Starting /dee2/code/volunteer_pipeline.sh SRR5933795 current disk space = 3056289267712 free memory = 1311827164 SRR5933795 SRAfilesize 323ec757baa1f22448612c999436f66d SRR5933795.sra SRR5933795.sra file validated SRR5933795 is paired end SRR5933795 is conventional basespace SRR5933795 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.79125 32.0 2.0 32.0 2.0 32.0 2 27.8175 32.0 27.0 32.0 12.0 32.0 3 33.045 32.0 32.0 37.0 32.0 37.0 4 35.8375 37.0 37.0 37.0 32.0 37.0 5 35.73125 37.0 37.0 37.0 32.0 37.0 6 39.38125 41.0 41.0 41.0 37.0 41.0 7 39.591 41.0 41.0 41.0 37.0 41.0 8 39.803 41.0 41.0 41.0 37.0 41.0 9 40.08525 41.0 41.0 41.0 37.0 41.0 10-14 39.89255 41.0 41.0 41.0 37.0 41.0 15-19 39.91035 41.0 41.0 41.0 37.0 41.0 20-24 39.76455 41.0 41.0 41.0 37.0 41.0 25-29 39.3489 41.0 41.0 41.0 36.0 41.0 30-34 39.58515 41.0 41.0 41.0 37.0 41.0 35-39 39.19615 41.0 41.0 41.0 36.0 41.0 40-44 39.39685000000001 41.0 41.0 41.0 36.0 41.0 45-49 39.39565 41.0 41.0 41.0 37.0 41.0 50-54 39.120050000000006 41.0 40.2 41.0 36.0 41.0 55-59 38.76035 41.0 39.4 41.0 34.0 41.0 60-64 39.23065 41.0 41.0 41.0 36.0 41.0 65-69 39.114149999999995 41.0 41.0 41.0 36.0 41.0 70-74 39.25865 41.0 41.0 41.0 37.0 41.0 75-79 38.8544 41.0 39.4 41.0 34.0 41.0 80-84 38.900999999999996 41.0 40.2 41.0 35.0 41.0 85-89 38.46965 41.0 38.6 41.0 32.0 41.0 90-94 38.833600000000004 41.0 40.2 41.0 33.0 41.0 95-99 38.97185 41.0 41.0 41.0 34.0 41.0 100-104 38.61505 41.0 39.4 41.0 33.0 41.0 105-109 38.69455 41.0 40.2 41.0 33.0 41.0 110-114 38.3768 41.0 37.8 41.0 32.0 41.0 115-119 37.323899999999995 41.0 36.0 41.0 29.0 41.0 120-124 36.68625 40.2 36.0 41.0 27.0 41.0 125-129 34.482549999999996 38.6 31.0 41.0 18.0 41.0 130-134 34.7751 39.4 33.0 41.0 18.0 41.0 135-139 33.70565 38.6 29.0 41.0 16.0 41.0 140-144 33.911449999999995 38.4 29.0 41.0 20.0 41.0 145-149 29.157849999999996 32.0 21.0 38.4 12.0 40.2 150 28.9855 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 0.0 21 0.0 22 3.0 23 5.0 24 7.0 25 10.0 26 21.0 27 23.0 28 36.0 29 47.0 30 45.0 31 80.0 32 80.0 33 115.0 34 163.0 35 202.0 36 282.0 37 430.0 38 636.0 39 1114.0 40 698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.91902071563089 16.760828625235405 19.538606403013183 35.781544256120526 2 25.924999999999997 27.05 33.625 13.4 3 22.625 29.825000000000003 25.575 21.975 4 23.305826456614152 36.25906476619154 20.455113778444613 19.979994998749685 5 23.35 37.425000000000004 22.3 16.925 6 16.275000000000002 39.550000000000004 23.325000000000003 20.849999999999998 7 14.575 16.675 46.75 22.0 8 19.900000000000002 22.925 28.4 28.775000000000002 9 19.925 23.325000000000003 30.7 26.05 10-14 20.645 31.205 27.24 20.91 15-19 21.0 28.065 28.985 21.95 20-24 20.905 29.549999999999997 27.38 22.165000000000003 25-29 21.22 28.84 28.265 21.675 30-34 20.875 29.095 28.084999999999997 21.945 35-39 20.985 29.54 28.005000000000003 21.47 40-44 21.11 29.220000000000002 28.055000000000003 21.615000000000002 45-49 21.01 28.84 28.03 22.12 50-54 21.61 29.354999999999997 27.405 21.63 55-59 21.48 28.715000000000003 27.955000000000002 21.85 60-64 21.044999999999998 29.189999999999998 27.96 21.805 65-69 21.315 28.455000000000002 28.294999999999998 21.935 70-74 21.43 28.735 28.525 21.310000000000002 75-79 22.215 28.544999999999998 28.005000000000003 21.235 80-84 21.375 28.28 28.444999999999997 21.9 85-89 21.95 27.865000000000002 27.99 22.195 90-94 21.475 28.96 27.815 21.75 95-99 21.745 28.549999999999997 28.42 21.285 100-104 21.475 28.315 28.17 22.040000000000003 105-109 21.27 28.134999999999998 28.27 22.325 110-114 21.725 27.98 27.944999999999997 22.35 115-119 21.425 28.7 27.79 22.085 120-124 21.5 27.85 28.199999999999996 22.45 125-129 21.741087054352718 27.996399819990998 28.801440072003597 21.461073053652683 130-134 21.04710471047105 28.83788378837884 28.257825782578255 21.857185718571856 135-139 20.906045302265113 28.7864393219661 28.696434821741086 21.6110805540277 140-144 21.595 28.785 28.02 21.6 145-149 21.232123212321234 28.092809280928094 29.98799879987999 20.687068706870686 150 21.775 28.849999999999998 28.175 21.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 1.0 22 3.5 23 9.0 24 11.0 25 12.0 26 13.0 27 13.5 28 16.0 29 25.0 30 35.0 31 41.5 32 43.0 33 58.5 34 75.5 35 84.0 36 109.0 37 137.5 38 166.0 39 191.0 40 200.5 41 232.5 42 259.5 43 240.5 44 258.0 45 275.5 46 236.5 47 205.0 48 204.5 49 182.5 50 141.5 51 119.0 52 92.5 53 72.5 54 61.0 55 42.5 56 31.0 57 26.0 58 17.0 59 12.0 60 11.5 61 6.0 62 2.5 63 4.5 64 4.0 65 2.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 46.9 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.53287012292891 87.5 2 6.06627471940139 11.35 3 0.3741314804917157 1.05 4 0.026723677177979688 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.4625 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.5 0.0 0.0 0.0 0.0 136-137 0.5 0.0 0.0 0.0 0.0 138 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933795 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933795_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.235 32.0 2.0 32.0 2.0 32.0 2 30.5925 32.0 32.0 32.0 27.0 32.0 3 32.87375 32.0 32.0 37.0 32.0 37.0 4 34.65125 37.0 32.0 37.0 32.0 37.0 5 35.03125 37.0 37.0 37.0 32.0 37.0 6 37.5185 41.0 37.0 41.0 32.0 41.0 7 35.80375 41.0 32.0 41.0 22.0 41.0 8 39.15325 41.0 41.0 41.0 37.0 41.0 9 39.1355 41.0 41.0 41.0 37.0 41.0 10-14 39.25275 41.0 41.0 41.0 37.0 41.0 15-19 39.03575 41.0 41.0 41.0 35.0 41.0 20-24 38.6879 41.0 39.4 41.0 35.0 41.0 25-29 38.2846 41.0 38.6 41.0 33.0 41.0 30-34 38.33685 41.0 38.6 41.0 32.0 41.0 35-39 38.207 41.0 37.8 41.0 32.0 41.0 40-44 39.11915 41.0 40.2 41.0 35.0 41.0 45-49 39.31295 41.0 41.0 41.0 37.0 41.0 50-54 38.911550000000005 41.0 41.0 41.0 34.0 41.0 55-59 38.42659999999999 41.0 38.6 41.0 32.0 41.0 60-64 37.843 41.0 37.0 41.0 31.0 41.0 65-69 36.29265 41.0 36.0 41.0 23.0 41.0 70-74 36.57345 41.0 36.0 41.0 25.0 41.0 75-79 36.755399999999995 41.0 35.0 41.0 27.0 41.0 80-84 36.417649999999995 41.0 35.0 41.0 25.0 41.0 85-89 35.97945 41.0 35.0 41.0 24.0 41.0 90-94 34.37985 38.6 30.0 41.0 18.0 41.0 95-99 34.7763 37.0 31.0 41.0 21.0 41.0 100-104 35.345749999999995 38.6 34.0 41.0 23.0 41.0 105-109 33.80415000000001 37.0 31.0 41.0 16.0 41.0 110-114 33.66235 37.0 31.0 41.0 18.0 41.0 115-119 31.3111 35.0 25.0 41.0 12.0 41.0 120-124 29.591199999999997 32.0 22.0 38.6 12.0 41.0 125-129 29.597199999999997 32.0 22.0 40.2 12.0 41.0 130-134 27.183250000000005 28.0 18.0 37.0 12.0 41.0 135-139 23.867649999999998 25.0 12.0 33.0 12.0 39.4 140-144 21.05005 17.0 12.0 29.0 11.2 37.0 145-149 21.647550000000003 20.0 12.0 30.0 11.2 36.0 150 18.34525 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 2.0 18 5.0 19 3.0 20 8.0 21 15.0 22 22.0 23 32.0 24 43.0 25 49.0 26 82.0 27 82.0 28 116.0 29 150.0 30 201.0 31 197.0 32 240.0 33 297.0 34 355.0 35 416.0 36 482.0 37 518.0 38 443.0 39 208.0 40 32.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.92995060619668 15.850920520880107 20.341266277503365 35.87786259541985 2 24.0 25.924999999999997 34.1 15.975 3 23.23080770192548 29.08227056764191 26.60665166291573 21.080270067516878 4 24.075 34.699999999999996 21.475 19.75 5 23.375 37.75 22.775000000000002 16.1 6 16.325 39.0 24.625 20.05 7 15.275 17.575 45.75 21.4 8 18.975 21.875 30.925000000000004 28.225 9 20.674999999999997 23.474999999999998 29.075 26.775 10-14 20.4 31.145 26.945000000000004 21.51 15-19 20.64 29.354999999999997 28.110000000000003 21.895 20-24 21.58 29.330000000000002 27.96 21.13 25-29 21.355 29.604999999999997 28.410000000000004 20.630000000000003 30-34 21.0 28.720000000000002 28.715000000000003 21.565 35-39 21.54 29.244999999999997 28.084999999999997 21.13 40-44 22.03 29.39 27.065 21.515 45-49 21.085 29.509999999999998 27.815 21.59 50-54 21.125 29.005 28.13 21.740000000000002 55-59 21.711085554277716 28.801440072003597 28.466423321166058 21.02105105255263 60-64 21.395 28.685 27.79 22.13 65-69 21.790000000000003 29.01 28.134999999999998 21.065 70-74 21.745 29.354999999999997 28.025 20.875 75-79 22.4161208060403 28.521426071303562 27.771388569428474 21.291064553227663 80-84 21.181059052952648 29.29146457322866 28.0314015700785 21.496074803740186 85-89 21.977197719771976 28.0978097809781 28.54785478547855 21.377137713771376 90-94 21.48 28.715000000000003 28.449999999999996 21.355 95-99 21.81 28.425 27.965 21.8 100-104 21.535 28.915000000000003 27.96 21.59 105-109 22.12 29.060000000000002 27.41 21.41 110-114 22.28 28.42 27.800000000000004 21.5 115-119 22.235 29.32 27.735 20.71 120-124 22.515 28.615000000000002 28.705000000000002 20.165 125-129 21.94 28.9 28.084999999999997 21.075 130-134 22.255 28.799999999999997 28.055000000000003 20.89 135-139 23.535 28.67 27.705000000000002 20.09 140-144 23.52 28.749999999999996 28.67 19.06 145-149 22.24 28.87 28.660000000000004 20.23 150 24.275 29.075 32.1 14.549999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.5 20 2.0 21 5.0 22 5.5 23 6.5 24 7.5 25 6.5 26 9.0 27 18.5 28 23.5 29 19.5 30 29.5 31 42.0 32 49.0 33 57.5 34 69.0 35 94.5 36 128.5 37 144.0 38 156.0 39 190.5 40 212.0 41 234.5 42 266.0 43 264.5 44 260.0 45 260.5 46 237.5 47 207.0 48 196.5 49 173.5 50 133.5 51 109.5 52 89.5 53 68.5 54 52.5 55 38.5 56 26.5 57 20.5 58 15.0 59 10.5 60 8.0 61 7.5 62 9.5 63 7.5 64 5.0 65 4.0 66 3.0 67 2.5 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 44.324999999999996 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12858660998937 88.575 2 5.499468650371945 10.35 3 0.34537725823591925 0.975 4 0.026567481402763018 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.6125 0.0 0.0 0.0 0.0 134-135 0.65 0.0 0.0 0.0 0.0 136-137 0.65 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGATGT 10 0.0070392117 143.55 3 >>END_MODULE Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277747 spots for SRR5933795.sra Written 1277747 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra Read 1277743 spots for SRR5933795.sra Written 1277743 spots for SRR5933795.sra SRR ids: ['SRR5933795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ocf9irt SRR5933795.sra spots: 25554864 blocks: [[1, 1277743], [1277744, 2555486], [2555487, 3833229], [3833230, 5110972], [5110973, 6388715], [6388716, 7666458], [7666459, 8944201], [8944202, 10221944], [10221945, 11499687], [11499688, 12777430], [12777431, 14055173], [14055174, 15332916], [15332917, 16610659], [16610660, 17888402], [17888403, 19166145], [19166146, 20443888], [20443889, 21721631], [21721632, 22999374], [22999375, 24277117], [24277118, 25554864]] SRR5933795 file size 8588092 SRR5933795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933795 SRR5933795_1.fastq SRR5933795_2.fastq Input file: SRR5933795_1.fastq Paired file: SRR5933795_2.fastq trimmed: SRR5933795-trimmed-pair1.fastq, SRR5933795-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:06:19 2025 >> started Mon Feb 10 20:07:01 2025 >> done (42.085s) 25554864 read pairs processed; of these: 208 ( 0.00%) short read pairs filtered out after trimming by size control 73 ( 0.00%) empty read pairs filtered out after trimming by size control 25554583 (100.00%) read pairs available; of these: 1790241 ( 7.01%) trimmed read pairs available after processing 23764342 (92.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 55 0.00% 20 65 0.00% 21 78 0.00% 22 117 0.00% 23 155 0.00% 24 156 0.00% 25 206 0.00% 26 187 0.00% 27 244 0.00% 28 305 0.00% 29 285 0.00% 30 274 0.00% 31 326 0.00% 32 311 0.00% 33 331 0.00% 34 307 0.00% 35 366 0.00% 36 338 0.00% 37 353 0.00% 38 407 0.00% 39 327 0.00% 40 392 0.00% 41 374 0.00% 42 380 0.00% 43 354 0.00% 44 451 0.00% 45 361 0.00% 46 406 0.00% 47 420 0.00% 48 462 0.00% 49 418 0.00% 50 396 0.00% 51 415 0.00% 52 390 0.00% 53 472 0.00% 54 411 0.00% 55 420 0.00% 56 429 0.00% 57 405 0.00% 58 476 0.00% 59 442 0.00% 60 431 0.00% 61 417 0.00% 62 387 0.00% 63 435 0.00% 64 439 0.00% 65 466 0.00% 66 431 0.00% 67 427 0.00% 68 470 0.00% 69 444 0.00% 70 464 0.00% 71 457 0.00% 72 470 0.00% 73 486 0.00% 74 467 0.00% 75 498 0.00% 76 509 0.00% 77 549 0.00% 78 529 0.00% 79 568 0.00% 80 590 0.00% 81 593 0.00% 82 688 0.00% 83 756 0.00% 84 724 0.00% 85 782 0.00% 86 848 0.00% 87 855 0.00% 88 851 0.00% 89 925 0.00% 90 1023 0.00% 91 1077 0.00% 92 1130 0.00% 93 1186 0.00% 94 1277 0.00% 95 1417 0.01% 96 1459 0.01% 97 1597 0.01% 98 1674 0.01% 99 1704 0.01% 100 1883 0.01% 101 2121 0.01% 102 2121 0.01% 103 2224 0.01% 104 2262 0.01% 105 2507 0.01% 106 2716 0.01% 107 2820 0.01% 108 3042 0.01% 109 3248 0.01% 110 3291 0.01% 111 3565 0.01% 112 3606 0.01% 113 3848 0.02% 114 4063 0.02% 115 4305 0.02% 116 4643 0.02% 117 4682 0.02% 118 5088 0.02% 119 5328 0.02% 120 5331 0.02% 121 5864 0.02% 122 6163 0.02% 123 6432 0.03% 124 6779 0.03% 125 7082 0.03% 126 7683 0.03% 127 7809 0.03% 128 8031 0.03% 129 8466 0.03% 130 8867 0.03% 131 9188 0.04% 132 9572 0.04% 133 10184 0.04% 134 10569 0.04% 135 11331 0.04% 136 11756 0.05% 137 12075 0.05% 138 12525 0.05% 139 13223 0.05% 140 13762 0.05% 141 14422 0.06% 142 15262 0.06% 143 15903 0.06% 144 16558 0.06% 145 18208 0.07% 146 22207 0.09% 147 38844 0.15% 148 132790 0.52% 149 1211988 4.74% 150 23764342 92.99% 25554583 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.29 fanout-score-rank=26 prefix-density=0.14 prefix-fanout=3.7 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=378.75 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=32.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=33 prefix-density=0.10 prefix-fanout=2.5 sequence=AAGACCATCACCCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=429.63 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=34.8 sequence=TTCTTCTTCTTT SRR5933795 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:08:53 Started mapping on | Feb 10 20:08:53 Finished on | Feb 10 20:16:35 Mapping speed, Million of reads per hour | 199.13 Number of input reads | 25554583 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20267669 Uniquely mapped reads % | 79.31% Average mapped length | 280.60 Number of splices: Total | 14887506 Number of splices: Annotated (sjdb) | 14178611 Number of splices: GT/AG | 14515079 Number of splices: GC/AG | 184063 Number of splices: AT/AC | 10959 Number of splices: Non-canonical | 177405 Mismatch rate per base, % | 2.23% Deletion rate per base | 0.14% Deletion average length | 3.20 Insertion rate per base | 0.09% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1463792 % of reads mapped to multiple loci | 5.73% Number of reads mapped to too many loci | 13036 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.67% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3823124 3823124 3823124 N_multimapping 1463792 1463792 1463792 N_noFeature 549813 10375289 10334168 N_ambiguous 385078 138930 140567 UnstrandedReadsAssigned:19332778 PositiveStrandReadsAssigned:9753450 NegativeStrandReadsAssigned:9792934 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5933795 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933795-trimmed-pair1.fastq SRR5933795-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,554,583 reads, 20,025,463 reads pseudoaligned [quant] estimated average fragment length: 238.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR5933795.ke.tsv 34699 SRR5933795.se.tsv 87100 total ==> SRR5933795.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.22 5691.14 149.908 Potri.005G024800.1.v4.1 1035 797.216 1402 82.4654 Potri.004G059700.1.v4.1 961 723.216 32 2.07483 Potri.007G009000.2.v4.1 1416 1178.22 0 0 Potri.003G141000.2.v4.1 2943 2705.22 592.66 10.2732 Potri.016G087400.1.v4.1 270 57.2953 448 366.656 Potri.015G069301.1.v4.1 564 326.323 0 0 Potri.010G195200.1.v4.1 1773 1535.22 101 3.08498 Potri.012G127500.1.v4.1 977 739.216 5651 358.471 ==> SRR5933795.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 110 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 725 SRR5933795 completed mapping pipeline successfully