Starting /dee2/code/volunteer_pipeline.sh SRR5933798 current disk space = 3056351272960 free memory = 1484240660 SRR5933798 SRAfilesize 15b0105139156aae4bb5c218e0c3d39d SRR5933798.sra SRR5933798.sra file validated SRR5933798 is paired end SRR5933798 is conventional basespace SRR5933798 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.58125 32.0 2.0 32.0 2.0 32.0 2 27.8825 32.0 27.0 32.0 12.0 32.0 3 33.0975 32.0 32.0 37.0 32.0 37.0 4 35.92625 37.0 37.0 37.0 32.0 37.0 5 35.77375 37.0 37.0 37.0 32.0 37.0 6 39.28375 41.0 41.0 41.0 37.0 41.0 7 39.57 41.0 41.0 41.0 37.0 41.0 8 39.786 41.0 41.0 41.0 37.0 41.0 9 39.93525 41.0 41.0 41.0 37.0 41.0 10-14 39.82445 41.0 41.0 41.0 37.0 41.0 15-19 39.891149999999996 41.0 41.0 41.0 37.0 41.0 20-24 39.75825 41.0 41.0 41.0 37.0 41.0 25-29 39.41754999999999 41.0 41.0 41.0 36.0 41.0 30-34 39.6183 41.0 41.0 41.0 37.0 41.0 35-39 39.328799999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.4908 41.0 41.0 41.0 36.0 41.0 45-49 39.399950000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.0557 41.0 41.0 41.0 35.0 41.0 55-59 38.73205 41.0 39.4 41.0 34.0 41.0 60-64 39.269949999999994 41.0 41.0 41.0 36.0 41.0 65-69 39.127599999999994 41.0 41.0 41.0 36.0 41.0 70-74 39.2136 41.0 41.0 41.0 37.0 41.0 75-79 38.92165 41.0 39.4 41.0 34.0 41.0 80-84 38.800000000000004 41.0 40.2 41.0 34.0 41.0 85-89 38.53895 41.0 38.6 41.0 34.0 41.0 90-94 38.79690000000001 41.0 40.2 41.0 33.0 41.0 95-99 38.8861 41.0 40.2 41.0 35.0 41.0 100-104 38.51695 41.0 40.2 41.0 31.0 41.0 105-109 38.58919999999999 41.0 39.4 41.0 33.0 41.0 110-114 38.24435 41.0 37.0 41.0 32.0 41.0 115-119 37.3328 41.0 36.0 41.0 29.0 41.0 120-124 36.561099999999996 40.2 36.0 41.0 26.0 41.0 125-129 34.5354 38.6 32.0 41.0 18.0 41.0 130-134 34.806650000000005 39.4 34.0 41.0 18.0 41.0 135-139 33.419 38.6 29.0 41.0 16.0 41.0 140-144 33.874249999999996 39.4 29.0 41.0 18.0 41.0 145-149 29.26495 32.0 21.0 38.4 14.0 41.0 150 29.355 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 3.0 22 2.0 23 3.0 24 3.0 25 13.0 26 16.0 27 19.0 28 35.0 29 52.0 30 67.0 31 73.0 32 92.0 33 117.0 34 136.0 35 229.0 36 304.0 37 375.0 38 608.0 39 1093.0 40 757.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.456668163448583 17.377638078132016 18.1859003143242 34.9797934440952 2 24.775 26.55 34.025 14.649999999999999 3 22.625 29.25 26.875 21.25 4 24.0 34.849999999999994 20.349999999999998 20.8 5 22.5 37.6 22.775000000000002 17.125 6 16.45 39.574999999999996 23.95 20.025000000000002 7 13.925 18.175 45.525 22.375 8 19.45 22.075 28.875 29.599999999999998 9 21.45 23.5 28.525 26.525 10-14 20.105 30.964999999999996 27.91 21.02 15-19 20.71 29.049999999999997 27.88 22.36 20-24 21.65 29.53 26.979999999999997 21.84 25-29 21.375 29.78 27.575 21.27 30-34 20.955 28.605000000000004 27.765 22.675 35-39 21.310000000000002 28.775000000000002 27.655 22.259999999999998 40-44 20.560000000000002 28.88 28.235 22.325 45-49 20.76 29.25 27.83 22.16 50-54 21.815 28.525 28.060000000000002 21.6 55-59 21.584999999999997 28.62 27.61 22.185 60-64 21.4 28.355000000000004 28.134999999999998 22.11 65-69 21.58 29.270000000000003 27.115000000000002 22.035 70-74 21.529999999999998 29.134999999999998 27.85 21.485000000000003 75-79 21.95 29.054999999999996 28.095 20.9 80-84 22.075 28.675 28.055000000000003 21.195 85-89 21.915000000000003 28.585 27.665 21.834999999999997 90-94 21.645 28.110000000000003 27.755000000000003 22.49 95-99 22.065 28.395 27.615000000000002 21.925 100-104 22.215 27.98 28.225 21.58 105-109 21.675 28.515 28.060000000000002 21.75 110-114 22.045 28.205000000000002 28.04 21.709999999999997 115-119 21.4 28.32 27.985 22.295 120-124 22.045 28.22 28.04 21.695 125-129 21.92 28.12 28.439999999999998 21.52 130-134 21.925 27.76 28.610000000000003 21.705 135-139 22.035 27.925 28.715000000000003 21.325 140-144 22.025 28.58 27.884999999999998 21.51 145-149 21.675 28.599999999999998 29.34 20.385 150 21.8 27.224999999999998 29.349999999999998 21.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 3.0 14 2.5 15 0.5 16 1.0 17 0.5 18 1.5 19 3.0 20 3.0 21 3.0 22 4.0 23 4.5 24 4.5 25 6.0 26 7.5 27 14.0 28 22.5 29 30.5 30 35.5 31 36.5 32 43.5 33 65.5 34 79.5 35 91.5 36 112.5 37 131.5 38 143.0 39 166.0 40 191.0 41 213.5 42 241.0 43 244.5 44 251.0 45 257.5 46 241.0 47 227.5 48 213.5 49 166.5 50 139.5 51 126.5 52 99.0 53 83.5 54 69.0 55 46.5 56 29.5 57 29.5 58 25.5 59 20.5 60 16.0 61 9.0 62 5.0 63 1.5 64 2.0 65 2.0 66 2.5 67 3.5 68 3.0 69 1.5 70 1.0 71 2.0 72 3.0 73 2.5 74 1.5 75 2.0 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 44.324999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1470034936845 86.65 2 6.261757592045149 11.65 3 0.5374899220639613 1.5 4 0.053748992206396125 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.45 0.0 0.0 0.0 0.0 132-133 0.5375 0.0 0.0 0.0 0.0 134-135 0.675 0.0 0.0 0.0 0.0 136-137 0.775 0.0 0.0 0.0 0.0 138 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACTA 10 0.0070392117 143.55 4 AACTAAA 10 0.0070392117 143.55 6 AAGAAAC 10 0.0070392117 143.55 2 GTGGAGG 10 0.0070392117 143.55 6 >>END_MODULE SRR5933798 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933798_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.91375 32.0 2.0 32.0 2.0 32.0 2 30.68 32.0 32.0 32.0 32.0 32.0 3 32.91625 32.0 32.0 37.0 32.0 37.0 4 34.4275 37.0 32.0 37.0 32.0 37.0 5 35.07375 37.0 37.0 37.0 32.0 37.0 6 37.49725 41.0 37.0 41.0 32.0 41.0 7 35.95825 41.0 37.0 41.0 22.0 41.0 8 39.07775 41.0 37.0 41.0 37.0 41.0 9 39.20825 41.0 41.0 41.0 37.0 41.0 10-14 39.11280000000001 41.0 41.0 41.0 36.0 41.0 15-19 38.93044999999999 41.0 40.2 41.0 35.0 41.0 20-24 38.481550000000006 41.0 39.4 41.0 32.0 41.0 25-29 38.2495 41.0 37.8 41.0 32.0 41.0 30-34 38.31975 41.0 37.8 41.0 32.0 41.0 35-39 38.08325 41.0 37.8 41.0 31.0 41.0 40-44 38.99464999999999 41.0 40.2 41.0 35.0 41.0 45-49 39.186049999999994 41.0 41.0 41.0 37.0 41.0 50-54 38.75384999999999 41.0 41.0 41.0 33.0 41.0 55-59 38.20635 41.0 37.8 41.0 32.0 41.0 60-64 37.697849999999995 41.0 37.0 41.0 30.0 41.0 65-69 36.13485 41.0 35.0 41.0 22.0 41.0 70-74 36.4895 41.0 36.0 41.0 25.0 41.0 75-79 36.468900000000005 40.2 35.0 41.0 26.0 41.0 80-84 36.18445 41.0 35.0 41.0 24.0 41.0 85-89 35.66735 41.0 34.0 41.0 23.0 41.0 90-94 34.1079 37.0 30.0 41.0 18.0 41.0 95-99 34.682249999999996 37.8 32.0 41.0 20.0 41.0 100-104 35.0505 37.0 34.0 41.0 20.0 41.0 105-109 33.58925000000001 37.0 31.0 41.0 14.0 41.0 110-114 33.63405 37.0 30.0 41.0 16.0 41.0 115-119 31.1963 35.0 25.0 41.0 12.0 41.0 120-124 29.400050000000004 32.0 22.0 38.6 12.0 41.0 125-129 29.4144 32.0 21.0 39.4 12.0 41.0 130-134 27.28005 28.0 18.0 37.0 12.0 41.0 135-139 23.874549999999996 25.0 12.0 33.0 12.0 39.4 140-144 20.90435 17.0 12.0 29.0 10.4 37.8 145-149 21.51945 20.0 12.0 29.0 12.0 36.0 150 18.252 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 3.0 18 6.0 19 8.0 20 7.0 21 20.0 22 28.0 23 38.0 24 36.0 25 64.0 26 78.0 27 105.0 28 109.0 29 130.0 30 177.0 31 240.0 32 231.0 33 318.0 34 365.0 35 393.0 36 466.0 37 512.0 38 414.0 39 213.0 40 36.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.898488120950322 16.15550755939525 18.61771058315335 36.328293736501074 2 24.625 27.3 32.074999999999996 16.0 3 23.65 29.049999999999997 26.325 20.974999999999998 4 24.975 33.425 21.625 19.975 5 24.099999999999998 38.25 21.25 16.400000000000002 6 16.875 40.0 23.525 19.6 7 14.799999999999999 16.875 45.074999999999996 23.25 8 19.15 21.45 29.925 29.475 9 22.15 23.125 29.125 25.6 10-14 20.145 30.680000000000003 28.01 21.165 15-19 21.25 28.125 28.765 21.86 20-24 21.709999999999997 29.445 27.275 21.57 25-29 21.13 28.655 28.01 22.205 30-34 21.2 29.770000000000003 27.87 21.16 35-39 20.979999999999997 29.54 28.084999999999997 21.395 40-44 21.985 29.085 27.79 21.14 45-49 21.295 28.744999999999997 28.17 21.790000000000003 50-54 21.66 28.28 28.15 21.91 55-59 21.26 29.28 27.800000000000004 21.66 60-64 21.415 28.599999999999998 28.1 21.884999999999998 65-69 21.8 29.265 27.455000000000002 21.48 70-74 21.83 28.994999999999997 27.685 21.490000000000002 75-79 22.015 28.615000000000002 28.110000000000003 21.26 80-84 21.834999999999997 28.42 28.465 21.279999999999998 85-89 22.105 28.299999999999997 28.13 21.465 90-94 21.75 29.080000000000002 27.96 21.21 95-99 21.775 28.139999999999997 28.165000000000003 21.92 100-104 21.465 28.155 28.005000000000003 22.375 105-109 21.47 28.99 28.095 21.445 110-114 22.275 28.38 28.265 21.08 115-119 21.8 28.860000000000003 27.48 21.86 120-124 21.990000000000002 29.235 27.905 20.87 125-129 22.205 28.835 27.68 21.279999999999998 130-134 21.884999999999998 28.835 28.000000000000004 21.279999999999998 135-139 23.11 29.044999999999998 27.415 20.43 140-144 23.244999999999997 28.825 28.225 19.705000000000002 145-149 22.215 28.299999999999997 29.26 20.225 150 24.025 29.799999999999997 31.25 14.924999999999999 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 0.5 20 1.5 21 2.5 22 3.0 23 6.0 24 8.5 25 10.5 26 13.5 27 20.0 28 26.5 29 33.0 30 36.0 31 43.0 32 56.0 33 58.5 34 63.0 35 84.0 36 101.0 37 127.5 38 159.5 39 182.0 40 201.0 41 230.0 42 258.5 43 259.0 44 241.0 45 228.5 46 237.5 47 228.0 48 201.0 49 166.5 50 143.0 51 115.0 52 85.0 53 76.5 54 61.5 55 48.0 56 40.5 57 29.5 58 15.5 59 12.5 60 14.5 61 12.5 62 10.5 63 9.5 64 7.0 65 3.0 66 2.5 67 3.5 68 2.5 69 1.5 70 2.0 71 1.5 72 0.5 73 2.0 74 2.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 42.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78003203416978 87.825 2 5.6860651361452215 10.65 3 0.5072076882007475 1.425 4 0.026695141484249865 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.9 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTGC 10 0.0070337174 143.5875 3 GTGCAAA 10 0.0070337174 143.5875 6 AACTGTG 10 0.0070337174 143.5875 2 ACACCAA 10 0.0070337174 143.5875 5 >>END_MODULE Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230761 spots for SRR5933798.sra Written 1230761 spots for SRR5933798.sra Read 1230778 spots for SRR5933798.sra Written 1230778 spots for SRR5933798.sra SRR ids: ['SRR5933798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ew49b6j SRR5933798.sra spots: 24615237 blocks: [[1, 1230761], [1230762, 2461522], [2461523, 3692283], [3692284, 4923044], [4923045, 6153805], [6153806, 7384566], [7384567, 8615327], [8615328, 9846088], [9846089, 11076849], [11076850, 12307610], [12307611, 13538371], [13538372, 14769132], [14769133, 15999893], [15999894, 17230654], [17230655, 18461415], [18461416, 19692176], [19692177, 20922937], [20922938, 22153698], [22153699, 23384459], [23384460, 24615237]] SRR5933798 file size 8271519 SRR5933798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933798 SRR5933798_1.fastq SRR5933798_2.fastq Input file: SRR5933798_1.fastq Paired file: SRR5933798_2.fastq trimmed: SRR5933798-trimmed-pair1.fastq, SRR5933798-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:00:31 2025 >> started Mon Feb 10 21:00:57 2025 >> done (26.488s) 24615237 read pairs processed; of these: 240 ( 0.00%) short read pairs filtered out after trimming by size control 63 ( 0.00%) empty read pairs filtered out after trimming by size control 24614934 (100.00%) read pairs available; of these: 1660933 ( 6.75%) trimmed read pairs available after processing 22954001 (93.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 50 0.00% 19 57 0.00% 20 79 0.00% 21 117 0.00% 22 149 0.00% 23 227 0.00% 24 259 0.00% 25 267 0.00% 26 296 0.00% 27 317 0.00% 28 319 0.00% 29 350 0.00% 30 392 0.00% 31 418 0.00% 32 406 0.00% 33 400 0.00% 34 396 0.00% 35 434 0.00% 36 430 0.00% 37 495 0.00% 38 495 0.00% 39 455 0.00% 40 496 0.00% 41 445 0.00% 42 464 0.00% 43 486 0.00% 44 457 0.00% 45 476 0.00% 46 520 0.00% 47 561 0.00% 48 517 0.00% 49 491 0.00% 50 523 0.00% 51 560 0.00% 52 524 0.00% 53 543 0.00% 54 542 0.00% 55 534 0.00% 56 505 0.00% 57 485 0.00% 58 470 0.00% 59 505 0.00% 60 523 0.00% 61 528 0.00% 62 471 0.00% 63 521 0.00% 64 508 0.00% 65 506 0.00% 66 488 0.00% 67 483 0.00% 68 454 0.00% 69 482 0.00% 70 540 0.00% 71 486 0.00% 72 541 0.00% 73 516 0.00% 74 519 0.00% 75 540 0.00% 76 495 0.00% 77 559 0.00% 78 649 0.00% 79 543 0.00% 80 556 0.00% 81 561 0.00% 82 564 0.00% 83 630 0.00% 84 635 0.00% 85 645 0.00% 86 734 0.00% 87 664 0.00% 88 709 0.00% 89 755 0.00% 90 825 0.00% 91 794 0.00% 92 866 0.00% 93 888 0.00% 94 953 0.00% 95 997 0.00% 96 1067 0.00% 97 1038 0.00% 98 1198 0.00% 99 1283 0.01% 100 1367 0.01% 101 1472 0.01% 102 1504 0.01% 103 1637 0.01% 104 1755 0.01% 105 1763 0.01% 106 1870 0.01% 107 2007 0.01% 108 2106 0.01% 109 2215 0.01% 110 2422 0.01% 111 2415 0.01% 112 2569 0.01% 113 2859 0.01% 114 2912 0.01% 115 3153 0.01% 116 3216 0.01% 117 3462 0.01% 118 3730 0.02% 119 3777 0.02% 120 4089 0.02% 121 4469 0.02% 122 4484 0.02% 123 4934 0.02% 124 5021 0.02% 125 5256 0.02% 126 5608 0.02% 127 5879 0.02% 128 6046 0.02% 129 6271 0.03% 130 6653 0.03% 131 6951 0.03% 132 7410 0.03% 133 7638 0.03% 134 8454 0.03% 135 8770 0.04% 136 8966 0.04% 137 9370 0.04% 138 10024 0.04% 139 10322 0.04% 140 10797 0.04% 141 11252 0.05% 142 11863 0.05% 143 12945 0.05% 144 13258 0.05% 145 15048 0.06% 146 19238 0.08% 147 35484 0.14% 148 127774 0.52% 149 1174822 4.77% 150 22954001 93.25% 24614934 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=27 prefix-density=0.12 prefix-fanout=3.4 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=116.29 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=17.8 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=28 prefix-density=0.12 prefix-fanout=3.5 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=118.13 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=18.3 sequence=GCTGCTGCTGCT SRR5933798 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 21:17:09 Started mapping on | Feb 10 21:17:09 Finished on | Feb 10 21:25:18 Mapping speed, Million of reads per hour | 181.17 Number of input reads | 24609076 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 18208558 Uniquely mapped reads % | 73.99% Average mapped length | 269.02 Number of splices: Total | 12305171 Number of splices: Annotated (sjdb) | 11538529 Number of splices: GT/AG | 11954462 Number of splices: GC/AG | 156831 Number of splices: AT/AC | 8620 Number of splices: Non-canonical | 185258 Mismatch rate per base, % | 2.31% Deletion rate per base | 0.15% Deletion average length | 3.20 Insertion rate per base | 0.09% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1581516 % of reads mapped to multiple loci | 6.43% Number of reads mapped to too many loci | 31892 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.87% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4819539 4819539 4819539 N_multimapping 1581516 1581516 1581516 N_noFeature 619475 9381932 9347522 N_ambiguous 405562 154186 155585 UnstrandedReadsAssigned:17183521 PositiveStrandReadsAssigned:8672440 NegativeStrandReadsAssigned:8705451 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR5933798 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933798-trimmed-pair1.fastq SRR5933798-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,609,076 reads, 18,199,294 reads pseudoaligned [quant] estimated average fragment length: 226.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR5933798.ke.tsv 34699 SRR5933798.se.tsv 87100 total ==> SRR5933798.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.02 6086.74 160.971 Potri.005G024800.1.v4.1 1035 809.019 2007 117.57 Potri.004G059700.1.v4.1 961 735.019 12 0.77373 Potri.007G009000.2.v4.1 1416 1190.02 0 0 Potri.003G141000.2.v4.1 2943 2717.02 502.302 8.76151 Potri.016G087400.1.v4.1 270 62.638 357.161 270.229 Potri.015G069301.1.v4.1 564 338.239 0 0 Potri.010G195200.1.v4.1 1773 1547.02 158 4.84025 Potri.012G127500.1.v4.1 977 751.019 2385 150.503 ==> SRR5933798.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 140 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 11 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 2305 SRR5933798 completed mapping pipeline successfully