Starting /dee2/code/volunteer_pipeline.sh SRR5933794 current disk space = 3056265650176 free memory = 1181641840 SRR5933794 SRAfilesize 0b2615cd2ee359ee0b1c693a3789745d SRR5933794.sra SRR5933794.sra file validated SRR5933794 is paired end SRR5933794 is conventional basespace SRR5933794 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.75875 32.0 2.0 32.0 2.0 32.0 2 27.6725 32.0 27.0 32.0 12.0 32.0 3 33.1775 32.0 32.0 37.0 32.0 37.0 4 35.95125 37.0 37.0 37.0 32.0 37.0 5 35.8875 37.0 37.0 37.0 32.0 37.0 6 39.2545 41.0 41.0 41.0 37.0 41.0 7 39.509 41.0 41.0 41.0 37.0 41.0 8 39.837 41.0 41.0 41.0 37.0 41.0 9 39.96875 41.0 41.0 41.0 37.0 41.0 10-14 39.885949999999994 41.0 41.0 41.0 37.0 41.0 15-19 39.8766 41.0 41.0 41.0 37.0 41.0 20-24 39.786950000000004 41.0 41.0 41.0 37.0 41.0 25-29 39.4001 41.0 41.0 41.0 37.0 41.0 30-34 39.66459999999999 41.0 41.0 41.0 37.0 41.0 35-39 39.30915 41.0 41.0 41.0 37.0 41.0 40-44 39.47825 41.0 41.0 41.0 37.0 41.0 45-49 39.4409 41.0 41.0 41.0 37.0 41.0 50-54 39.10850000000001 41.0 41.0 41.0 35.0 41.0 55-59 38.80884999999999 41.0 40.2 41.0 34.0 41.0 60-64 39.25835 41.0 41.0 41.0 36.0 41.0 65-69 39.20825 41.0 41.0 41.0 36.0 41.0 70-74 39.30415 41.0 41.0 41.0 37.0 41.0 75-79 38.90235 41.0 39.4 41.0 34.0 41.0 80-84 38.9183 41.0 40.2 41.0 35.0 41.0 85-89 38.61815 41.0 39.4 41.0 34.0 41.0 90-94 38.87955 41.0 40.2 41.0 35.0 41.0 95-99 38.9629 41.0 41.0 41.0 35.0 41.0 100-104 38.6572 41.0 40.2 41.0 34.0 41.0 105-109 38.81415 41.0 40.2 41.0 34.0 41.0 110-114 38.44435 41.0 37.8 41.0 32.0 41.0 115-119 37.50135 41.0 36.0 41.0 29.0 41.0 120-124 36.71355 40.2 36.0 41.0 28.0 41.0 125-129 34.727999999999994 39.4 32.0 41.0 18.0 41.0 130-134 35.016949999999994 39.4 34.0 41.0 19.0 41.0 135-139 33.77535 38.6 30.0 41.0 16.0 41.0 140-144 34.05145 39.4 30.0 41.0 19.0 41.0 145-149 29.3633 32.0 21.0 38.4 12.0 41.0 150 29.163 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 1.0 23 2.0 24 5.0 25 16.0 26 11.0 27 18.0 28 31.0 29 45.0 30 50.0 31 67.0 32 96.0 33 123.0 34 163.0 35 195.0 36 284.0 37 395.0 38 643.0 39 1106.0 40 746.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.775320654577623 16.585581601061477 20.610349402919063 35.02874834144184 2 25.4 26.224999999999998 34.875 13.5 3 21.85 30.325000000000003 26.8 21.025 4 24.175 34.925 21.15 19.75 5 23.7 37.9 21.5 16.900000000000002 6 17.4 39.825 25.324999999999996 17.45 7 15.6 16.400000000000002 45.35 22.650000000000002 8 19.1 22.775000000000002 29.349999999999998 28.775000000000002 9 20.150000000000002 23.45 29.475 26.924999999999997 10-14 20.294999999999998 31.115 27.54 21.05 15-19 21.17 28.754999999999995 28.215 21.86 20-24 20.965 29.025000000000002 28.205000000000002 21.805 25-29 20.835 28.720000000000002 28.63 21.815 30-34 20.880000000000003 28.785 28.53 21.805 35-39 20.97 29.12 28.925 20.985 40-44 21.584999999999997 28.93 28.389999999999997 21.095 45-49 20.810000000000002 28.860000000000003 28.744999999999997 21.584999999999997 50-54 21.515 28.825 27.99 21.67 55-59 22.05 28.494999999999997 28.09 21.365000000000002 60-64 21.755 28.01 28.82 21.415 65-69 21.75 29.26 27.83 21.16 70-74 21.495 29.025000000000002 27.694999999999997 21.785 75-79 21.69 28.235 27.93 22.145 80-84 21.43 29.01 27.750000000000004 21.81 85-89 22.11 28.18 28.08 21.63 90-94 21.795 28.78 28.015 21.41 95-99 21.54 28.415000000000003 28.21 21.834999999999997 100-104 21.759999999999998 28.499999999999996 28.105000000000004 21.634999999999998 105-109 21.895 28.27 27.889999999999997 21.945 110-114 21.65 28.360000000000003 28.275 21.715 115-119 21.865000000000002 28.73 28.255000000000003 21.15 120-124 21.695 29.054999999999996 27.71 21.54 125-129 21.2 28.199999999999996 29.09 21.51 130-134 22.09 27.79 28.634999999999998 21.485000000000003 135-139 21.560000000000002 27.975 29.225 21.240000000000002 140-144 21.54 27.944999999999997 28.965000000000003 21.55 145-149 21.73 28.38 29.515 20.375 150 21.099999999999998 28.299999999999997 29.725 20.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.5 14 1.0 15 1.0 16 2.0 17 4.0 18 4.5 19 5.0 20 5.0 21 3.0 22 5.0 23 6.0 24 7.0 25 8.0 26 13.0 27 18.0 28 21.0 29 30.0 30 37.0 31 42.5 32 43.0 33 58.5 34 69.5 35 80.0 36 111.0 37 134.0 38 151.5 39 175.0 40 212.5 41 254.0 42 271.5 43 252.5 44 246.0 45 248.0 46 238.5 47 216.5 48 191.0 49 162.0 50 127.0 51 115.0 52 95.0 53 70.5 54 56.0 55 44.5 56 37.0 57 27.5 58 16.5 59 14.5 60 15.0 61 11.0 62 8.5 63 4.5 64 3.0 65 4.5 66 4.5 67 3.5 68 3.5 69 1.5 70 0.5 71 0.5 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 43.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.04884594739667 86.675 2 6.5485775630703165 12.2 3 0.40257648953301123 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.2625 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.675 0.0 0.0 0.0 0.0 136-137 0.7 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGGA 10 0.0070392117 143.55 9 CATCCAG 10 0.0070392117 143.55 5 AGAGACA 10 0.0070392117 143.55 6 GTTTGTG 20 0.009071707 130.5 1 >>END_MODULE SRR5933794 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.2925 32.0 2.0 32.0 2.0 32.0 2 30.64625 32.0 32.0 32.0 27.0 32.0 3 33.2225 32.0 32.0 37.0 32.0 37.0 4 34.65125 37.0 32.0 37.0 32.0 37.0 5 35.22125 37.0 37.0 37.0 32.0 37.0 6 37.4875 41.0 37.0 41.0 32.0 41.0 7 35.978 41.0 37.0 41.0 22.0 41.0 8 39.02075 41.0 41.0 41.0 37.0 41.0 9 39.21125 41.0 41.0 41.0 37.0 41.0 10-14 39.22245 41.0 41.0 41.0 36.0 41.0 15-19 39.0479 41.0 41.0 41.0 35.0 41.0 20-24 38.61645 41.0 40.2 41.0 33.0 41.0 25-29 38.3164 41.0 38.6 41.0 33.0 41.0 30-34 38.32255000000001 41.0 38.6 41.0 33.0 41.0 35-39 38.363350000000004 41.0 38.6 41.0 32.0 41.0 40-44 39.190349999999995 41.0 41.0 41.0 36.0 41.0 45-49 39.311 41.0 41.0 41.0 37.0 41.0 50-54 38.9085 41.0 41.0 41.0 34.0 41.0 55-59 38.29595 41.0 38.6 41.0 32.0 41.0 60-64 37.830949999999994 41.0 37.0 41.0 30.0 41.0 65-69 36.40675 41.0 37.0 41.0 24.0 41.0 70-74 36.626850000000005 41.0 36.0 41.0 25.0 41.0 75-79 36.7124 40.2 35.0 41.0 26.0 41.0 80-84 36.399100000000004 41.0 35.0 41.0 25.0 41.0 85-89 35.8383 41.0 34.0 41.0 24.0 41.0 90-94 34.47439999999999 38.6 31.0 41.0 18.0 41.0 95-99 34.81685 38.6 33.0 41.0 21.0 41.0 100-104 35.4578 38.6 34.0 41.0 23.0 41.0 105-109 33.9042 37.0 31.0 41.0 16.0 41.0 110-114 33.83200000000001 37.0 30.0 41.0 18.0 41.0 115-119 31.494049999999998 35.0 26.0 41.0 12.0 41.0 120-124 29.771949999999997 33.0 22.0 38.6 12.0 41.0 125-129 29.80775 32.0 23.0 40.2 12.0 41.0 130-134 27.51 30.0 18.0 37.0 12.0 41.0 135-139 24.07455 25.0 12.0 33.0 12.0 38.6 140-144 20.9959 17.0 12.0 29.0 10.4 37.8 145-149 21.5406 20.0 12.0 29.0 11.2 36.0 150 18.2295 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 6.0 19 7.0 20 9.0 21 21.0 22 24.0 23 27.0 24 39.0 25 42.0 26 73.0 27 84.0 28 99.0 29 131.0 30 165.0 31 210.0 32 276.0 33 306.0 34 396.0 35 402.0 36 485.0 37 516.0 38 452.0 39 201.0 40 25.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.905004240882104 18.278201865988127 20.949957591178965 32.866836301950805 2 23.599999999999998 25.75 35.525 15.125 3 21.825 29.875 27.800000000000004 20.5 4 23.225 34.699999999999996 21.675 20.4 5 23.724999999999998 36.775000000000006 22.55 16.950000000000003 6 16.125 40.699999999999996 22.625 20.549999999999997 7 16.2 17.8 43.4 22.6 8 18.3 22.85 29.65 29.2 9 20.5 23.7 28.025 27.775 10-14 19.900000000000002 30.755 27.815 21.529999999999998 15-19 21.195 28.275 28.605000000000004 21.925 20-24 20.669999999999998 29.744999999999997 28.125 21.46 25-29 21.365000000000002 29.599999999999998 27.99 21.044999999999998 30-34 20.71 29.459999999999997 28.68 21.15 35-39 20.349999999999998 29.82 27.98 21.85 40-44 21.505 28.744999999999997 27.875 21.875 45-49 20.26 28.444999999999997 28.884999999999998 22.41 50-54 21.355 29.01 28.055000000000003 21.58 55-59 21.310000000000002 29.53 27.794999999999998 21.365000000000002 60-64 21.275 29.265 28.335 21.125 65-69 21.075 29.82 27.715 21.39 70-74 21.41 28.975 27.825 21.790000000000003 75-79 21.060000000000002 29.054999999999996 28.13 21.755 80-84 21.45 29.330000000000002 27.625 21.595 85-89 21.555 29.24 28.139999999999997 21.065 90-94 21.63 29.07 28.435 20.865000000000002 95-99 22.06 28.935 27.76 21.245 100-104 22.13 28.904999999999998 27.395000000000003 21.57 105-109 21.385 28.955 28.355000000000004 21.305 110-114 21.59 29.25 27.779999999999998 21.38 115-119 21.985 29.43 27.685 20.9 120-124 21.44 29.110000000000003 28.26 21.19 125-129 21.759999999999998 29.39 27.805000000000003 21.044999999999998 130-134 22.455 28.78 27.905 20.86 135-139 23.03 28.310000000000002 28.18 20.48 140-144 23.195 28.305000000000003 28.76 19.74 145-149 21.945 28.825 28.965000000000003 20.265 150 23.849999999999998 28.95 32.65 14.549999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 2.0 12 2.0 13 0.0 14 2.0 15 2.0 16 1.5 17 2.5 18 3.5 19 4.5 20 3.0 21 4.5 22 6.5 23 7.5 24 7.0 25 7.0 26 12.0 27 17.0 28 16.5 29 25.0 30 38.0 31 43.0 32 55.0 33 68.0 34 90.0 35 107.5 36 123.0 37 154.0 38 161.0 39 190.0 40 231.5 41 238.5 42 236.0 43 225.0 44 233.0 45 238.0 46 230.0 47 217.0 48 178.5 49 147.0 50 134.5 51 118.5 52 94.5 53 67.0 54 50.5 55 46.5 56 33.0 57 22.5 58 21.5 59 17.5 60 13.5 61 11.0 62 6.0 63 3.5 64 6.0 65 5.5 66 5.0 67 4.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 41.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.81992541289291 88.05 2 5.8071390516782095 10.9 3 0.37293553542887586 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGACA 10 0.007030057 143.6125 8 CTGAGAC 10 0.007030057 143.6125 7 AACCCTG 10 0.007030057 143.6125 3 >>END_MODULE Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208817 spots for SRR5933794.sra Written 1208817 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra Read 1208808 spots for SRR5933794.sra Written 1208808 spots for SRR5933794.sra SRR ids: ['SRR5933794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qz20198x SRR5933794.sra spots: 24176169 blocks: [[1, 1208808], [1208809, 2417616], [2417617, 3626424], [3626425, 4835232], [4835233, 6044040], [6044041, 7252848], [7252849, 8461656], [8461657, 9670464], [9670465, 10879272], [10879273, 12088080], [12088081, 13296888], [13296889, 14505696], [14505697, 15714504], [15714505, 16923312], [16923313, 18132120], [18132121, 19340928], [19340929, 20549736], [20549737, 21758544], [21758545, 22967352], [22967353, 24176169]] SRR5933794 file size 8123590 SRR5933794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933794 SRR5933794_1.fastq SRR5933794_2.fastq Input file: SRR5933794_1.fastq Paired file: SRR5933794_2.fastq trimmed: SRR5933794-trimmed-pair1.fastq, SRR5933794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:15:41 2025 >> started Mon Feb 10 20:16:14 2025 >> done (33.508s) 24176169 read pairs processed; of these: 231 ( 0.00%) short read pairs filtered out after trimming by size control 74 ( 0.00%) empty read pairs filtered out after trimming by size control 24175864 (100.00%) read pairs available; of these: 1624841 ( 6.72%) trimmed read pairs available after processing 22551023 (93.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 57 0.00% 19 57 0.00% 20 77 0.00% 21 92 0.00% 22 150 0.00% 23 151 0.00% 24 202 0.00% 25 231 0.00% 26 247 0.00% 27 262 0.00% 28 295 0.00% 29 276 0.00% 30 341 0.00% 31 346 0.00% 32 354 0.00% 33 352 0.00% 34 356 0.00% 35 391 0.00% 36 388 0.00% 37 410 0.00% 38 409 0.00% 39 377 0.00% 40 425 0.00% 41 401 0.00% 42 425 0.00% 43 496 0.00% 44 483 0.00% 45 414 0.00% 46 431 0.00% 47 460 0.00% 48 447 0.00% 49 486 0.00% 50 484 0.00% 51 513 0.00% 52 476 0.00% 53 507 0.00% 54 453 0.00% 55 516 0.00% 56 456 0.00% 57 480 0.00% 58 480 0.00% 59 485 0.00% 60 532 0.00% 61 525 0.00% 62 469 0.00% 63 475 0.00% 64 457 0.00% 65 461 0.00% 66 499 0.00% 67 500 0.00% 68 501 0.00% 69 461 0.00% 70 538 0.00% 71 487 0.00% 72 477 0.00% 73 490 0.00% 74 474 0.00% 75 560 0.00% 76 580 0.00% 77 630 0.00% 78 564 0.00% 79 627 0.00% 80 632 0.00% 81 576 0.00% 82 661 0.00% 83 742 0.00% 84 759 0.00% 85 754 0.00% 86 767 0.00% 87 809 0.00% 88 846 0.00% 89 833 0.00% 90 950 0.00% 91 1028 0.00% 92 1081 0.00% 93 1054 0.00% 94 1202 0.00% 95 1231 0.01% 96 1249 0.01% 97 1488 0.01% 98 1387 0.01% 99 1556 0.01% 100 1612 0.01% 101 1707 0.01% 102 1755 0.01% 103 1850 0.01% 104 2082 0.01% 105 2266 0.01% 106 2243 0.01% 107 2364 0.01% 108 2597 0.01% 109 2647 0.01% 110 2726 0.01% 111 2866 0.01% 112 3029 0.01% 113 3206 0.01% 114 3350 0.01% 115 3572 0.01% 116 3809 0.02% 117 3884 0.02% 118 4138 0.02% 119 4203 0.02% 120 4417 0.02% 121 4649 0.02% 122 4919 0.02% 123 5005 0.02% 124 5323 0.02% 125 5509 0.02% 126 5826 0.02% 127 6061 0.03% 128 6506 0.03% 129 6452 0.03% 130 6733 0.03% 131 7212 0.03% 132 7570 0.03% 133 7724 0.03% 134 8266 0.03% 135 8691 0.04% 136 9019 0.04% 137 9432 0.04% 138 9852 0.04% 139 10168 0.04% 140 10388 0.04% 141 10942 0.05% 142 11630 0.05% 143 12149 0.05% 144 12663 0.05% 145 13946 0.06% 146 18005 0.07% 147 33727 0.14% 148 122092 0.51% 149 1139008 4.71% 150 22551023 93.28% 24175864 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.73 fanout-score-rank=28 prefix-density=0.14 prefix-fanout=3.5 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=1492.45 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=30.9 sequence=TTTCTTCTTTCGTTCACACTACTTGTTCGCTATCGGTTTGCCGCTTTGTGTATTCAGCGTTAGAAGCCACTTACCTTCGTCTTTAGACTATACTCCCAAATAGTCCGACTCTGTGTTTTGCACGCCTCCTCTTCTTTCTTTTATACAGGACTATCACCTTCTTTGTTATTCT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=28 prefix-density=0.11 prefix-fanout=2.6 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=1710.23 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=32.2 sequence=TTTCTTCTTTCGTTCACACTACTTGTTCGCTATCGGTTTGCCGCTTTGTGTATTCAGCGTTAGAAGCCACTTACCTTCGTCTTTAGACTATACTCCCAAATAGTCCGACTCTGTGTTTTGCACGCCTCCTCTTCTTTCTTTTATACAGGACTATCACCTTCTTTGTTATTCT SRR5933794 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:17:50 Started mapping on | Feb 10 20:17:53 Finished on | Feb 10 20:26:00 Mapping speed, Million of reads per hour | 178.71 Number of input reads | 24175864 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18316057 Uniquely mapped reads % | 75.76% Average mapped length | 280.27 Number of splices: Total | 12810715 Number of splices: Annotated (sjdb) | 12159014 Number of splices: GT/AG | 12481223 Number of splices: GC/AG | 155925 Number of splices: AT/AC | 9644 Number of splices: Non-canonical | 163923 Mismatch rate per base, % | 2.26% Deletion rate per base | 0.15% Deletion average length | 3.21 Insertion rate per base | 0.10% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1347249 % of reads mapped to multiple loci | 5.57% Number of reads mapped to too many loci | 11678 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.86% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4512562 4512562 4512562 N_multimapping 1347249 1347249 1347249 N_noFeature 563485 9398120 9378478 N_ambiguous 354934 126413 127899 UnstrandedReadsAssigned:17397638 PositiveStrandReadsAssigned:8791524 NegativeStrandReadsAssigned:8809680 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933794-trimmed-pair1.fastq SRR5933794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,175,864 reads, 18,249,276 reads pseudoaligned [quant] estimated average fragment length: 244.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR5933794.ke.tsv 34699 SRR5933794.se.tsv 87100 total ==> SRR5933794.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.84 5451.12 145.395 Potri.005G024800.1.v4.1 1035 791.841 1335 79.8114 Potri.004G059700.1.v4.1 961 717.846 9 0.593517 Potri.007G009000.2.v4.1 1416 1172.84 0 0 Potri.003G141000.2.v4.1 2943 2699.84 495 8.67938 Potri.016G087400.1.v4.1 270 54.4121 369.395 321.379 Potri.015G069301.1.v4.1 564 320.995 0 0 Potri.010G195200.1.v4.1 1773 1529.84 231 7.14805 Potri.012G127500.1.v4.1 977 733.846 7202 464.59 ==> SRR5933794.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 88 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 7 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 508 SRR5933794 completed mapping pipeline successfully