Starting /dee2/code/volunteer_pipeline.sh SRR5933797 current disk space = 3056251555840 free memory = 1444998056 SRR5933797 SRAfilesize a19327f45c6f633cb7398ff325026162 SRR5933797.sra SRR5933797.sra file validated SRR5933797 is paired end SRR5933797 is conventional basespace SRR5933797 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27 32.0 32.0 32.0 32.0 32.0 2 28.92125 32.0 32.0 32.0 12.0 32.0 3 34.5725 37.0 32.0 37.0 32.0 37.0 4 36.245 37.0 37.0 37.0 37.0 37.0 5 35.71 37.0 37.0 37.0 32.0 37.0 6 37.80875 41.0 37.0 41.0 32.0 41.0 7 34.45525 37.0 32.0 41.0 12.0 41.0 8 37.85 41.0 37.0 41.0 32.0 41.0 9 39.24125 41.0 37.0 41.0 37.0 41.0 10-14 38.56230000000001 41.0 38.6 41.0 34.0 41.0 15-19 37.2082 41.0 36.8 41.0 27.0 41.0 20-24 37.984449999999995 41.0 37.8 41.0 31.0 41.0 25-29 36.29445 40.2 33.8 41.0 24.0 41.0 30-34 38.3048 41.0 38.6 41.0 33.0 41.0 35-39 34.72925 38.4 30.0 41.0 22.0 41.0 40-44 31.99205 35.0 25.0 40.2 14.0 41.0 45-49 27.803050000000002 29.0 19.0 37.8 12.0 41.0 50-54 24.9854 26.0 14.0 35.0 12.0 39.4 55-59 26.807949999999998 26.0 19.0 35.6 14.0 39.4 60-64 27.46565 29.0 20.0 35.6 14.0 39.4 65-69 26.880599999999998 29.0 16.0 36.8 12.0 41.0 70-74 24.97295 25.0 12.0 35.0 12.0 41.0 75-79 22.9001 22.0 14.0 31.0 12.0 36.8 80-84 25.602050000000002 26.0 16.0 36.0 12.0 40.2 85-89 29.0877 31.0 22.0 37.4 18.0 40.2 90-94 29.884499999999996 32.0 21.0 40.2 16.0 41.0 95-99 23.79515 24.0 14.0 33.0 12.0 38.6 100-104 23.7524 24.0 16.0 34.0 12.0 38.6 105-109 21.77935 20.0 12.0 29.0 12.0 37.0 110-114 20.26565 18.0 12.0 26.0 12.0 35.0 115-119 21.2879 20.0 12.0 30.0 12.0 37.0 120-124 17.537100000000002 14.0 12.0 24.0 8.8 30.0 125-129 16.2181 12.0 12.0 22.0 8.0 28.0 130-134 15.237799999999998 12.0 12.0 22.0 8.0 25.0 135-139 14.869049999999998 12.0 12.0 20.0 8.0 22.0 140-144 14.60975 12.0 12.0 22.0 8.0 22.0 145-149 15.5399 12.0 12.0 22.0 8.0 25.0 150 15.28475 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 17 1.0 18 5.0 19 32.0 20 79.0 21 175.0 22 320.0 23 421.0 24 452.0 25 460.0 26 388.0 27 352.0 28 356.0 29 323.0 30 257.0 31 187.0 32 118.0 33 54.0 34 12.0 35 4.0 36 3.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.77777777777778 18.04281345565749 19.164118246687053 35.015290519877674 2 26.0 27.400000000000002 33.125 13.475000000000001 3 21.125 30.45 27.075 21.349999999999998 4 23.103879849812266 34.993742177722154 21.201501877346686 20.700876095118897 5 22.3 37.25 23.5 16.950000000000003 6 17.25 38.85 23.575 20.325 7 16.3 16.525000000000002 44.975 22.2 8 19.75 23.175 27.725 29.349999999999998 9 21.125 23.075000000000003 29.099999999999998 26.700000000000003 10-14 20.925 30.055 27.82 21.2 15-19 21.235 27.975 28.189999999999998 22.6 20-24 20.79 28.76 27.91 22.54 25-29 21.498599439775912 29.04661864745898 27.846138455382153 21.608643457382954 30-34 20.845 29.07 27.589999999999996 22.495 35-39 21.875 29.154999999999998 27.845 21.125 40-44 21.345 28.605000000000004 28.38 21.67 45-49 22.52 28.71 28.139999999999997 20.630000000000003 50-54 22.445 28.58 28.935 20.04 55-59 23.06 27.994999999999997 28.975 19.97 60-64 22.650000000000002 27.98 28.53 20.84 65-69 22.445 28.595 28.044999999999998 20.915 70-74 21.805 28.89 28.285 21.02 75-79 22.37 28.189999999999998 29.509999999999998 19.93 80-84 21.404999999999998 29.12 27.894999999999996 21.58 85-89 21.98 28.54 28.95 20.53 90-94 21.41 27.85 29.335 21.404999999999998 95-99 21.23 28.54 29.48 20.75 100-104 22.215 28.01 29.345 20.43 105-109 22.245 27.589999999999996 29.2 20.965 110-114 22.634999999999998 28.799999999999997 29.445 19.12 115-119 22.264999999999997 27.810000000000002 28.615000000000002 21.310000000000002 120-124 22.555 27.435 30.769999999999996 19.24 125-129 23.380000000000003 26.810000000000002 30.445 19.365 130-134 23.375 26.855 30.805 18.965 135-139 22.85 28.285 30.61 18.255 140-144 24.09 27.439999999999998 30.209999999999997 18.26 145-149 22.955000000000002 27.675 29.23 20.14 150 21.975 26.950000000000003 30.7 20.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.5 14 2.0 15 2.0 16 1.5 17 0.5 18 1.0 19 3.0 20 4.5 21 3.5 22 4.5 23 7.0 24 7.5 25 11.5 26 15.0 27 14.0 28 15.5 29 22.5 30 26.5 31 37.0 32 51.0 33 66.0 34 84.5 35 91.0 36 117.5 37 146.0 38 159.0 39 180.0 40 198.0 41 227.5 42 239.5 43 243.0 44 252.0 45 232.0 46 212.5 47 191.5 48 186.0 49 181.0 50 153.0 51 135.0 52 106.0 53 71.0 54 52.0 55 46.5 56 38.5 57 29.0 58 27.5 59 17.0 60 11.0 61 11.5 62 9.0 63 7.5 64 4.0 65 4.0 66 6.0 67 5.0 68 4.0 69 4.0 70 2.0 71 0.5 72 2.0 73 2.0 74 2.5 75 2.5 76 1.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.04 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.90602655771195 95.85000000000001 2 2.0429009193054135 4.0 3 0.05107252298263534 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.1375 0.0 0.0 0.0 0.0 138 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933797 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933797_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2325 32.0 32.0 32.0 27.0 32.0 2 31.09875 32.0 32.0 32.0 32.0 32.0 3 34.59625 37.0 32.0 37.0 32.0 37.0 4 35.51625 37.0 37.0 37.0 32.0 37.0 5 34.715 37.0 37.0 37.0 32.0 37.0 6 36.13625 41.0 37.0 41.0 22.0 41.0 7 33.46425 37.0 27.0 41.0 12.0 41.0 8 38.322 41.0 37.0 41.0 32.0 41.0 9 38.49425 41.0 37.0 41.0 32.0 41.0 10-14 38.4408 41.0 39.4 41.0 33.0 41.0 15-19 36.9771 40.2 35.0 41.0 26.0 41.0 20-24 37.63244999999999 41.0 37.6 41.0 29.0 41.0 25-29 38.418949999999995 41.0 38.6 41.0 32.0 41.0 30-34 38.55765 41.0 39.4 41.0 33.0 41.0 35-39 38.968999999999994 41.0 41.0 41.0 35.0 41.0 40-44 38.63145000000001 41.0 41.0 41.0 33.0 41.0 45-49 38.119299999999996 41.0 38.6 41.0 31.0 41.0 50-54 38.3962 41.0 37.8 41.0 32.0 41.0 55-59 37.70685 41.0 37.0 41.0 29.0 41.0 60-64 36.607549999999996 41.0 36.0 41.0 25.0 41.0 65-69 36.8568 41.0 36.0 41.0 25.0 41.0 70-74 36.4634 41.0 36.0 41.0 23.0 41.0 75-79 34.29600000000001 37.6 31.0 41.0 20.0 41.0 80-84 36.33755 41.0 35.0 41.0 24.0 41.0 85-89 34.79795 39.4 32.0 41.0 20.0 41.0 90-94 33.09925 37.0 30.0 41.0 12.0 41.0 95-99 35.0584 39.4 32.0 41.0 22.0 41.0 100-104 31.459450000000004 34.8 25.0 40.2 16.0 41.0 105-109 29.405849999999997 31.0 20.0 38.6 14.0 41.0 110-114 29.19815 32.0 23.0 38.6 12.0 41.0 115-119 26.088900000000002 27.0 16.0 36.0 12.0 41.0 120-124 27.284549999999996 29.0 18.0 37.0 12.0 41.0 125-129 25.03265 26.0 12.0 36.0 12.0 40.2 130-134 25.42785 27.0 14.0 37.0 12.0 41.0 135-139 25.9261 27.0 16.0 37.0 12.0 41.0 140-144 25.4588 27.0 14.0 37.0 12.0 41.0 145-149 25.04 26.0 12.0 35.0 12.0 40.2 150 24.69125 27.0 12.0 37.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 3.0 17 4.0 18 2.0 19 13.0 20 13.0 21 27.0 22 25.0 23 50.0 24 56.0 25 76.0 26 101.0 27 115.0 28 170.0 29 209.0 30 231.0 31 233.0 32 292.0 33 306.0 34 335.0 35 378.0 36 355.0 37 405.0 38 346.0 39 206.0 40 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.721496284909044 17.72995131949782 19.318472969510633 34.2300794260825 2 25.074999999999996 27.200000000000003 33.875 13.850000000000001 3 21.2 30.875000000000004 26.525 21.4 4 24.075 33.95 21.875 20.1 5 23.525 37.55 22.0 16.925 6 16.150000000000002 39.050000000000004 24.075 20.724999999999998 7 15.275 16.375 44.95 23.400000000000002 8 19.05 22.425 28.9 29.625 9 19.825 23.724999999999998 30.3 26.150000000000002 10-14 20.544999999999998 30.095 27.755000000000003 21.605 15-19 21.52 28.050000000000004 28.42 22.009999999999998 20-24 21.52 29.53 27.224999999999998 21.725 25-29 21.4 28.34 28.54 21.72 30-34 21.04 28.92 28.044999999999998 21.995 35-39 21.66 29.044999999999998 27.685 21.61 40-44 21.245 28.689999999999998 27.994999999999997 22.07 45-49 21.515 29.075 27.595 21.815 50-54 21.224999999999998 28.825 28.265 21.685 55-59 21.54 28.425 28.115000000000002 21.92 60-64 21.634999999999998 28.744999999999997 27.965 21.654999999999998 65-69 21.75 28.389999999999997 28.050000000000004 21.81 70-74 22.155 28.38 27.93 21.535 75-79 21.705 28.335 28.38 21.58 80-84 21.61 28.93 27.474999999999998 21.985 85-89 22.115000000000002 28.249999999999996 27.950000000000003 21.685 90-94 22.215 28.475 27.529999999999998 21.78 95-99 21.84 28.33 27.534999999999997 22.295 100-104 22.220000000000002 28.465 28.09 21.224999999999998 105-109 22.49 27.735 27.88 21.895 110-114 21.790000000000003 28.015 27.71 22.485 115-119 22.95 27.48 28.04 21.529999999999998 120-124 22.415 27.944999999999997 27.55 22.09 125-129 22.52 27.805000000000003 27.634999999999998 22.040000000000003 130-134 22.065 28.244999999999997 27.450000000000003 22.24 135-139 22.755 27.224999999999998 28.13 21.89 140-144 23.294999999999998 27.805000000000003 27.33 21.57 145-149 22.45 28.54 26.674999999999997 22.335 150 22.75 28.575 26.55 22.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 1.0 14 1.0 15 2.0 16 2.0 17 1.5 18 1.5 19 1.5 20 2.0 21 3.0 22 3.0 23 2.5 24 4.5 25 9.5 26 10.0 27 13.5 28 20.5 29 23.5 30 27.5 31 36.5 32 47.5 33 65.0 34 77.0 35 84.5 36 112.0 37 129.0 38 138.0 39 172.5 40 195.0 41 205.5 42 222.5 43 243.0 44 264.0 45 246.0 46 219.5 47 228.0 48 216.0 49 176.0 50 146.5 51 127.0 52 103.0 53 74.0 54 63.5 55 58.0 56 37.5 57 28.0 58 28.0 59 26.0 60 18.5 61 10.5 62 11.0 63 8.0 64 7.5 65 5.0 66 3.5 67 5.5 68 5.0 69 3.0 70 2.5 71 2.5 72 1.5 73 3.0 74 2.5 75 1.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16679800367743 90.575 2 4.596795376937221 8.75 3 0.2364066193853428 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACGTC 10 0.0069754543 143.9875 3 CACGTCC 10 0.0069754543 143.9875 4 >>END_MODULE Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra Read 1172623 spots for SRR5933797.sra Written 1172623 spots for SRR5933797.sra SRR ids: ['SRR5933797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hliwsw1_ SRR5933797.sra spots: 23452460 blocks: [[1, 1172623], [1172624, 2345246], [2345247, 3517869], [3517870, 4690492], [4690493, 5863115], [5863116, 7035738], [7035739, 8208361], [8208362, 9380984], [9380985, 10553607], [10553608, 11726230], [11726231, 12898853], [12898854, 14071476], [14071477, 15244099], [15244100, 16416722], [16416723, 17589345], [17589346, 18761968], [18761969, 19934591], [19934592, 21107214], [21107215, 22279837], [22279838, 23452460]] SRR5933797 file size 7879763 SRR5933797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933797 SRR5933797_1.fastq SRR5933797_2.fastq Input file: SRR5933797_1.fastq Paired file: SRR5933797_2.fastq trimmed: SRR5933797-trimmed-pair1.fastq, SRR5933797-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:11:53 2025 >> started Mon Feb 10 20:12:31 2025 >> done (37.582s) 23452460 read pairs processed; of these: 269 ( 0.00%) short read pairs filtered out after trimming by size control 91 ( 0.00%) empty read pairs filtered out after trimming by size control 23452100 (100.00%) read pairs available; of these: 1585523 ( 6.76%) trimmed read pairs available after processing 21866577 (93.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 42 0.00% 19 38 0.00% 20 61 0.00% 21 70 0.00% 22 61 0.00% 23 79 0.00% 24 100 0.00% 25 100 0.00% 26 122 0.00% 27 131 0.00% 28 145 0.00% 29 130 0.00% 30 149 0.00% 31 161 0.00% 32 186 0.00% 33 144 0.00% 34 167 0.00% 35 155 0.00% 36 193 0.00% 37 168 0.00% 38 191 0.00% 39 188 0.00% 40 206 0.00% 41 192 0.00% 42 212 0.00% 43 187 0.00% 44 217 0.00% 45 209 0.00% 46 211 0.00% 47 200 0.00% 48 210 0.00% 49 220 0.00% 50 257 0.00% 51 270 0.00% 52 251 0.00% 53 270 0.00% 54 266 0.00% 55 250 0.00% 56 290 0.00% 57 236 0.00% 58 246 0.00% 59 260 0.00% 60 291 0.00% 61 261 0.00% 62 264 0.00% 63 297 0.00% 64 268 0.00% 65 310 0.00% 66 295 0.00% 67 301 0.00% 68 312 0.00% 69 307 0.00% 70 321 0.00% 71 339 0.00% 72 332 0.00% 73 394 0.00% 74 351 0.00% 75 408 0.00% 76 402 0.00% 77 441 0.00% 78 486 0.00% 79 498 0.00% 80 535 0.00% 81 594 0.00% 82 636 0.00% 83 653 0.00% 84 700 0.00% 85 719 0.00% 86 771 0.00% 87 759 0.00% 88 828 0.00% 89 907 0.00% 90 1033 0.00% 91 1070 0.00% 92 1276 0.01% 93 1361 0.01% 94 1329 0.01% 95 1492 0.01% 96 1582 0.01% 97 1769 0.01% 98 1888 0.01% 99 1888 0.01% 100 1998 0.01% 101 2138 0.01% 102 2201 0.01% 103 2438 0.01% 104 2658 0.01% 105 2872 0.01% 106 3049 0.01% 107 3101 0.01% 108 3256 0.01% 109 3567 0.02% 110 3727 0.02% 111 3814 0.02% 112 4120 0.02% 113 4364 0.02% 114 4533 0.02% 115 4895 0.02% 116 5095 0.02% 117 5501 0.02% 118 5613 0.02% 119 6043 0.03% 120 6101 0.03% 121 6439 0.03% 122 6856 0.03% 123 7152 0.03% 124 7454 0.03% 125 8059 0.03% 126 8313 0.04% 127 8615 0.04% 128 9037 0.04% 129 9414 0.04% 130 10009 0.04% 131 10417 0.04% 132 10673 0.05% 133 11340 0.05% 134 11913 0.05% 135 12595 0.05% 136 13025 0.06% 137 13562 0.06% 138 14134 0.06% 139 14569 0.06% 140 15323 0.07% 141 15943 0.07% 142 16800 0.07% 143 17600 0.08% 144 18609 0.08% 145 20545 0.09% 146 23634 0.10% 147 36739 0.16% 148 111641 0.48% 149 997920 4.26% 150 21866577 93.24% 23452100 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=25 prefix-density=0.14 prefix-fanout=3.6 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=115.50 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=18.1 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=24 prefix-density=0.13 prefix-fanout=3.5 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=113.71 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=17.7 sequence=GCTGCTGCTGCT SRR5933797 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:14:30 Started mapping on | Feb 10 20:14:30 Finished on | Feb 10 20:25:12 Mapping speed, Million of reads per hour | 131.51 Number of input reads | 23452100 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16656454 Uniquely mapped reads % | 71.02% Average mapped length | 280.20 Number of splices: Total | 12144512 Number of splices: Annotated (sjdb) | 11400982 Number of splices: GT/AG | 11803113 Number of splices: GC/AG | 156140 Number of splices: AT/AC | 8510 Number of splices: Non-canonical | 176749 Mismatch rate per base, % | 2.27% Deletion rate per base | 0.15% Deletion average length | 3.23 Insertion rate per base | 0.10% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1452905 % of reads mapped to multiple loci | 6.20% Number of reads mapped to too many loci | 35027 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.01% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5342742 5342742 5342742 N_multimapping 1452905 1452905 1452905 N_noFeature 517213 8544738 8534953 N_ambiguous 371551 140278 140025 UnstrandedReadsAssigned:15767690 PositiveStrandReadsAssigned:7971438 NegativeStrandReadsAssigned:7981476 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933797 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933797-trimmed-pair1.fastq SRR5933797-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,452,100 reads, 16,572,963 reads pseudoaligned [quant] estimated average fragment length: 236.294 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR5933797.ke.tsv 34699 SRR5933797.se.tsv 87100 total ==> SRR5933797.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.71 5769.21 163.659 Potri.005G024800.1.v4.1 1035 799.706 1916 121.162 Potri.004G059700.1.v4.1 961 725.706 16 1.11497 Potri.007G009000.2.v4.1 1416 1180.71 0 0 Potri.003G141000.2.v4.1 2943 2707.71 382 7.13451 Potri.016G087400.1.v4.1 270 59.0852 267 228.526 Potri.015G069301.1.v4.1 564 328.907 0 0 Potri.010G195200.1.v4.1 1773 1537.71 184.857 6.07944 Potri.012G127500.1.v4.1 977 741.706 2034 138.682 ==> SRR5933797.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 15 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2325 SRR5933797 completed mapping pipeline successfully