Starting /dee2/code/volunteer_pipeline.sh SRR5933801 current disk space = 3056139841536 free memory = 1466078408 SRR5933801 SRAfilesize be323c18f089cc9b713fbdba700d4bee SRR5933801.sra SRR5933801.sra file validated SRR5933801 is paired end SRR5933801 is conventional basespace SRR5933801 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.085 32.0 32.0 32.0 32.0 32.0 2 28.9075 32.0 32.0 32.0 12.0 32.0 3 34.67 37.0 32.0 37.0 32.0 37.0 4 36.23875 37.0 37.0 37.0 32.0 37.0 5 35.615 37.0 37.0 37.0 32.0 37.0 6 37.90275 41.0 37.0 41.0 32.0 41.0 7 34.362 37.0 32.0 41.0 12.0 41.0 8 37.86025 41.0 37.0 41.0 32.0 41.0 9 39.1955 41.0 37.0 41.0 37.0 41.0 10-14 38.4554 41.0 38.6 41.0 33.0 41.0 15-19 37.1052 41.0 36.8 41.0 28.0 41.0 20-24 37.95355 41.0 37.8 41.0 30.0 41.0 25-29 36.371449999999996 40.2 33.8 41.0 24.0 41.0 30-34 38.35275 41.0 38.6 41.0 33.0 41.0 35-39 34.83385 38.4 30.0 41.0 22.0 41.0 40-44 32.0526 35.0 25.0 40.2 16.0 41.0 45-49 27.9394 29.0 19.0 37.8 12.0 41.0 50-54 24.97665 26.0 14.0 36.0 12.0 40.2 55-59 26.79155 26.0 18.0 36.6 14.0 39.4 60-64 27.494349999999997 27.0 20.0 34.6 14.0 39.4 65-69 26.752050000000004 29.0 16.0 36.8 12.0 41.0 70-74 24.894399999999997 24.0 12.0 35.0 12.0 41.0 75-79 22.964199999999998 22.0 14.0 31.0 12.0 36.8 80-84 25.5681 26.0 16.0 36.0 12.0 40.2 85-89 29.128999999999998 31.0 22.0 37.4 18.0 40.2 90-94 30.127 33.0 23.0 40.2 16.0 41.0 95-99 23.86945 24.0 14.0 33.0 12.0 38.6 100-104 23.9213 22.0 16.0 33.0 12.0 38.6 105-109 21.74735 20.0 12.0 29.0 12.0 37.0 110-114 20.47885 18.0 12.0 26.0 12.0 35.0 115-119 21.1675 20.0 12.0 30.0 12.0 36.0 120-124 17.57685 14.0 12.0 24.0 8.8 32.0 125-129 16.25565 12.0 12.0 22.0 8.0 28.0 130-134 15.331449999999998 12.0 12.0 22.0 8.0 25.0 135-139 14.9 12.0 12.0 20.0 8.0 23.0 140-144 14.5786 12.0 12.0 20.0 8.0 22.0 145-149 15.352250000000002 12.0 12.0 22.0 8.0 25.0 150 15.1855 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 17 1.0 18 8.0 19 32.0 20 97.0 21 187.0 22 288.0 23 414.0 24 458.0 25 450.0 26 389.0 27 354.0 28 324.0 29 333.0 30 285.0 31 201.0 32 105.0 33 45.0 34 23.0 35 4.0 36 1.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.419288820670246 16.525965720133026 19.826042466103864 34.22870299309287 2 27.075 25.874999999999996 32.0 15.049999999999999 3 23.125 29.849999999999998 25.85 21.175 4 24.087043521760883 34.94247123561781 21.810905452726363 19.15957978989495 5 24.375 35.9 23.200000000000003 16.525000000000002 6 16.675 40.075 24.224999999999998 19.025 7 16.150000000000002 17.299999999999997 44.55 22.0 8 19.45 21.725 28.9 29.925 9 21.85 23.225 29.675 25.25 10-14 20.919999999999998 30.240000000000002 27.82 21.02 15-19 21.990000000000002 28.499999999999996 27.88 21.63 20-24 21.245 29.525000000000002 27.295 21.935 25-29 21.74587293646823 29.05952976488244 27.233616808404204 21.96098049024512 30-34 21.195 28.875 28.025 21.905 35-39 21.575 28.470000000000002 28.1 21.855 40-44 22.16 28.59 27.894999999999996 21.355 45-49 22.175 28.999999999999996 28.000000000000004 20.825 50-54 22.95 28.535 28.494999999999997 20.02 55-59 23.45 27.525 29.165000000000003 19.86 60-64 22.84 27.6 28.884999999999998 20.674999999999997 65-69 22.95 28.939999999999998 27.810000000000002 20.3 70-74 22.505 28.275 28.265 20.955 75-79 23.26 27.575 28.910000000000004 20.255000000000003 80-84 22.16 28.29 27.935 21.615000000000002 85-89 22.66 28.425 28.645 20.27 90-94 22.509999999999998 27.41 28.77 21.310000000000002 95-99 22.89 28.155 28.63 20.325 100-104 22.39 27.950000000000003 28.9 20.76 105-109 22.405 27.775 29.15 20.669999999999998 110-114 22.79 28.78 30.005 18.425 115-119 22.31 27.785 28.32 21.584999999999997 120-124 22.505 27.689999999999998 30.64 19.165 125-129 23.73 27.145000000000003 30.09 19.035 130-134 23.285 27.375 30.514999999999997 18.825 135-139 23.369999999999997 27.83 29.975 18.825 140-144 23.685000000000002 27.305 30.09 18.92 145-149 23.345 26.765 29.909999999999997 19.98 150 25.45 26.125 29.575000000000003 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 2.0 15 0.5 16 1.5 17 2.5 18 4.0 19 4.5 20 3.0 21 2.0 22 2.0 23 7.5 24 12.5 25 9.5 26 7.5 27 13.0 28 17.0 29 20.5 30 35.0 31 43.0 32 46.0 33 58.0 34 76.5 35 98.0 36 107.0 37 125.0 38 160.5 39 186.5 40 201.0 41 215.5 42 228.5 43 224.5 44 240.0 45 244.5 46 215.5 47 199.0 48 186.0 49 171.5 50 152.0 51 119.5 52 97.5 53 87.0 54 70.0 55 58.0 56 47.5 57 36.0 58 27.0 59 21.5 60 21.5 61 17.5 62 9.0 63 8.0 64 7.0 65 7.5 66 8.0 67 3.5 68 4.0 69 6.0 70 4.0 71 2.5 72 2.0 73 4.0 74 4.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.05 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21792260692465 96.45 2 1.7311608961303464 3.4000000000000004 3 0.05091649694501018 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTAG 10 0.0069754543 143.9875 8 GACACTA 10 0.0069754543 143.9875 3 CAAGGAT 10 0.0069754543 143.9875 9 >>END_MODULE SRR5933801 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5933801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.27875 32.0 32.0 32.0 27.0 32.0 2 31.205 32.0 32.0 32.0 32.0 32.0 3 34.93 37.0 32.0 37.0 32.0 37.0 4 35.82875 37.0 37.0 37.0 32.0 37.0 5 35.13375 37.0 37.0 37.0 32.0 37.0 6 36.7685 41.0 37.0 41.0 27.0 41.0 7 34.13825 37.0 32.0 41.0 12.0 41.0 8 38.49375 41.0 37.0 41.0 32.0 41.0 9 38.58325 41.0 37.0 41.0 32.0 41.0 10-14 38.7214 41.0 40.2 41.0 35.0 41.0 15-19 37.2883 40.2 36.0 41.0 27.0 41.0 20-24 38.01745 41.0 38.6 41.0 31.0 41.0 25-29 38.72715 41.0 39.4 41.0 34.0 41.0 30-34 38.76205 41.0 39.4 41.0 34.0 41.0 35-39 39.150800000000004 41.0 41.0 41.0 35.0 41.0 40-44 38.7928 41.0 41.0 41.0 33.0 41.0 45-49 38.30915 41.0 38.6 41.0 32.0 41.0 50-54 38.564800000000005 41.0 40.2 41.0 32.0 41.0 55-59 37.8877 41.0 37.0 41.0 30.0 41.0 60-64 36.97565 41.0 37.0 41.0 26.0 41.0 65-69 37.1502 41.0 37.0 41.0 27.0 41.0 70-74 36.92215 41.0 37.0 41.0 26.0 41.0 75-79 34.9052 38.6 32.0 41.0 21.0 41.0 80-84 36.74735 41.0 37.0 41.0 27.0 41.0 85-89 35.189249999999994 39.4 33.0 41.0 20.0 41.0 90-94 33.606550000000006 37.0 31.0 41.0 14.0 41.0 95-99 35.46155 40.2 33.0 41.0 23.0 41.0 100-104 32.08715 34.8 25.0 40.2 16.0 41.0 105-109 29.942950000000003 33.0 22.0 38.6 14.0 41.0 110-114 29.94885 34.0 24.0 38.6 12.0 41.0 115-119 26.715250000000005 28.0 16.0 37.8 12.0 41.0 120-124 28.00605 30.0 19.0 37.0 12.0 41.0 125-129 25.907999999999998 26.0 16.0 36.0 12.0 41.0 130-134 26.043650000000003 27.0 14.0 37.0 12.0 41.0 135-139 26.63565 28.0 16.0 37.0 12.0 41.0 140-144 25.8019 27.0 14.0 37.0 12.0 41.0 145-149 25.6087 26.0 14.0 36.0 12.0 41.0 150 25.46475 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 2.0 17 4.0 18 6.0 19 8.0 20 10.0 21 17.0 22 36.0 23 33.0 24 63.0 25 73.0 26 65.0 27 121.0 28 128.0 29 156.0 30 194.0 31 248.0 32 304.0 33 285.0 34 347.0 35 358.0 36 390.0 37 440.0 38 412.0 39 250.0 40 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.61487007975302 16.8767687162336 18.909184461023926 33.59917674298945 2 25.4 25.55 33.975 15.075 3 24.375 27.975 25.1 22.55 4 24.175 35.099999999999994 20.599999999999998 20.125 5 22.925 37.1 22.175 17.8 6 16.575 38.574999999999996 24.05 20.8 7 16.225 17.0 44.75 22.025 8 19.925 22.7 29.049999999999997 28.325 9 21.725 23.0 28.425 26.85 10-14 20.835 30.19 27.694999999999997 21.279999999999998 15-19 21.7 28.24 28.28 21.78 20-24 21.435000000000002 29.165000000000003 27.705000000000002 21.695 25-29 21.26 29.39 27.794999999999998 21.555 30-34 21.5 28.825 28.13 21.545 35-39 21.565 28.994999999999997 27.705000000000002 21.735 40-44 21.044999999999998 28.315 27.705000000000002 22.935 45-49 22.045 28.28 27.439999999999998 22.235 50-54 21.29 28.71 27.860000000000003 22.14 55-59 21.7 28.804999999999996 28.075 21.42 60-64 21.94 28.265 27.575 22.220000000000002 65-69 21.654999999999998 28.32 27.694999999999997 22.33 70-74 22.355 28.04 27.794999999999998 21.81 75-79 21.715 27.79 28.139999999999997 22.355 80-84 22.45 28.565 27.295 21.69 85-89 22.615 28.194999999999997 27.6 21.59 90-94 21.495 27.985 28.33 22.189999999999998 95-99 21.62 27.575 28.33 22.475 100-104 22.165000000000003 27.76 27.595 22.48 105-109 22.18 27.52 27.839999999999996 22.46 110-114 22.66 28.13 27.205000000000002 22.005 115-119 22.82 27.310000000000002 27.755000000000003 22.115000000000002 120-124 21.990000000000002 27.485 27.79 22.735 125-129 22.245 27.529999999999998 27.744999999999997 22.48 130-134 23.035 27.21 27.805000000000003 21.95 135-139 22.73 27.200000000000003 27.47 22.6 140-144 22.495 27.534999999999997 27.55 22.42 145-149 22.595000000000002 27.66 27.26 22.485 150 22.650000000000002 27.1 28.075 22.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.5 9 2.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 1.5 17 2.5 18 1.5 19 1.0 20 1.5 21 1.5 22 2.0 23 4.5 24 6.0 25 8.0 26 14.0 27 16.0 28 14.0 29 21.5 30 35.5 31 40.0 32 50.0 33 56.0 34 57.5 35 77.0 36 104.5 37 127.5 38 147.0 39 163.5 40 181.0 41 207.5 42 232.0 43 247.0 44 258.0 45 251.5 46 227.5 47 216.0 48 189.0 49 159.0 50 147.5 51 131.5 52 108.0 53 81.5 54 72.0 55 64.0 56 49.5 57 41.0 58 32.5 59 28.5 60 21.0 61 12.0 62 10.5 63 9.5 64 9.0 65 8.0 66 7.0 67 6.0 68 5.5 69 5.5 70 3.5 71 3.0 72 4.5 73 3.0 74 1.0 75 1.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.38178955654683 90.875 2 4.303332458672265 8.200000000000001 3 0.2886381527158226 0.8250000000000001 4 0.026239832065074783 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.6000000000000001 0.0 0.0 0.0 0.0 132-133 0.7125 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTCAT 10 0.0064622764 147.66667 1 >>END_MODULE Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124049 spots for SRR5933801.sra Written 1124049 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra Read 1124042 spots for SRR5933801.sra Written 1124042 spots for SRR5933801.sra SRR ids: ['SRR5933801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wfs8cnhv SRR5933801.sra spots: 22480847 blocks: [[1, 1124042], [1124043, 2248084], [2248085, 3372126], [3372127, 4496168], [4496169, 5620210], [5620211, 6744252], [6744253, 7868294], [7868295, 8992336], [8992337, 10116378], [10116379, 11240420], [11240421, 12364462], [12364463, 13488504], [13488505, 14612546], [14612547, 15736588], [15736589, 16860630], [16860631, 17984672], [17984673, 19108714], [19108715, 20232756], [20232757, 21356798], [21356799, 22480847]] SRR5933801 file size 7552413 SRR5933801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5933801 SRR5933801_1.fastq SRR5933801_2.fastq Input file: SRR5933801_1.fastq Paired file: SRR5933801_2.fastq trimmed: SRR5933801-trimmed-pair1.fastq, SRR5933801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:48:20 2025 >> started Mon Feb 10 20:48:45 2025 >> done (24.476s) 22480847 read pairs processed; of these: 311 ( 0.00%) short read pairs filtered out after trimming by size control 110 ( 0.00%) empty read pairs filtered out after trimming by size control 22480426 (100.00%) read pairs available; of these: 1467428 ( 6.53%) trimmed read pairs available after processing 21012998 (93.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 44 0.00% 19 44 0.00% 20 75 0.00% 21 101 0.00% 22 113 0.00% 23 130 0.00% 24 177 0.00% 25 182 0.00% 26 200 0.00% 27 186 0.00% 28 232 0.00% 29 241 0.00% 30 227 0.00% 31 269 0.00% 32 279 0.00% 33 251 0.00% 34 262 0.00% 35 291 0.00% 36 299 0.00% 37 271 0.00% 38 296 0.00% 39 322 0.00% 40 324 0.00% 41 307 0.00% 42 322 0.00% 43 350 0.00% 44 357 0.00% 45 375 0.00% 46 349 0.00% 47 330 0.00% 48 361 0.00% 49 389 0.00% 50 373 0.00% 51 355 0.00% 52 400 0.00% 53 369 0.00% 54 404 0.00% 55 405 0.00% 56 404 0.00% 57 390 0.00% 58 417 0.00% 59 418 0.00% 60 462 0.00% 61 407 0.00% 62 410 0.00% 63 419 0.00% 64 412 0.00% 65 381 0.00% 66 397 0.00% 67 450 0.00% 68 389 0.00% 69 434 0.00% 70 441 0.00% 71 513 0.00% 72 464 0.00% 73 468 0.00% 74 502 0.00% 75 500 0.00% 76 530 0.00% 77 520 0.00% 78 583 0.00% 79 596 0.00% 80 584 0.00% 81 651 0.00% 82 753 0.00% 83 763 0.00% 84 826 0.00% 85 903 0.00% 86 889 0.00% 87 991 0.00% 88 976 0.00% 89 1015 0.00% 90 1064 0.00% 91 1161 0.01% 92 1369 0.01% 93 1364 0.01% 94 1485 0.01% 95 1587 0.01% 96 1702 0.01% 97 1812 0.01% 98 1918 0.01% 99 1989 0.01% 100 2197 0.01% 101 2272 0.01% 102 2527 0.01% 103 2821 0.01% 104 2925 0.01% 105 3054 0.01% 106 3221 0.01% 107 3380 0.02% 108 3576 0.02% 109 3644 0.02% 110 3991 0.02% 111 4170 0.02% 112 4453 0.02% 113 4601 0.02% 114 4793 0.02% 115 5174 0.02% 116 5424 0.02% 117 5625 0.03% 118 5843 0.03% 119 6263 0.03% 120 6593 0.03% 121 6748 0.03% 122 6996 0.03% 123 7525 0.03% 124 8040 0.04% 125 8348 0.04% 126 8724 0.04% 127 9107 0.04% 128 9733 0.04% 129 9814 0.04% 130 10323 0.05% 131 10864 0.05% 132 11305 0.05% 133 11893 0.05% 134 12491 0.06% 135 13160 0.06% 136 13446 0.06% 137 14311 0.06% 138 15031 0.07% 139 15303 0.07% 140 15686 0.07% 141 16667 0.07% 142 17409 0.08% 143 18145 0.08% 144 19489 0.09% 145 21125 0.09% 146 23805 0.11% 147 35337 0.16% 148 96376 0.43% 149 868709 3.86% 150 21012998 93.47% 22480426 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.26 fanout-score-rank=21 prefix-density=0.15 prefix-fanout=3.1 sequence=CTCTCCACCTCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=87.02 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=15.7 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=30 prefix-density=0.11 prefix-fanout=2.7 sequence=TTTATCAACCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=90.02 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.0 sequence=GCTGCTGCTGCT SRR5933801 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 10 21:04:01 Started mapping on | Feb 10 21:04:04 Finished on | Feb 10 21:12:22 Mapping speed, Million of reads per hour | 162.48 Number of input reads | 22476552 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 16382563 Uniquely mapped reads % | 72.89% Average mapped length | 269.16 Number of splices: Total | 10985573 Number of splices: Annotated (sjdb) | 10247451 Number of splices: GT/AG | 10659868 Number of splices: GC/AG | 139987 Number of splices: AT/AC | 8180 Number of splices: Non-canonical | 177538 Mismatch rate per base, % | 2.28% Deletion rate per base | 0.15% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1450833 % of reads mapped to multiple loci | 6.45% Number of reads mapped to too many loci | 37057 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.96% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4643499 4643499 4643499 N_multimapping 1450833 1450833 1450833 N_noFeature 600452 8447442 8442747 N_ambiguous 391022 150124 150845 UnstrandedReadsAssigned:15391089 PositiveStrandReadsAssigned:7784997 NegativeStrandReadsAssigned:7788971 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5933801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5933801-trimmed-pair1.fastq SRR5933801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,476,552 reads, 16,282,008 reads pseudoaligned [quant] estimated average fragment length: 221.061 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR5933801.ke.tsv 34699 SRR5933801.se.tsv 87100 total ==> SRR5933801.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.94 5035.45 149.403 Potri.005G024800.1.v4.1 1035 814.939 1676 109.71 Potri.004G059700.1.v4.1 961 740.944 11 0.791959 Potri.007G009000.2.v4.1 1416 1195.94 0 0 Potri.003G141000.2.v4.1 2943 2722.94 421 8.24783 Potri.016G087400.1.v4.1 270 67.4948 243.449 192.413 Potri.015G069301.1.v4.1 564 344.11 0 0 Potri.010G195200.1.v4.1 1773 1552.94 166 5.70229 Potri.012G127500.1.v4.1 977 756.939 2326 163.925 ==> SRR5933801.se.tsv <== Potri.001G166300.v4.1 8 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 112 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 20 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1429 SRR5933801 completed mapping pipeline successfully