Starting /dee2/code/volunteer_pipeline.sh SRR5933800 current disk space = 3057027452928 free memory = 1579306340 SRR5933800 SRAfilesize 1393a719d37f4a4773b1c7369b6f83d5 SRR5933800.sra SRR5933800.sra file validated SRR5933800 is paired end SRR5933800 is conventional basespace SRR5933800 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.22125 32.0 32.0 32.0 32.0 32.0 2 28.93625 32.0 32.0 32.0 12.0 32.0 3 34.67125 37.0 32.0 37.0 32.0 37.0 4 36.26875 37.0 37.0 37.0 32.0 37.0 5 35.71125 37.0 37.0 37.0 32.0 37.0 6 38.038 41.0 37.0 41.0 32.0 41.0 7 34.60875 37.0 32.0 41.0 12.0 41.0 8 37.91825 41.0 37.0 41.0 32.0 41.0 9 39.23925 41.0 37.0 41.0 37.0 41.0 10-14 38.5061 41.0 38.6 41.0 33.0 41.0 15-19 37.128099999999996 41.0 36.8 41.0 27.0 41.0 20-24 37.9918 41.0 37.8 41.0 30.0 41.0 25-29 36.394549999999995 40.2 33.8 41.0 24.0 41.0 30-34 38.38154999999999 41.0 38.6 41.0 33.0 41.0 35-39 34.8378 38.4 30.0 41.0 22.0 41.0 40-44 32.154700000000005 35.0 25.0 40.2 16.0 41.0 45-49 28.0876 30.0 19.0 37.8 12.0 41.0 50-54 25.201900000000002 26.0 14.0 36.0 12.0 40.2 55-59 26.828600000000005 28.0 18.0 36.6 14.0 39.4 60-64 27.558000000000003 29.0 20.0 35.6 16.0 39.4 65-69 26.887150000000002 29.0 16.0 36.8 12.0 41.0 70-74 24.946499999999997 24.0 12.0 35.0 12.0 40.2 75-79 22.891599999999997 22.0 14.0 31.0 12.0 36.8 80-84 25.54355 27.0 14.0 36.0 12.0 40.2 85-89 28.9632 31.0 22.0 37.4 18.0 40.2 90-94 30.01475 32.0 23.0 40.2 16.0 41.0 95-99 23.78715 22.0 14.0 33.0 12.0 38.6 100-104 23.983449999999998 25.0 16.0 34.0 12.0 38.6 105-109 21.70245 20.0 12.0 29.0 12.0 37.0 110-114 20.41965 18.0 12.0 26.0 12.0 35.0 115-119 21.259549999999997 20.0 12.0 30.0 12.0 36.0 120-124 17.59045 14.0 12.0 24.0 8.8 31.0 125-129 16.2345 12.0 12.0 22.0 8.0 28.0 130-134 15.322700000000001 12.0 12.0 20.0 8.0 25.0 135-139 14.973249999999998 12.0 12.0 22.0 8.0 23.0 140-144 14.583350000000001 12.0 12.0 18.0 8.0 22.0 145-149 15.56825 12.0 12.0 22.0 8.0 25.0 150 15.2975 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 17 1.0 18 10.0 19 20.0 20 74.0 21 176.0 22 308.0 23 439.0 24 483.0 25 405.0 26 415.0 27 364.0 28 316.0 29 291.0 30 276.0 31 223.0 32 116.0 33 59.0 34 21.0 35 2.0 36 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.300713557594293 16.386340468909278 19.54638124362895 33.76656472986748 2 26.200000000000003 25.224999999999998 33.175 15.4 3 23.35 29.475 26.224999999999998 20.95 4 22.586293146573286 36.54327163581791 20.885442721360683 19.984992496248125 5 23.3 37.574999999999996 22.025 17.1 6 16.575 40.425 24.224999999999998 18.775 7 16.5 17.075000000000003 44.975 21.45 8 19.425 22.925 28.275 29.375 9 21.075 22.45 28.925 27.55 10-14 20.169999999999998 30.814999999999998 27.555000000000003 21.46 15-19 21.675 28.71 28.095 21.52 20-24 20.685000000000002 29.635 27.400000000000002 22.28 25-29 21.735433858464617 29.21730432608152 27.161790447611907 21.885471367841962 30-34 21.095 29.425 27.74 21.740000000000002 35-39 21.605 29.115000000000002 27.775 21.505 40-44 21.475 29.265 27.939999999999998 21.32 45-49 22.93 28.71 27.79 20.57 50-54 23.11 28.749999999999996 28.175 19.965 55-59 23.06 28.410000000000004 28.455000000000002 20.075000000000003 60-64 22.67 28.465 28.76 20.105 65-69 23.085 28.615000000000002 27.810000000000002 20.49 70-74 21.93 29.060000000000002 27.6 21.41 75-79 23.175 28.175 28.77 19.88 80-84 22.31 28.64 28.04 21.01 85-89 22.745 28.42 29.21 19.625 90-94 22.145 29.17 27.77 20.915 95-99 21.93 29.054999999999996 28.565 20.45 100-104 22.58 28.465 28.665000000000003 20.29 105-109 21.965 27.67 29.880000000000003 20.485 110-114 22.335 30.245 28.455000000000002 18.965 115-119 22.3 28.549999999999997 28.265 20.885 120-124 22.994999999999997 27.755000000000003 30.570000000000004 18.68 125-129 23.685000000000002 26.63 30.3 19.384999999999998 130-134 23.494999999999997 27.905 29.875 18.725 135-139 23.09 28.275 30.345 18.29 140-144 23.61 28.345 29.74 18.305 145-149 23.5 27.595 28.87 20.035 150 23.474999999999998 27.525 30.599999999999998 18.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.5 8 2.0 9 1.0 10 2.0 11 1.5 12 1.5 13 2.0 14 1.5 15 2.5 16 2.0 17 2.0 18 2.5 19 1.5 20 4.5 21 5.0 22 3.5 23 5.0 24 6.0 25 7.0 26 10.0 27 17.5 28 30.5 29 33.0 30 37.0 31 53.5 32 56.5 33 63.5 34 75.5 35 91.0 36 112.0 37 127.5 38 151.5 39 181.5 40 194.0 41 212.5 42 224.0 43 211.5 44 226.5 45 254.5 46 237.0 47 199.5 48 188.0 49 172.0 50 148.5 51 115.5 52 92.5 53 75.5 54 55.5 55 54.0 56 44.5 57 35.5 58 28.5 59 21.0 60 19.0 61 15.0 62 13.5 63 12.0 64 10.0 65 6.5 66 4.5 67 5.5 68 2.5 69 1.5 70 3.5 71 4.0 72 3.0 73 4.5 74 5.5 75 2.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.025 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7743668457406 95.55 2 2.1233051931440263 4.15 3 0.10232796111537479 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCAG 10 0.0069754543 143.9875 9 AATTGAA 10 0.0069754543 143.9875 5 AAAAAAA 130 6.529692E-4 9.968366 100-104 >>END_MODULE SRR5933800 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1925 32.0 32.0 32.0 27.0 32.0 2 31.26625 32.0 32.0 32.0 32.0 32.0 3 34.98625 37.0 32.0 37.0 32.0 37.0 4 35.70375 37.0 37.0 37.0 32.0 37.0 5 35.01625 37.0 37.0 37.0 32.0 37.0 6 36.90675 41.0 37.0 41.0 27.0 41.0 7 34.2745 37.0 32.0 41.0 12.0 41.0 8 38.66375 41.0 37.0 41.0 32.0 41.0 9 38.5335 41.0 37.0 41.0 32.0 41.0 10-14 38.6746 41.0 40.2 41.0 35.0 41.0 15-19 37.28165 40.2 35.0 41.0 27.0 41.0 20-24 38.0592 41.0 38.6 41.0 31.0 41.0 25-29 38.717650000000006 41.0 39.4 41.0 34.0 41.0 30-34 38.74 41.0 40.2 41.0 34.0 41.0 35-39 39.101 41.0 41.0 41.0 35.0 41.0 40-44 38.7505 41.0 41.0 41.0 33.0 41.0 45-49 38.351350000000004 41.0 38.6 41.0 31.0 41.0 50-54 38.6899 41.0 40.2 41.0 33.0 41.0 55-59 37.9142 41.0 37.0 41.0 30.0 41.0 60-64 36.94840000000001 41.0 37.0 41.0 26.0 41.0 65-69 37.09394999999999 41.0 37.0 41.0 27.0 41.0 70-74 36.87864999999999 41.0 37.0 41.0 25.0 41.0 75-79 34.70545 38.6 32.0 41.0 21.0 41.0 80-84 36.66515 41.0 37.0 41.0 26.0 41.0 85-89 35.27624999999999 39.4 34.0 41.0 20.0 41.0 90-94 33.547999999999995 37.0 31.0 41.0 14.0 41.0 95-99 35.3393 39.4 32.0 41.0 22.0 41.0 100-104 31.922800000000002 34.8 25.0 40.2 16.0 41.0 105-109 29.83465 33.0 20.0 38.6 14.0 41.0 110-114 29.856849999999998 32.0 24.0 38.6 12.0 41.0 115-119 26.4774 28.0 16.0 37.8 12.0 41.0 120-124 27.59035 29.0 19.0 37.0 12.0 41.0 125-129 25.8411 26.0 16.0 36.0 12.0 41.0 130-134 25.838299999999997 27.0 14.0 37.0 12.0 41.0 135-139 26.35165 27.0 16.0 37.0 12.0 41.0 140-144 25.63895 27.0 14.0 37.0 12.0 41.0 145-149 25.625 27.0 14.0 36.0 12.0 41.0 150 25.24375 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 7.0 19 12.0 20 13.0 21 19.0 22 22.0 23 31.0 24 40.0 25 65.0 26 82.0 27 123.0 28 157.0 29 164.0 30 226.0 31 285.0 32 272.0 33 316.0 34 330.0 35 362.0 36 372.0 37 374.0 38 410.0 39 254.0 40 58.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.377082799282235 15.867726224045118 21.353499102794153 33.40169187387849 2 25.25 25.900000000000002 32.6 16.25 3 24.6 28.599999999999998 26.400000000000002 20.4 4 25.025 33.625 21.05 20.3 5 23.425 36.8 22.650000000000002 17.125 6 16.75 38.875 24.5 19.875 7 16.45 16.6 43.95 23.0 8 20.75 22.275 29.275000000000002 27.700000000000003 9 21.7 23.0 28.65 26.650000000000002 10-14 20.555 29.520000000000003 27.894999999999996 22.03 15-19 21.325 27.900000000000002 28.999999999999996 21.775 20-24 21.86 28.884999999999998 27.805000000000003 21.45 25-29 22.0 28.65 28.249999999999996 21.099999999999998 30-34 21.26 27.994999999999997 28.775000000000002 21.97 35-39 21.485000000000003 28.494999999999997 27.485 22.535 40-44 21.875 29.025000000000002 27.485 21.615000000000002 45-49 21.275 28.59 28.634999999999998 21.5 50-54 22.06 28.139999999999997 28.249999999999996 21.55 55-59 21.555 28.525 28.189999999999998 21.73 60-64 21.345 28.849999999999998 27.744999999999997 22.06 65-69 21.69 28.725 27.82 21.765 70-74 22.035 28.015 27.994999999999997 21.955 75-79 21.92 28.349999999999998 28.405 21.325 80-84 21.475 28.599999999999998 28.185 21.740000000000002 85-89 21.815 28.37 28.345 21.47 90-94 21.145 27.735 28.799999999999997 22.32 95-99 21.89 27.884999999999998 28.425 21.8 100-104 22.74 27.455000000000002 28.465 21.34 105-109 22.17 27.315 28.444999999999997 22.07 110-114 21.86 28.084999999999997 28.050000000000004 22.005 115-119 22.695 26.99 28.299999999999997 22.015 120-124 22.25 27.505000000000003 28.110000000000003 22.134999999999998 125-129 22.13 27.555000000000003 28.035 22.28 130-134 22.165000000000003 27.175 28.235 22.425 135-139 22.745 27.515 27.515 22.225 140-144 22.54 27.839999999999996 27.694999999999997 21.925 145-149 22.665 27.439999999999998 27.675 22.220000000000002 150 22.725 27.35 26.575 23.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 3.0 16 4.0 17 3.0 18 2.5 19 4.0 20 5.0 21 4.5 22 5.0 23 8.5 24 10.5 25 11.0 26 13.5 27 16.5 28 20.0 29 16.0 30 20.5 31 35.5 32 51.0 33 61.5 34 68.5 35 86.0 36 103.5 37 124.5 38 151.5 39 177.0 40 189.5 41 213.0 42 240.0 43 251.5 44 238.5 45 220.0 46 223.5 47 201.0 48 189.5 49 179.5 50 148.0 51 129.5 52 103.5 53 79.5 54 69.0 55 58.0 56 44.5 57 35.0 58 28.0 59 24.0 60 20.5 61 16.5 62 14.5 63 9.5 64 6.0 65 5.5 66 4.5 67 6.5 68 7.0 69 5.0 70 3.0 71 3.0 72 3.5 73 2.0 74 2.5 75 3.0 76 3.5 77 2.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 95.07894736842105 90.325 2 4.578947368421052 8.7 3 0.34210526315789475 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTAG 10 0.0069754543 143.9875 6 CTTAGTA 10 0.0069754543 143.9875 8 TCTTAGT 20 3.689142E-4 107.99063 7 ATTGAAA 35 0.0034056995 61.708927 6 >>END_MODULE Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148668 spots for SRR5933800.sra Written 1148668 spots for SRR5933800.sra Read 1148683 spots for SRR5933800.sra Written 1148683 spots for SRR5933800.sra SRR ids: ['SRR5933800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6r4iocv6 SRR5933800.sra spots: 22973375 blocks: [[1, 1148668], [1148669, 2297336], [2297337, 3446004], [3446005, 4594672], [4594673, 5743340], [5743341, 6892008], [6892009, 8040676], [8040677, 9189344], [9189345, 10338012], [10338013, 11486680], [11486681, 12635348], [12635349, 13784016], [13784017, 14932684], [14932685, 16081352], [16081353, 17230020], [17230021, 18378688], [18378689, 19527356], [19527357, 20676024], [20676025, 21824692], [21824693, 22973375]] SRR5933800 file size 7718352 SRR5933800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933800 SRR5933800_1.fastq SRR5933800_2.fastq Input file: SRR5933800_1.fastq Paired file: SRR5933800_2.fastq trimmed: SRR5933800-trimmed-pair1.fastq, SRR5933800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:45:17 2025 >> started Mon Feb 10 21:45:42 2025 >> done (24.913s) 22973375 read pairs processed; of these: 302 ( 0.00%) short read pairs filtered out after trimming by size control 106 ( 0.00%) empty read pairs filtered out after trimming by size control 22972967 (100.00%) read pairs available; of these: 1388128 ( 6.04%) trimmed read pairs available after processing 21584839 (93.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 63 0.00% 19 60 0.00% 20 83 0.00% 21 93 0.00% 22 132 0.00% 23 154 0.00% 24 194 0.00% 25 194 0.00% 26 211 0.00% 27 225 0.00% 28 263 0.00% 29 276 0.00% 30 269 0.00% 31 278 0.00% 32 308 0.00% 33 326 0.00% 34 298 0.00% 35 350 0.00% 36 318 0.00% 37 343 0.00% 38 373 0.00% 39 324 0.00% 40 384 0.00% 41 349 0.00% 42 355 0.00% 43 381 0.00% 44 326 0.00% 45 369 0.00% 46 355 0.00% 47 366 0.00% 48 382 0.00% 49 390 0.00% 50 383 0.00% 51 402 0.00% 52 394 0.00% 53 431 0.00% 54 401 0.00% 55 376 0.00% 56 414 0.00% 57 407 0.00% 58 421 0.00% 59 405 0.00% 60 423 0.00% 61 435 0.00% 62 442 0.00% 63 405 0.00% 64 398 0.00% 65 394 0.00% 66 437 0.00% 67 412 0.00% 68 456 0.00% 69 436 0.00% 70 443 0.00% 71 426 0.00% 72 449 0.00% 73 447 0.00% 74 459 0.00% 75 441 0.00% 76 528 0.00% 77 518 0.00% 78 541 0.00% 79 564 0.00% 80 495 0.00% 81 568 0.00% 82 636 0.00% 83 652 0.00% 84 676 0.00% 85 693 0.00% 86 774 0.00% 87 741 0.00% 88 811 0.00% 89 885 0.00% 90 971 0.00% 91 1015 0.00% 92 1165 0.01% 93 1158 0.01% 94 1200 0.01% 95 1294 0.01% 96 1422 0.01% 97 1546 0.01% 98 1631 0.01% 99 1689 0.01% 100 1792 0.01% 101 1833 0.01% 102 2028 0.01% 103 2220 0.01% 104 2426 0.01% 105 2574 0.01% 106 2673 0.01% 107 2875 0.01% 108 2918 0.01% 109 3066 0.01% 110 3301 0.01% 111 3491 0.02% 112 3694 0.02% 113 3803 0.02% 114 4053 0.02% 115 4388 0.02% 116 4543 0.02% 117 4730 0.02% 118 4908 0.02% 119 5194 0.02% 120 5482 0.02% 121 5794 0.03% 122 6224 0.03% 123 6306 0.03% 124 6825 0.03% 125 7061 0.03% 126 7584 0.03% 127 7801 0.03% 128 8196 0.04% 129 8538 0.04% 130 9104 0.04% 131 9335 0.04% 132 9832 0.04% 133 10100 0.04% 134 11011 0.05% 135 11055 0.05% 136 11839 0.05% 137 12320 0.05% 138 12715 0.06% 139 13191 0.06% 140 13968 0.06% 141 14180 0.06% 142 14870 0.06% 143 15654 0.07% 144 16702 0.07% 145 18588 0.08% 146 21216 0.09% 147 32078 0.14% 148 92818 0.40% 149 859329 3.74% 150 21584839 93.96% 22972967 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.14 fanout-score-rank=12 prefix-density=0.36 prefix-fanout=3.2 sequence=GAGAGAGAAAATCCTCTTGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=87.40 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.3 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.91 fanout-score-rank=14 prefix-density=0.35 prefix-fanout=3.2 sequence=GAGAGAGAAAATCCTCTTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=78.11 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.6 sequence=TCTGCTTCACGATTTTCGCTTTTGTCGTGACCAATAAAGGTGCCGGTCAAGTTTTGTCCGGGAAGGGGTATAAGGAGTATAAGTTGGGAGATTATTCAAATTGGTTGCAGAAGAGAGTGGGCAATCAGAAGAACTGGAGGAAGATTAAGAGTTGTTTGATTGATGCTAAAGTTTGCAGTGATTTTAACCAGAAATTCGCGAATGATACTGTTGAAG SRR5933800 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:46:52 Started mapping on | Feb 10 21:46:52 Finished on | Feb 10 21:58:25 Mapping speed, Million of reads per hour | 119.34 Number of input reads | 22972967 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16299794 Uniquely mapped reads % | 70.95% Average mapped length | 287.58 Number of splices: Total | 11329104 Number of splices: Annotated (sjdb) | 10588305 Number of splices: GT/AG | 10992941 Number of splices: GC/AG | 141222 Number of splices: AT/AC | 8191 Number of splices: Non-canonical | 186750 Mismatch rate per base, % | 2.25% Deletion rate per base | 0.16% Deletion average length | 3.26 Insertion rate per base | 0.10% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1535999 % of reads mapped to multiple loci | 6.69% Number of reads mapped to too many loci | 37641 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.47% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5137174 5137174 5137174 N_multimapping 1535999 1535999 1535999 N_noFeature 638858 8432519 8408733 N_ambiguous 345028 124935 125526 UnstrandedReadsAssigned:15315908 PositiveStrandReadsAssigned:7742340 NegativeStrandReadsAssigned:7765535 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933800-trimmed-pair1.fastq SRR5933800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,972,967 reads, 15,958,083 reads pseudoaligned [quant] estimated average fragment length: 244.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR5933800.ke.tsv 34699 SRR5933800.se.tsv 87100 total ==> SRR5933800.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.95 5040.3 140.401 Potri.005G024800.1.v4.1 1035 791.95 1283.22 80.1131 Potri.004G059700.1.v4.1 961 717.955 5 0.344329 Potri.007G009000.2.v4.1 1416 1172.95 0 0 Potri.003G141000.2.v4.1 2943 2699.95 436 7.9842 Potri.016G087400.1.v4.1 270 54.1897 215.189 196.338 Potri.015G069301.1.v4.1 564 321.15 0 0 Potri.010G195200.1.v4.1 1773 1529.95 190 6.14013 Potri.012G127500.1.v4.1 977 733.955 1387 93.4346 ==> SRR5933800.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 103 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 9 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 13 Potri.001G452600.v4.1 1556 SRR5933800 completed mapping pipeline successfully