Starting /dee2/code/volunteer_pipeline.sh SRR5933796 current disk space = 3056174870528 free memory = 1218442424 SRR5933796 SRAfilesize c5b0b15c9703fbb942a838cd0b6592ec SRR5933796.sra SRR5933796.sra file validated SRR5933796 is paired end SRR5933796 is conventional basespace SRR5933796 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2875 32.0 32.0 32.0 32.0 32.0 2 28.96375 32.0 32.0 32.0 12.0 32.0 3 34.72875 37.0 32.0 37.0 32.0 37.0 4 36.25 37.0 37.0 37.0 32.0 37.0 5 35.6775 37.0 37.0 37.0 32.0 37.0 6 37.919 41.0 37.0 41.0 32.0 41.0 7 34.51475 37.0 32.0 41.0 12.0 41.0 8 37.92325 41.0 37.0 41.0 32.0 41.0 9 39.292 41.0 41.0 41.0 37.0 41.0 10-14 38.523 41.0 38.6 41.0 33.0 41.0 15-19 37.1716 41.0 36.8 41.0 27.0 41.0 20-24 38.06055 41.0 37.8 41.0 31.0 41.0 25-29 36.3789 40.2 34.8 41.0 24.0 41.0 30-34 38.45625 41.0 38.6 41.0 33.0 41.0 35-39 34.91725 38.4 32.0 41.0 21.0 41.0 40-44 32.206100000000006 35.0 25.0 40.2 17.0 41.0 45-49 28.06005 29.0 19.0 37.8 12.0 41.0 50-54 25.20855 26.0 14.0 36.0 12.0 39.4 55-59 26.9113 27.0 19.0 35.6 14.0 39.4 60-64 27.604049999999994 27.0 21.0 35.6 16.0 39.4 65-69 27.043599999999998 29.0 16.0 36.8 12.0 41.0 70-74 25.0178 24.0 12.0 35.0 12.0 41.0 75-79 22.8902 22.0 14.0 31.0 12.0 37.6 80-84 25.638749999999998 26.0 16.0 36.0 12.0 40.2 85-89 29.109500000000004 31.0 22.0 37.4 18.0 40.2 90-94 30.126350000000002 34.0 23.0 40.2 16.0 41.0 95-99 23.822799999999997 24.0 14.0 33.0 12.0 38.6 100-104 23.940749999999998 23.0 16.0 34.0 12.0 38.6 105-109 21.857750000000003 20.0 12.0 29.0 12.0 37.0 110-114 20.477549999999997 18.0 12.0 26.0 12.0 35.0 115-119 21.3869 20.0 12.0 30.0 12.0 37.0 120-124 17.519 14.0 12.0 24.0 8.8 30.0 125-129 16.2916 12.0 12.0 22.0 8.0 29.0 130-134 15.410449999999997 12.0 12.0 22.0 8.0 25.0 135-139 14.855599999999999 12.0 12.0 18.0 8.0 22.0 140-144 14.681049999999999 12.0 12.0 20.0 8.0 22.0 145-149 15.493500000000001 12.0 12.0 20.0 8.0 25.0 150 15.2925 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 18 7.0 19 32.0 20 88.0 21 170.0 22 310.0 23 397.0 24 472.0 25 433.0 26 400.0 27 320.0 28 333.0 29 309.0 30 324.0 31 218.0 32 117.0 33 45.0 34 17.0 35 6.0 36 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.97149401883431 17.332654619496054 19.725120895902265 34.97073046576737 2 26.8 26.075 32.45 14.674999999999999 3 20.424999999999997 31.275 26.474999999999998 21.825 4 23.44844844844845 36.16116116116116 19.994994994994993 20.395395395395397 5 23.400000000000002 37.275000000000006 22.525000000000002 16.8 6 15.7 40.2 24.0 20.1 7 16.475 16.625 44.925 21.975 8 19.275000000000002 23.549999999999997 28.125 29.049999999999997 9 21.375 23.875 28.425 26.325 10-14 20.41 32.214999999999996 26.534999999999997 20.84 15-19 21.545 28.515 27.93 22.009999999999998 20-24 21.17 30.314999999999998 26.979999999999997 21.535 25-29 21.02630789236771 29.65889766930079 27.728318495548663 21.586475942782833 30-34 21.84 29.509999999999998 27.839999999999996 20.810000000000002 35-39 21.73 28.895 28.144999999999996 21.23 40-44 21.69 29.304999999999996 27.500000000000004 21.505 45-49 22.555 28.42 28.52 20.505000000000003 50-54 22.395 28.685 28.65 20.27 55-59 23.425 28.235 28.494999999999997 19.845 60-64 22.2 29.215000000000003 28.235 20.349999999999998 65-69 22.675 28.799999999999997 28.000000000000004 20.525 70-74 22.165000000000003 28.884999999999998 28.015 20.935000000000002 75-79 22.314999999999998 28.185 29.555 19.945 80-84 21.725 29.044999999999998 28.225 21.005 85-89 21.6 28.965000000000003 29.265 20.169999999999998 90-94 21.82 28.7 28.365000000000002 21.115000000000002 95-99 22.37 28.825 28.410000000000004 20.395 100-104 22.36 28.325 29.054999999999996 20.26 105-109 22.205 28.694999999999997 28.485 20.615 110-114 21.78 29.509999999999998 29.775000000000002 18.935 115-119 22.735 28.22 28.315 20.73 120-124 22.865 27.935 30.085 19.115 125-129 23.535 26.68 30.54 19.245 130-134 23.115 27.505000000000003 30.404999999999998 18.975 135-139 23.830000000000002 27.589999999999996 30.615 17.965 140-144 23.39 27.825 30.625000000000004 18.16 145-149 23.47 27.955000000000002 29.185 19.39 150 22.900000000000002 27.125 29.549999999999997 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 2.5 19 2.5 20 2.5 21 2.5 22 7.0 23 8.0 24 7.5 25 12.5 26 17.0 27 21.0 28 22.5 29 24.5 30 33.0 31 46.5 32 56.5 33 73.0 34 96.0 35 107.5 36 115.0 37 128.0 38 156.5 39 188.0 40 205.5 41 217.5 42 220.0 43 220.5 44 215.5 45 223.0 46 230.0 47 213.0 48 196.5 49 165.0 50 138.5 51 116.5 52 99.5 53 92.0 54 67.0 55 56.5 56 45.5 57 25.0 58 20.0 59 22.0 60 17.5 61 11.0 62 7.5 63 6.0 64 6.5 65 4.5 66 4.0 67 2.5 68 1.0 69 1.0 70 1.5 71 1.5 72 1.0 73 1.0 74 1.0 75 0.5 76 1.5 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.1 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.03 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.82719836400818 95.675 2 2.096114519427403 4.1000000000000005 3 0.07668711656441718 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0125 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.0625 0.0 0.0 0.025 0.0 100-101 0.075 0.0 0.0 0.025 0.0 102-103 0.075 0.0 0.0 0.025 0.0 104-105 0.075 0.0 0.0 0.025 0.0 106-107 0.075 0.0 0.0 0.025 0.0 108-109 0.075 0.0 0.0 0.025 0.0 110-111 0.075 0.0 0.0 0.025 0.0 112-113 0.075 0.0 0.0 0.025 0.0 114-115 0.075 0.0 0.0 0.025 0.0 116-117 0.075 0.0 0.0 0.025 0.0 118-119 0.075 0.0 0.0 0.025 0.0 120-121 0.075 0.0 0.0 0.025 0.0 122-123 0.075 0.0 0.0 0.025 0.0 124-125 0.075 0.0 0.0 0.025 0.0 126-127 0.075 0.0 0.0 0.025 0.0 128-129 0.075 0.0 0.0 0.025 0.0 130-131 0.075 0.0 0.0 0.025 0.0 132-133 0.075 0.0 0.0 0.025 0.0 134-135 0.075 0.0 0.0 0.025 0.0 136-137 0.075 0.0 0.0 0.025 0.0 138 0.075 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATCT 10 0.0067147487 145.81013 1 >>END_MODULE SRR5933796 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933796_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3675 32.0 32.0 32.0 27.0 32.0 2 31.11625 32.0 32.0 32.0 32.0 32.0 3 34.935 37.0 32.0 37.0 32.0 37.0 4 35.60125 37.0 37.0 37.0 32.0 37.0 5 34.9275 37.0 37.0 37.0 32.0 37.0 6 36.6755 41.0 37.0 41.0 27.0 41.0 7 33.95025 37.0 32.0 41.0 12.0 41.0 8 38.6195 41.0 37.0 41.0 32.0 41.0 9 38.552 41.0 37.0 41.0 32.0 41.0 10-14 38.632099999999994 41.0 40.2 41.0 35.0 41.0 15-19 37.340399999999995 40.2 36.6 41.0 27.0 41.0 20-24 37.9889 41.0 38.6 41.0 31.0 41.0 25-29 38.75335 41.0 40.2 41.0 34.0 41.0 30-34 38.7714 41.0 40.2 41.0 34.0 41.0 35-39 39.0743 41.0 41.0 41.0 36.0 41.0 40-44 38.755 41.0 41.0 41.0 33.0 41.0 45-49 38.36415 41.0 38.6 41.0 32.0 41.0 50-54 38.6311 41.0 40.2 41.0 32.0 41.0 55-59 38.0333 41.0 38.6 41.0 29.0 41.0 60-64 36.99855 41.0 37.0 41.0 26.0 41.0 65-69 37.02810000000001 41.0 37.0 41.0 26.0 41.0 70-74 36.8738 41.0 37.0 41.0 26.0 41.0 75-79 34.70145 38.6 32.0 41.0 21.0 41.0 80-84 36.66005 41.0 37.0 41.0 26.0 41.0 85-89 35.2301 39.4 33.0 41.0 20.0 41.0 90-94 33.36234999999999 37.0 31.0 41.0 12.0 41.0 95-99 35.4063 39.4 32.0 41.0 23.0 41.0 100-104 32.0505 34.8 25.0 40.2 16.0 41.0 105-109 29.7432 33.0 20.0 38.6 14.0 41.0 110-114 29.780250000000002 33.0 24.0 38.6 12.0 41.0 115-119 26.340950000000003 28.0 16.0 36.8 12.0 41.0 120-124 27.644849999999998 30.0 19.0 37.0 12.0 41.0 125-129 25.727250000000005 26.0 16.0 36.0 12.0 41.0 130-134 26.111849999999997 27.0 14.0 37.0 12.0 41.0 135-139 26.440049999999996 27.0 16.0 37.0 12.0 41.0 140-144 25.80465 27.0 14.0 37.0 12.0 41.0 145-149 25.700399999999995 27.0 14.0 36.0 12.0 41.0 150 25.29725 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 4.0 17 7.0 18 3.0 19 7.0 20 15.0 21 18.0 22 23.0 23 49.0 24 51.0 25 75.0 26 92.0 27 106.0 28 130.0 29 172.0 30 206.0 31 238.0 32 285.0 33 279.0 34 372.0 35 344.0 36 397.0 37 409.0 38 416.0 39 247.0 40 51.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.980322003577818 16.99463327370304 19.115767952977254 34.909276769741886 2 25.825 25.174999999999997 33.625 15.375 3 22.7 31.7 24.3 21.3 4 22.900000000000002 36.0 20.424999999999997 20.674999999999997 5 23.05 36.575 23.075000000000003 17.299999999999997 6 15.975 38.875 25.275 19.875 7 15.275 17.150000000000002 45.425 22.15 8 19.075 21.3 30.825000000000003 28.799999999999997 9 20.474999999999998 24.375 29.575000000000003 25.575 10-14 20.375 30.705 27.765 21.154999999999998 15-19 20.845 27.92 28.9 22.335 20-24 21.135 29.14 28.33 21.395 25-29 21.435000000000002 28.810000000000002 28.405 21.349999999999998 30-34 21.265 29.549999999999997 27.384999999999998 21.8 35-39 21.455 28.955 28.435 21.154999999999998 40-44 21.965 28.915000000000003 27.750000000000004 21.37 45-49 21.29 28.575 28.005000000000003 22.13 50-54 21.099999999999998 28.4 28.360000000000003 22.14 55-59 21.26 28.470000000000002 28.54 21.73 60-64 21.555 28.79 28.139999999999997 21.515 65-69 21.18 29.09 28.17 21.560000000000002 70-74 21.335 29.215000000000003 28.305000000000003 21.145 75-79 21.705 27.944999999999997 28.865000000000002 21.485000000000003 80-84 21.38 28.105000000000004 28.4 22.115000000000002 85-89 21.385 29.2 28.000000000000004 21.415 90-94 21.46 29.054999999999996 27.950000000000003 21.535 95-99 21.605 28.095 28.18 22.12 100-104 22.585 27.775 27.74 21.9 105-109 22.05 28.470000000000002 27.36 22.12 110-114 21.945 27.224999999999998 28.555000000000003 22.275 115-119 23.380000000000003 26.51 28.65 21.46 120-124 22.07 28.1 27.66 22.17 125-129 22.56 27.49 28.134999999999998 21.815 130-134 22.37 27.500000000000004 28.155 21.975 135-139 22.415 28.075 27.529999999999998 21.98 140-144 22.470000000000002 27.71 28.105000000000004 21.715 145-149 22.585 27.605 28.000000000000004 21.81 150 22.650000000000002 27.85 28.125 21.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 3.0 19 3.5 20 3.0 21 5.5 22 4.5 23 3.0 24 4.5 25 10.0 26 18.0 27 21.0 28 23.0 29 31.0 30 41.0 31 41.0 32 43.0 33 62.5 34 85.0 35 91.0 36 106.0 37 126.5 38 142.0 39 166.0 40 202.0 41 237.0 42 245.0 43 246.0 44 236.5 45 233.5 46 236.0 47 227.0 48 202.5 49 168.0 50 141.0 51 105.5 52 85.0 53 81.0 54 68.5 55 51.0 56 39.0 57 26.5 58 22.0 59 23.5 60 16.5 61 9.5 62 7.5 63 9.0 64 7.0 65 4.0 66 4.5 67 4.5 68 4.5 69 5.0 70 3.0 71 0.5 72 0.0 73 2.0 74 3.5 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.49029889879391 91.05 2 4.142632406921867 7.9 3 0.36706869428421607 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.5375 0.0 0.0 0.0 0.0 130-131 0.6625 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.8 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205716 spots for SRR5933796.sra Written 1205716 spots for SRR5933796.sra Read 1205724 spots for SRR5933796.sra Written 1205724 spots for SRR5933796.sra SRR ids: ['SRR5933796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1gczljok SRR5933796.sra spots: 24114328 blocks: [[1, 1205716], [1205717, 2411432], [2411433, 3617148], [3617149, 4822864], [4822865, 6028580], [6028581, 7234296], [7234297, 8440012], [8440013, 9645728], [9645729, 10851444], [10851445, 12057160], [12057161, 13262876], [13262877, 14468592], [14468593, 15674308], [15674309, 16880024], [16880025, 18085740], [18085741, 19291456], [19291457, 20497172], [20497173, 21702888], [21702889, 22908604], [22908605, 24114328]] SRR5933796 file size 8102755 SRR5933796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933796 SRR5933796_1.fastq SRR5933796_2.fastq Input file: SRR5933796_1.fastq Paired file: SRR5933796_2.fastq trimmed: SRR5933796-trimmed-pair1.fastq, SRR5933796-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:21:32 2025 >> started Mon Feb 10 20:21:59 2025 >> done (26.321s) 24114328 read pairs processed; of these: 242 ( 0.00%) short read pairs filtered out after trimming by size control 65 ( 0.00%) empty read pairs filtered out after trimming by size control 24114021 (100.00%) read pairs available; of these: 1546487 ( 6.41%) trimmed read pairs available after processing 22567534 (93.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 45 0.00% 20 63 0.00% 21 73 0.00% 22 94 0.00% 23 132 0.00% 24 161 0.00% 25 154 0.00% 26 182 0.00% 27 186 0.00% 28 208 0.00% 29 215 0.00% 30 257 0.00% 31 239 0.00% 32 265 0.00% 33 268 0.00% 34 289 0.00% 35 288 0.00% 36 293 0.00% 37 288 0.00% 38 308 0.00% 39 329 0.00% 40 335 0.00% 41 303 0.00% 42 357 0.00% 43 325 0.00% 44 322 0.00% 45 296 0.00% 46 331 0.00% 47 373 0.00% 48 411 0.00% 49 379 0.00% 50 373 0.00% 51 386 0.00% 52 414 0.00% 53 406 0.00% 54 402 0.00% 55 422 0.00% 56 407 0.00% 57 404 0.00% 58 398 0.00% 59 424 0.00% 60 430 0.00% 61 386 0.00% 62 442 0.00% 63 441 0.00% 64 405 0.00% 65 381 0.00% 66 443 0.00% 67 420 0.00% 68 407 0.00% 69 417 0.00% 70 441 0.00% 71 462 0.00% 72 479 0.00% 73 478 0.00% 74 492 0.00% 75 488 0.00% 76 543 0.00% 77 594 0.00% 78 574 0.00% 79 674 0.00% 80 727 0.00% 81 743 0.00% 82 746 0.00% 83 876 0.00% 84 878 0.00% 85 893 0.00% 86 998 0.00% 87 1041 0.00% 88 1110 0.00% 89 1260 0.01% 90 1274 0.01% 91 1415 0.01% 92 1576 0.01% 93 1624 0.01% 94 1686 0.01% 95 1823 0.01% 96 1992 0.01% 97 2199 0.01% 98 2188 0.01% 99 2360 0.01% 100 2434 0.01% 101 2721 0.01% 102 2972 0.01% 103 3029 0.01% 104 3319 0.01% 105 3478 0.01% 106 3648 0.02% 107 3675 0.02% 108 3982 0.02% 109 4131 0.02% 110 4451 0.02% 111 4557 0.02% 112 5119 0.02% 113 5060 0.02% 114 5330 0.02% 115 5762 0.02% 116 6105 0.03% 117 6076 0.03% 118 6454 0.03% 119 6748 0.03% 120 6950 0.03% 121 7430 0.03% 122 7892 0.03% 123 8193 0.03% 124 8793 0.04% 125 9164 0.04% 126 9397 0.04% 127 9675 0.04% 128 10538 0.04% 129 10974 0.05% 130 11283 0.05% 131 11723 0.05% 132 12187 0.05% 133 12456 0.05% 134 13572 0.06% 135 14028 0.06% 136 14630 0.06% 137 15408 0.06% 138 15818 0.07% 139 16742 0.07% 140 17264 0.07% 141 17788 0.07% 142 18897 0.08% 143 19506 0.08% 144 20803 0.09% 145 22417 0.09% 146 25372 0.11% 147 36353 0.15% 148 99658 0.41% 149 903866 3.75% 150 22567534 93.59% 24114021 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=3.3 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=127.17 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=19.1 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.09 fanout-score-rank=14 prefix-density=0.18 prefix-fanout=5.6 sequence=GAGCTTCTTGGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=112.23 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=17.6 sequence=GCTGCTGCTGCT SRR5933796 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:24:19 Started mapping on | Feb 10 20:24:19 Finished on | Feb 10 20:32:36 Mapping speed, Million of reads per hour | 174.67 Number of input reads | 24114021 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18339718 Uniquely mapped reads % | 76.05% Average mapped length | 283.96 Number of splices: Total | 12766116 Number of splices: Annotated (sjdb) | 11941150 Number of splices: GT/AG | 12392951 Number of splices: GC/AG | 160548 Number of splices: AT/AC | 8629 Number of splices: Non-canonical | 203988 Mismatch rate per base, % | 2.24% Deletion rate per base | 0.15% Deletion average length | 3.22 Insertion rate per base | 0.10% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1621676 % of reads mapped to multiple loci | 6.73% Number of reads mapped to too many loci | 31923 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.45% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4152627 4152627 4152627 N_multimapping 1621676 1621676 1621676 N_noFeature 615156 9456201 9396908 N_ambiguous 410491 155350 156924 UnstrandedReadsAssigned:17314071 PositiveStrandReadsAssigned:8728167 NegativeStrandReadsAssigned:8785886 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR5933796 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933796-trimmed-pair1.fastq SRR5933796-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,114,021 reads, 18,090,343 reads pseudoaligned [quant] estimated average fragment length: 238.584 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR5933796.ke.tsv 34699 SRR5933796.se.tsv 87100 total ==> SRR5933796.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.42 5579.4 148.717 Potri.005G024800.1.v4.1 1035 797.416 2057 122.418 Potri.004G059700.1.v4.1 961 723.421 17 1.1152 Potri.007G009000.2.v4.1 1416 1178.42 0 0 Potri.003G141000.2.v4.1 2943 2705.42 452.872 7.94398 Potri.016G087400.1.v4.1 270 58.2558 300.149 244.508 Potri.015G069301.1.v4.1 564 326.631 0 0 Potri.010G195200.1.v4.1 1773 1535.42 208 6.42885 Potri.012G127500.1.v4.1 977 739.421 2522 161.864 ==> SRR5933796.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 7 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 2105 SRR5933796 completed mapping pipeline successfully