Starting /dee2/code/volunteer_pipeline.sh SRR5933799 current disk space = 3056147730432 free memory = 1207857348 SRR5933799 SRAfilesize e50bb6f337603ca249cfce9e887c1fd3 SRR5933799.sra SRR5933799.sra file validated SRR5933799 is paired end SRR5933799 is conventional basespace SRR5933799 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.13 32.0 2.0 32.0 2.0 32.0 2 27.84 32.0 27.0 32.0 12.0 32.0 3 33.1625 32.0 32.0 37.0 32.0 37.0 4 35.94 37.0 37.0 37.0 32.0 37.0 5 35.84375 37.0 37.0 37.0 32.0 37.0 6 39.25075 41.0 37.0 41.0 37.0 41.0 7 39.482 41.0 41.0 41.0 37.0 41.0 8 39.72775 41.0 41.0 41.0 37.0 41.0 9 39.93575 41.0 41.0 41.0 37.0 41.0 10-14 39.868550000000006 41.0 41.0 41.0 37.0 41.0 15-19 39.8896 41.0 41.0 41.0 37.0 41.0 20-24 39.7339 41.0 41.0 41.0 37.0 41.0 25-29 39.3733 41.0 41.0 41.0 36.0 41.0 30-34 39.53625 41.0 41.0 41.0 37.0 41.0 35-39 39.183 41.0 41.0 41.0 37.0 41.0 40-44 39.43814999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.4289 41.0 41.0 41.0 37.0 41.0 50-54 39.087450000000004 41.0 41.0 41.0 35.0 41.0 55-59 38.73425 41.0 40.2 41.0 34.0 41.0 60-64 39.147949999999994 41.0 41.0 41.0 36.0 41.0 65-69 39.1272 41.0 41.0 41.0 36.0 41.0 70-74 39.2033 41.0 41.0 41.0 37.0 41.0 75-79 38.828849999999996 41.0 39.4 41.0 33.0 41.0 80-84 38.869099999999996 41.0 40.2 41.0 35.0 41.0 85-89 38.505250000000004 41.0 38.6 41.0 33.0 41.0 90-94 38.78905 41.0 40.2 41.0 33.0 41.0 95-99 39.020599999999995 41.0 41.0 41.0 35.0 41.0 100-104 38.610499999999995 41.0 40.2 41.0 33.0 41.0 105-109 38.766650000000006 41.0 41.0 41.0 33.0 41.0 110-114 38.4222 41.0 37.0 41.0 32.0 41.0 115-119 37.361850000000004 41.0 36.0 41.0 28.0 41.0 120-124 36.623400000000004 40.2 36.0 41.0 27.0 41.0 125-129 34.621950000000005 38.6 32.0 41.0 18.0 41.0 130-134 34.959199999999996 39.4 34.0 41.0 19.0 41.0 135-139 33.76215 38.6 29.0 41.0 16.0 41.0 140-144 34.022000000000006 39.4 29.0 41.0 19.0 41.0 145-149 29.48675 32.0 22.0 38.4 12.0 41.0 150 29.073 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 3.0 22 3.0 23 6.0 24 5.0 25 19.0 26 17.0 27 17.0 28 33.0 29 40.0 30 56.0 31 73.0 32 72.0 33 126.0 34 153.0 35 200.0 36 298.0 37 389.0 38 641.0 39 1138.0 40 710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.95133149678604 18.59504132231405 18.044077134986225 36.40955004591368 2 24.875 26.900000000000002 34.625 13.600000000000001 3 23.150000000000002 28.075 27.750000000000004 21.025 4 23.150000000000002 34.4 21.175 21.275 5 22.75 36.375 24.05 16.825000000000003 6 16.175 39.574999999999996 24.5 19.75 7 14.499999999999998 17.599999999999998 45.475 22.425 8 20.325 22.45 27.950000000000003 29.275000000000002 9 20.849999999999998 24.0 28.15 27.0 10-14 20.705000000000002 30.785 27.96 20.549999999999997 15-19 21.54 27.98 28.595 21.884999999999998 20-24 21.3 29.945 27.26 21.495 25-29 21.495 28.875 28.57 21.060000000000002 30-34 21.060000000000002 28.98 28.12 21.84 35-39 21.529999999999998 28.565 28.310000000000002 21.595 40-44 21.4 28.74 27.860000000000003 22.0 45-49 20.93 28.599999999999998 28.599999999999998 21.87 50-54 21.565 29.294999999999998 27.884999999999998 21.255 55-59 22.115000000000002 28.325 28.165000000000003 21.395 60-64 21.38 28.265 28.605000000000004 21.75 65-69 21.455 28.860000000000003 27.889999999999997 21.795 70-74 21.61 28.165000000000003 28.720000000000002 21.505 75-79 21.745 28.65 27.860000000000003 21.745 80-84 22.075 28.660000000000004 27.935 21.33 85-89 21.715 28.51 28.000000000000004 21.775 90-94 21.765 28.595 28.794999999999998 20.845 95-99 21.759999999999998 28.244999999999997 28.375 21.62 100-104 21.535 28.325 28.310000000000002 21.83 105-109 21.575 28.175 28.299999999999997 21.95 110-114 21.625 28.325 28.165000000000003 21.884999999999998 115-119 21.55 28.715000000000003 28.335 21.4 120-124 22.415 27.634999999999998 28.444999999999997 21.505 125-129 22.445 27.900000000000002 28.555000000000003 21.099999999999998 130-134 21.565 28.665000000000003 28.305000000000003 21.465 135-139 21.88 28.035 29.315 20.77 140-144 21.245 29.42 28.084999999999997 21.25 145-149 21.43 28.93 29.354999999999997 20.285 150 22.575 28.1 28.425 20.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 3.5 20 3.0 21 3.0 22 4.5 23 4.5 24 7.5 25 11.0 26 12.0 27 15.0 28 23.0 29 34.5 30 40.5 31 42.5 32 43.5 33 56.0 34 75.0 35 88.5 36 100.0 37 120.5 38 148.0 39 169.0 40 200.5 41 234.0 42 247.0 43 264.5 44 268.5 45 264.0 46 246.0 47 221.0 48 210.0 49 171.0 50 130.5 51 108.5 52 90.0 53 71.5 54 58.5 55 49.0 56 36.0 57 27.5 58 21.0 59 14.0 60 10.5 61 5.5 62 4.0 63 5.0 64 4.5 65 2.5 66 1.5 67 3.0 68 3.5 69 2.5 70 1.5 71 1.5 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 45.550000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.00699300699301 86.45 2 6.481979558902635 12.049999999999999 3 0.43033889187735336 1.2 4 0.08068854222700376 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.6125 0.0 0.0 0.0 0.0 134-135 0.7124999999999999 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5933799 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933799_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.54375 32.0 2.0 32.0 2.0 32.0 2 30.6925 32.0 32.0 32.0 27.0 32.0 3 33.0875 32.0 32.0 37.0 32.0 37.0 4 34.43875 37.0 32.0 37.0 32.0 37.0 5 35.1925 37.0 37.0 37.0 32.0 37.0 6 37.39575 41.0 37.0 41.0 32.0 41.0 7 35.86825 41.0 37.0 41.0 22.0 41.0 8 39.05075 41.0 41.0 41.0 37.0 41.0 9 39.23525 41.0 41.0 41.0 37.0 41.0 10-14 39.132799999999996 41.0 41.0 41.0 36.0 41.0 15-19 38.9838 41.0 41.0 41.0 35.0 41.0 20-24 38.581100000000006 41.0 39.4 41.0 33.0 41.0 25-29 38.224599999999995 41.0 37.8 41.0 32.0 41.0 30-34 38.38635000000001 41.0 38.6 41.0 32.0 41.0 35-39 38.201350000000005 41.0 37.8 41.0 31.0 41.0 40-44 39.07005 41.0 40.2 41.0 36.0 41.0 45-49 39.3198 41.0 41.0 41.0 37.0 41.0 50-54 38.885149999999996 41.0 41.0 41.0 33.0 41.0 55-59 38.34325 41.0 38.6 41.0 32.0 41.0 60-64 37.778 41.0 37.0 41.0 30.0 41.0 65-69 36.15705 41.0 36.0 41.0 22.0 41.0 70-74 36.5413 41.0 36.0 41.0 25.0 41.0 75-79 36.56795 40.2 35.0 41.0 26.0 41.0 80-84 36.241 41.0 35.0 41.0 25.0 41.0 85-89 35.7613 41.0 35.0 41.0 23.0 41.0 90-94 34.27375 38.6 31.0 41.0 18.0 41.0 95-99 34.70055 37.0 32.0 41.0 20.0 41.0 100-104 35.17095 38.6 34.0 41.0 22.0 41.0 105-109 33.69305000000001 37.0 31.0 41.0 12.0 41.0 110-114 33.677749999999996 37.0 30.0 41.0 18.0 41.0 115-119 31.275150000000004 35.0 26.0 41.0 12.0 41.0 120-124 29.497950000000003 32.0 22.0 38.6 12.0 41.0 125-129 29.557650000000002 31.0 21.0 40.2 12.0 41.0 130-134 27.2678 28.0 18.0 37.0 12.0 41.0 135-139 24.0591 25.0 12.0 33.0 12.0 38.6 140-144 21.044649999999997 17.0 12.0 29.0 10.4 37.8 145-149 21.553050000000002 20.0 12.0 30.0 11.2 36.0 150 18.36575 12.0 12.0 27.0 8.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 3.0 17 5.0 18 2.0 19 5.0 20 12.0 21 12.0 22 22.0 23 34.0 24 35.0 25 60.0 26 72.0 27 79.0 28 122.0 29 159.0 30 172.0 31 212.0 32 269.0 33 309.0 34 387.0 35 398.0 36 429.0 37 528.0 38 404.0 39 231.0 40 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.038613426941637 17.06888986397543 21.017990346643263 33.87450636243967 2 25.374999999999996 25.775 34.449999999999996 14.399999999999999 3 22.275 30.175 26.6 20.95 4 23.95 34.675 21.65 19.725 5 22.7 37.95 23.325000000000003 16.025 6 17.525 39.2 24.125 19.15 7 15.625 17.775 45.824999999999996 20.775 8 19.875 21.7 28.849999999999998 29.575000000000003 9 21.375 23.599999999999998 28.849999999999998 26.174999999999997 10-14 20.68 30.425 28.035 20.86 15-19 21.765 27.839999999999996 28.360000000000003 22.035 20-24 21.19 29.404999999999998 27.700000000000003 21.705 25-29 21.37 29.315 28.115000000000002 21.2 30-34 21.17 29.67 27.584999999999997 21.575 35-39 21.175 30.009999999999998 28.035 20.78 40-44 21.57 29.110000000000003 27.08 22.24 45-49 21.47 28.77 28.535 21.224999999999998 50-54 21.265 29.110000000000003 27.715 21.91 55-59 21.94 28.96 27.185 21.915000000000003 60-64 21.72 29.2 27.725 21.355 65-69 21.55 28.505000000000003 28.485 21.46 70-74 21.85 29.23 27.165 21.755 75-79 21.475 28.875 27.725 21.925 80-84 21.85 28.815 27.565 21.77 85-89 21.54 28.27 28.64 21.55 90-94 21.995 29.599999999999998 27.935 20.47 95-99 21.790000000000003 29.335 27.76 21.115000000000002 100-104 21.98 28.34 27.985 21.695 105-109 21.64 29.134999999999998 28.165000000000003 21.060000000000002 110-114 21.505 28.925 27.189999999999998 22.38 115-119 21.61 29.005 27.51 21.875 120-124 21.395 28.875 27.97 21.759999999999998 125-129 22.02 28.485 28.475 21.02 130-134 21.87 29.375 28.08 20.674999999999997 135-139 22.595000000000002 28.655 27.85 20.9 140-144 23.169999999999998 29.13 28.634999999999998 19.064999999999998 145-149 22.32 28.64 29.060000000000002 19.98 150 24.8 28.4 30.875000000000004 15.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 2.5 20 2.5 21 2.0 22 3.0 23 4.5 24 8.0 25 10.5 26 16.5 27 22.0 28 23.0 29 21.5 30 24.5 31 35.5 32 52.0 33 71.0 34 90.5 35 108.5 36 113.5 37 126.5 38 155.5 39 186.5 40 199.5 41 219.0 42 245.5 43 251.5 44 248.0 45 237.5 46 242.0 47 224.0 48 182.0 49 165.0 50 143.0 51 111.0 52 91.5 53 76.0 54 61.0 55 48.5 56 35.5 57 29.0 58 25.0 59 16.5 60 15.5 61 15.5 62 8.0 63 4.0 64 4.5 65 2.0 66 1.0 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 43.025000000000006 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.69826435246996 87.725 2 5.847797062750334 10.95 3 0.4005340453938585 1.125 4 0.0534045393858478 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.5125 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6625000000000001 0.0 0.0 0.0 0.0 136-137 0.7124999999999999 0.0 0.0 0.0 0.0 138 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATCAC 10 0.0070373793 143.5625 9 TGTTATC 10 0.0070373793 143.5625 7 GATCCTC 10 0.0070373793 143.5625 5 TTTAGTT 10 0.0070373793 143.5625 7 GTTATCA 10 0.0070373793 143.5625 8 >>END_MODULE Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179181 spots for SRR5933799.sra Written 1179181 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra Read 1179163 spots for SRR5933799.sra Written 1179163 spots for SRR5933799.sra SRR ids: ['SRR5933799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kibzrud5 SRR5933799.sra spots: 23583278 blocks: [[1, 1179163], [1179164, 2358326], [2358327, 3537489], [3537490, 4716652], [4716653, 5895815], [5895816, 7074978], [7074979, 8254141], [8254142, 9433304], [9433305, 10612467], [10612468, 11791630], [11791631, 12970793], [12970794, 14149956], [14149957, 15329119], [15329120, 16508282], [16508283, 17687445], [17687446, 18866608], [18866609, 20045771], [20045772, 21224934], [21224935, 22404097], [22404098, 23583278]] SRR5933799 file size 7923837 SRR5933799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933799 SRR5933799_1.fastq SRR5933799_2.fastq Input file: SRR5933799_1.fastq Paired file: SRR5933799_2.fastq trimmed: SRR5933799-trimmed-pair1.fastq, SRR5933799-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:24:03 2025 >> started Mon Feb 10 20:24:28 2025 >> done (24.902s) 23583278 read pairs processed; of these: 260 ( 0.00%) short read pairs filtered out after trimming by size control 52 ( 0.00%) empty read pairs filtered out after trimming by size control 23582966 (100.00%) read pairs available; of these: 1626434 ( 6.90%) trimmed read pairs available after processing 21956532 (93.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 74 0.00% 20 69 0.00% 21 96 0.00% 22 139 0.00% 23 154 0.00% 24 184 0.00% 25 227 0.00% 26 251 0.00% 27 245 0.00% 28 303 0.00% 29 315 0.00% 30 304 0.00% 31 343 0.00% 32 312 0.00% 33 338 0.00% 34 382 0.00% 35 337 0.00% 36 331 0.00% 37 417 0.00% 38 423 0.00% 39 453 0.00% 40 419 0.00% 41 414 0.00% 42 415 0.00% 43 408 0.00% 44 405 0.00% 45 423 0.00% 46 438 0.00% 47 439 0.00% 48 425 0.00% 49 428 0.00% 50 439 0.00% 51 461 0.00% 52 465 0.00% 53 485 0.00% 54 473 0.00% 55 438 0.00% 56 479 0.00% 57 385 0.00% 58 432 0.00% 59 432 0.00% 60 461 0.00% 61 470 0.00% 62 461 0.00% 63 427 0.00% 64 415 0.00% 65 413 0.00% 66 392 0.00% 67 475 0.00% 68 423 0.00% 69 442 0.00% 70 430 0.00% 71 443 0.00% 72 514 0.00% 73 483 0.00% 74 519 0.00% 75 476 0.00% 76 514 0.00% 77 532 0.00% 78 579 0.00% 79 586 0.00% 80 584 0.00% 81 546 0.00% 82 635 0.00% 83 685 0.00% 84 672 0.00% 85 727 0.00% 86 703 0.00% 87 770 0.00% 88 815 0.00% 89 824 0.00% 90 879 0.00% 91 918 0.00% 92 994 0.00% 93 1113 0.00% 94 1261 0.01% 95 1232 0.01% 96 1248 0.01% 97 1410 0.01% 98 1360 0.01% 99 1473 0.01% 100 1683 0.01% 101 1695 0.01% 102 1902 0.01% 103 1939 0.01% 104 2019 0.01% 105 2035 0.01% 106 2302 0.01% 107 2400 0.01% 108 2530 0.01% 109 2697 0.01% 110 2812 0.01% 111 3001 0.01% 112 3119 0.01% 113 3292 0.01% 114 3540 0.02% 115 3640 0.02% 116 3879 0.02% 117 3918 0.02% 118 4155 0.02% 119 4527 0.02% 120 4702 0.02% 121 5016 0.02% 122 5134 0.02% 123 5346 0.02% 124 5761 0.02% 125 6169 0.03% 126 6307 0.03% 127 6601 0.03% 128 6981 0.03% 129 7301 0.03% 130 7387 0.03% 131 7908 0.03% 132 8292 0.04% 133 8886 0.04% 134 9132 0.04% 135 9627 0.04% 136 9887 0.04% 137 10344 0.04% 138 10714 0.05% 139 11294 0.05% 140 11671 0.05% 141 12096 0.05% 142 13116 0.06% 143 13450 0.06% 144 14566 0.06% 145 15834 0.07% 146 19837 0.08% 147 35244 0.15% 148 122278 0.52% 149 1115715 4.73% 150 21956532 93.10% 23582966 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=29 prefix-density=0.14 prefix-fanout=3.4 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=242.40 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=26.6 sequence=TTCTTCTTCTTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=29 prefix-density=0.13 prefix-fanout=3.4 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=251.37 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=27.1 sequence=TTCTTCTTCTTC SRR5933799 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:26:11 Started mapping on | Feb 10 20:26:11 Finished on | Feb 10 20:32:50 Mapping speed, Million of reads per hour | 212.78 Number of input reads | 23582966 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 17683603 Uniquely mapped reads % | 74.98% Average mapped length | 272.91 Number of splices: Total | 12030482 Number of splices: Annotated (sjdb) | 11286420 Number of splices: GT/AG | 11691998 Number of splices: GC/AG | 153091 Number of splices: AT/AC | 8236 Number of splices: Non-canonical | 177157 Mismatch rate per base, % | 2.30% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.10% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1544017 % of reads mapped to multiple loci | 6.55% Number of reads mapped to too many loci | 25747 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.93% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4355346 4355346 4355346 N_multimapping 1544017 1544017 1544017 N_noFeature 539251 9077811 9047297 N_ambiguous 408631 156485 157440 UnstrandedReadsAssigned:16735721 PositiveStrandReadsAssigned:8449307 NegativeStrandReadsAssigned:8478866 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5933799 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933799-trimmed-pair1.fastq SRR5933799-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,582,966 reads, 17,616,435 reads pseudoaligned [quant] estimated average fragment length: 233.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR5933799.ke.tsv 34699 SRR5933799.se.tsv 87100 total ==> SRR5933799.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.7 5580.82 152.972 Potri.005G024800.1.v4.1 1035 802.703 2162 131.833 Potri.004G059700.1.v4.1 961 728.708 19 1.27621 Potri.007G009000.2.v4.1 1416 1183.7 0 0 Potri.003G141000.2.v4.1 2943 2710.7 362.464 6.54493 Potri.016G087400.1.v4.1 270 60.281 286.119 232.321 Potri.015G069301.1.v4.1 564 331.914 0 0 Potri.010G195200.1.v4.1 1773 1540.7 173 5.49603 Potri.012G127500.1.v4.1 977 744.703 5161 339.213 ==> SRR5933799.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2564 SRR5933799 completed mapping pipeline successfully