11064179 Number of splices: GC/AG | 139582 Number of splices: AT/AC | 7579 Number of splices: Non-canonical | 176990 Mismatch rate per base, % | 2.28% Deletion rate per base | 0.16% Deletion average length | 3.28 Insertion rate per base | 0.10% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1512586 % of reads mapped to multiple loci | 6.60% Number of reads mapped to too many loci | 22396 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.40% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5500359 5500359 5500359 N_multimapping 1512586 1512586 1512586 N_noFeature 578349 8195487 8185282 N_ambiguous 358121 127135 129238 UnstrandedReadsAssigned:14971014 PositiveStrandReadsAssigned:7584862 NegativeStrandReadsAssigned:7592964 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933793-trimmed-pair1.fastq SRR5933793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,920,429 reads, 15,691,253 reads pseudoaligned [quant] estimated average fragment length: 252.99 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR5933793.ke.tsv 34699 SRR5933793.se.tsv 87100 total ==> SRR5933793.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.01 4705.94 146.675 Potri.005G024800.1.v4.1 1035 783.01 1679 118.028 Potri.004G059700.1.v4.1 961 709.039 4 0.310522 Potri.007G009000.2.v4.1 1416 1164.01 0 0 Potri.003G141000.2.v4.1 2943 2691.01 536.287 10.9694 Potri.016G087400.1.v4.1 270 49.3574 256.395 285.93 Potri.015G069301.1.v4.1 564 312.276 0 0 Potri.010G195200.1.v4.1 1773 1521.01 321 11.6165 Potri.012G127500.1.v4.1 977 725.016 1864 141.514 ==> SRR5933793.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 24 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 20 Potri.001G452600.v4.1 730 SRR5933793 completed mapping pipeline successfully