Starting /dee2/code/volunteer_pipeline.sh SRR5986234 current disk space = 3087994617856 free memory = 1524991148 SRR5986234 SRAfilesize 428a24bc5a1797100d05c08f70871ab9 SRR5986234.sra SRR5986234.sra file validated SRR5986234 is paired end SRR5986234 is conventional basespace SRR5986234 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.65625 32.0 12.0 32.0 2.0 32.0 2 31.19875 32.0 32.0 32.0 32.0 32.0 3 33.91 37.0 32.0 37.0 32.0 37.0 4 35.3925 37.0 37.0 37.0 32.0 37.0 5 36.055 37.0 37.0 37.0 32.0 37.0 6 38.642 41.0 37.0 41.0 32.0 41.0 7 39.3935 41.0 41.0 41.0 37.0 41.0 8 37.9845 41.0 37.0 41.0 32.0 41.0 9 39.27875 41.0 41.0 41.0 37.0 41.0 10-14 39.612049999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.3288 41.0 41.0 41.0 37.0 41.0 20-24 39.46175000000001 41.0 41.0 41.0 36.0 41.0 25-29 38.9157 41.0 40.2 41.0 35.0 41.0 30-34 38.66275 41.0 38.6 41.0 34.0 41.0 35-39 38.94795 41.0 40.2 41.0 35.0 41.0 40-44 38.20515 41.0 39.4 41.0 31.0 41.0 45-49 38.3238 41.0 37.8 41.0 32.0 41.0 50-54 38.093500000000006 41.0 37.8 41.0 29.0 41.0 55-59 37.7952 41.0 37.0 41.0 29.0 41.0 60-64 34.35465000000001 39.4 30.0 41.0 19.0 41.0 65-69 35.8906 40.2 34.0 41.0 23.0 41.0 70-74 35.21115 39.4 33.0 41.0 20.0 41.0 75-79 34.597300000000004 38.4 32.0 41.0 21.0 41.0 80-84 37.63435 41.0 37.8 41.0 29.0 41.0 85-89 34.087149999999994 38.6 30.0 41.0 16.0 41.0 90-94 34.16585 38.6 30.0 41.0 16.0 41.0 95-99 33.8466 38.4 31.0 41.0 18.0 41.0 100-104 28.955949999999994 30.8 21.0 36.6 16.0 41.0 105-109 33.9741 36.8 30.0 41.0 20.0 41.0 110-114 32.70285 37.0 27.0 41.0 16.0 41.0 115-119 33.27954999999999 37.0 29.0 41.0 16.0 41.0 120-124 35.081900000000005 38.6 34.0 41.0 20.0 41.0 125-129 32.8942 37.0 28.0 41.0 14.0 41.0 130-134 28.050649999999997 29.0 19.0 36.6 13.2 40.2 135-139 29.1878 32.0 21.0 38.6 12.0 41.0 140-144 31.253749999999997 36.0 25.0 40.2 12.0 41.0 145-149 27.71165 30.0 18.0 38.6 12.0 41.0 150 29.4635 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 10.0 22 15.0 23 25.0 24 47.0 25 60.0 26 83.0 27 95.0 28 129.0 29 126.0 30 162.0 31 179.0 32 202.0 33 240.0 34 273.0 35 335.0 36 372.0 37 420.0 38 524.0 39 555.0 40 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.176795580110497 18.4270393240169 19.72700682482938 33.66915827104322 2 25.074999999999996 25.7 34.699999999999996 14.524999999999999 3 21.6 30.825000000000003 27.450000000000003 20.125 4 22.75 35.85 20.175 21.224999999999998 5 22.95 37.1 22.7 17.25 6 16.05 39.775 22.7 21.475 7 15.475 16.225 44.824999999999996 23.474999999999998 8 19.650000000000002 21.9 28.625 29.825000000000003 9 20.825 23.75 28.449999999999996 26.974999999999998 10-14 20.49 30.275000000000002 27.205000000000002 22.03 15-19 21.125 28.155 28.645 22.075 20-24 21.255 28.645 28.13 21.97 25-29 21.15 29.235 27.525 22.09 30-34 21.19 29.01 27.6 22.2 35-39 20.945 28.865000000000002 28.17 22.02 40-44 21.235 29.18 27.85 21.735 45-49 21.445 28.96 27.62 21.975 50-54 21.725 28.749999999999996 27.095000000000002 22.43 55-59 21.21 29.205 27.625 21.959999999999997 60-64 21.65 28.410000000000004 27.445000000000004 22.495 65-69 21.735 28.84 27.57 21.855 70-74 21.73 28.310000000000002 27.88 22.08 75-79 21.545 28.455000000000002 27.6 22.400000000000002 80-84 21.6 28.43 28.035 21.935 85-89 21.81 28.444999999999997 27.46 22.285 90-94 21.82 28.17 28.37 21.64 95-99 21.825 27.87 28.449999999999996 21.855 100-104 22.91 28.235 29.24 19.615 105-109 22.189999999999998 28.655 27.229999999999997 21.925 110-114 21.305 28.395 28.68 21.62 115-119 21.94 28.185 28.065 21.81 120-124 21.8 28.38 28.205000000000002 21.615000000000002 125-129 21.75 28.345 27.944999999999997 21.959999999999997 130-134 22.215 29.23 29.365000000000002 19.189999999999998 135-139 21.85 28.634999999999998 27.700000000000003 21.815 140-144 21.790000000000003 28.675 27.589999999999996 21.945 145-149 22.59 28.845 27.37 21.195 150 22.475 28.425 27.725 21.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.5 18 2.5 19 0.5 20 0.0 21 3.5 22 4.5 23 3.0 24 4.0 25 5.0 26 9.5 27 14.0 28 16.5 29 24.0 30 34.5 31 30.0 32 35.5 33 56.5 34 66.0 35 84.5 36 116.0 37 138.5 38 153.5 39 187.0 40 195.5 41 194.5 42 222.0 43 236.0 44 252.0 45 262.0 46 265.0 47 246.5 48 200.5 49 170.5 50 148.5 51 123.5 52 98.0 53 82.5 54 76.0 55 59.0 56 39.0 57 30.5 58 26.5 59 25.5 60 16.5 61 9.5 62 7.5 63 3.5 64 5.0 65 3.0 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.075000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.80211081794195 89.825 2 4.881266490765172 9.25 3 0.29023746701846964 0.8250000000000001 4 0.02638522427440633 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986234 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.115 32.0 2.0 32.0 2.0 32.0 2 30.99125 32.0 32.0 32.0 32.0 32.0 3 33.01 32.0 32.0 37.0 32.0 37.0 4 34.305 37.0 32.0 37.0 32.0 37.0 5 33.50125 37.0 32.0 37.0 27.0 37.0 6 37.26225 41.0 37.0 41.0 32.0 41.0 7 34.73825 37.0 32.0 41.0 12.0 41.0 8 37.44125 41.0 37.0 41.0 27.0 41.0 9 38.992 41.0 41.0 41.0 37.0 41.0 10-14 38.20065 41.0 38.6 41.0 31.0 41.0 15-19 38.580149999999996 41.0 39.4 41.0 33.0 41.0 20-24 38.4346 41.0 39.4 41.0 32.0 41.0 25-29 38.714 41.0 40.2 41.0 34.0 41.0 30-34 38.2588 41.0 38.6 41.0 30.0 41.0 35-39 35.17245 39.4 33.0 41.0 19.0 41.0 40-44 35.07555 39.4 33.0 41.0 22.0 41.0 45-49 35.41245 39.4 33.0 41.0 21.0 41.0 50-54 28.845350000000003 29.0 21.0 37.4 12.0 40.2 55-59 33.01545 35.6 29.0 40.2 19.0 41.0 60-64 33.4032 37.8 28.0 41.0 17.0 41.0 65-69 32.3197 37.0 26.0 41.0 14.0 41.0 70-74 31.5987 35.0 25.0 41.0 12.0 41.0 75-79 32.755250000000004 35.8 27.0 40.2 20.0 41.0 80-84 24.355150000000002 23.0 14.0 33.0 12.0 39.4 85-89 29.092000000000002 32.0 21.0 38.6 14.0 41.0 90-94 30.326999999999998 34.0 20.0 40.2 12.0 41.0 95-99 29.95045 34.0 20.0 40.2 12.0 41.0 100-104 27.881899999999995 30.0 17.0 37.8 12.0 41.0 105-109 25.5023 26.0 12.0 37.0 12.0 41.0 110-114 28.266499999999997 31.0 18.0 38.6 12.0 41.0 115-119 29.00445 32.0 17.0 39.4 12.0 41.0 120-124 23.37195 24.0 12.0 32.0 11.2 38.4 125-129 23.624599999999997 22.0 12.0 32.0 11.2 40.2 130-134 23.2286 23.0 12.0 33.0 12.0 37.8 135-139 21.748399999999997 21.0 12.0 30.0 11.2 36.8 140-144 20.80895 18.0 12.0 29.0 12.0 36.0 145-149 19.63855 16.0 12.0 26.0 11.2 35.0 150 23.557 22.0 12.0 32.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 5.0 17 15.0 18 26.0 19 36.0 20 72.0 21 92.0 22 117.0 23 147.0 24 159.0 25 201.0 26 204.0 27 208.0 28 232.0 29 253.0 30 246.0 31 274.0 32 296.0 33 296.0 34 257.0 35 287.0 36 253.0 37 184.0 38 92.0 39 43.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.034251675353683 20.178704393149665 18.242740134028296 33.54430379746836 2 23.35 27.800000000000004 34.225 14.625 3 22.05 31.324999999999996 26.474999999999998 20.150000000000002 4 21.8 36.4 20.625 21.175 5 23.325000000000003 37.1 21.975 17.599999999999998 6 16.025 38.65 24.175 21.15 7 16.05 16.725 44.975 22.25 8 18.8 22.400000000000002 28.999999999999996 29.799999999999997 9 20.849999999999998 23.575 29.175 26.400000000000002 10-14 20.52 29.854999999999997 27.034999999999997 22.59 15-19 21.404999999999998 27.57 28.51 22.515 20-24 21.005 29.085 27.82 22.09 25-29 21.7 28.38 28.060000000000002 21.86 30-34 21.17 28.935 28.189999999999998 21.705 35-39 21.315 28.560000000000002 28.185 21.94 40-44 22.05 28.38 28.27 21.3 45-49 21.325 28.73 28.555000000000003 21.39 50-54 23.369999999999997 28.665000000000003 28.849999999999998 19.115 55-59 22.895 28.505000000000003 28.425 20.175 60-64 21.64 28.655 28.225 21.48 65-69 22.24 28.775000000000002 27.639999999999997 21.345 70-74 22.259999999999998 28.7 28.32 20.72 75-79 21.845 28.52 28.535 21.099999999999998 80-84 22.475 29.235 31.014999999999997 17.275 85-89 22.11 29.095 27.97 20.825 90-94 22.245 28.82 28.54 20.395 95-99 22.06 28.665000000000003 28.444999999999997 20.830000000000002 100-104 23.075000000000003 28.68 28.395 19.85 105-109 22.634999999999998 28.915000000000003 28.73 19.72 110-114 22.61 29.015 27.455000000000002 20.919999999999998 115-119 22.61 27.944999999999997 28.34 21.105 120-124 23.635 29.45 28.4 18.515 125-129 22.945 28.939999999999998 28.605000000000004 19.509999999999998 130-134 23.625 28.71 28.23 19.435 135-139 23.325000000000003 28.78 29.875 18.02 140-144 23.71 28.37 28.939999999999998 18.98 145-149 24.64 28.965000000000003 28.96 17.435000000000002 150 22.7 28.65 28.499999999999996 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 2.5 20 3.0 21 5.0 22 6.0 23 3.5 24 4.5 25 7.5 26 10.0 27 16.5 28 21.0 29 23.5 30 32.5 31 43.0 32 54.5 33 64.5 34 78.5 35 96.0 36 112.5 37 136.5 38 171.5 39 203.5 40 217.5 41 241.5 42 254.0 43 239.5 44 246.0 45 235.5 46 211.5 47 204.5 48 190.5 49 158.5 50 135.5 51 116.0 52 86.5 53 71.0 54 62.5 55 56.0 56 45.5 57 33.5 58 26.0 59 22.0 60 15.0 61 8.5 62 6.0 63 5.0 64 3.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 32.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.04166666666667 92.2 2 3.75 7.199999999999999 3 0.20833333333333334 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.3125 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4875 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.5874999999999999 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378637 spots for SRR5986234.sra Written 1378637 spots for SRR5986234.sra Read 1378638 spots for SRR5986234.sra Written 1378638 spots for SRR5986234.sra SRR ids: ['SRR5986234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zyqliuy SRR5986234.sra spots: 27572741 blocks: [[1, 1378637], [1378638, 2757274], [2757275, 4135911], [4135912, 5514548], [5514549, 6893185], [6893186, 8271822], [8271823, 9650459], [9650460, 11029096], [11029097, 12407733], [12407734, 13786370], [13786371, 15165007], [15165008, 16543644], [16543645, 17922281], [17922282, 19300918], [19300919, 20679555], [20679556, 22058192], [22058193, 23436829], [23436830, 24815466], [24815467, 26194103], [26194104, 27572741]] SRR5986234 file size 9267943 SRR5986234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986234 SRR5986234_1.fastq SRR5986234_2.fastq Input file: SRR5986234_1.fastq Paired file: SRR5986234_2.fastq trimmed: SRR5986234-trimmed-pair1.fastq, SRR5986234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:19:25 2025 >> started Fri Feb 14 02:19:53 2025 >> done (28.503s) 27572741 read pairs processed; of these: 284 ( 0.00%) short read pairs filtered out after trimming by size control 585 ( 0.00%) empty read pairs filtered out after trimming by size control 27571872 (100.00%) read pairs available; of these: 1941400 ( 7.04%) trimmed read pairs available after processing 25630472 (92.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 39 0.00% 19 33 0.00% 20 34 0.00% 21 51 0.00% 22 55 0.00% 23 70 0.00% 24 71 0.00% 25 72 0.00% 26 90 0.00% 27 80 0.00% 28 87 0.00% 29 109 0.00% 30 98 0.00% 31 123 0.00% 32 79 0.00% 33 102 0.00% 34 88 0.00% 35 116 0.00% 36 111 0.00% 37 123 0.00% 38 118 0.00% 39 98 0.00% 40 135 0.00% 41 132 0.00% 42 130 0.00% 43 123 0.00% 44 146 0.00% 45 123 0.00% 46 117 0.00% 47 146 0.00% 48 151 0.00% 49 158 0.00% 50 128 0.00% 51 150 0.00% 52 136 0.00% 53 157 0.00% 54 190 0.00% 55 174 0.00% 56 171 0.00% 57 171 0.00% 58 177 0.00% 59 184 0.00% 60 168 0.00% 61 218 0.00% 62 241 0.00% 63 208 0.00% 64 219 0.00% 65 228 0.00% 66 240 0.00% 67 253 0.00% 68 256 0.00% 69 249 0.00% 70 300 0.00% 71 327 0.00% 72 353 0.00% 73 324 0.00% 74 365 0.00% 75 409 0.00% 76 460 0.00% 77 450 0.00% 78 419 0.00% 79 514 0.00% 80 496 0.00% 81 549 0.00% 82 641 0.00% 83 709 0.00% 84 730 0.00% 85 830 0.00% 86 832 0.00% 87 928 0.00% 88 1050 0.00% 89 1116 0.00% 90 1142 0.00% 91 1239 0.00% 92 1435 0.01% 93 1547 0.01% 94 1674 0.01% 95 1700 0.01% 96 1860 0.01% 97 2046 0.01% 98 2193 0.01% 99 2253 0.01% 100 2551 0.01% 101 2603 0.01% 102 2815 0.01% 103 3207 0.01% 104 3199 0.01% 105 3386 0.01% 106 3746 0.01% 107 3882 0.01% 108 4055 0.01% 109 4307 0.02% 110 4542 0.02% 111 4805 0.02% 112 5292 0.02% 113 5337 0.02% 114 5710 0.02% 115 6109 0.02% 116 6179 0.02% 117 6737 0.02% 118 6950 0.03% 119 7055 0.03% 120 7452 0.03% 121 7944 0.03% 122 8426 0.03% 123 8792 0.03% 124 9425 0.03% 125 9943 0.04% 126 10324 0.04% 127 10810 0.04% 128 11104 0.04% 129 11696 0.04% 130 11764 0.04% 131 12487 0.05% 132 13411 0.05% 133 13783 0.05% 134 14829 0.05% 135 15215 0.06% 136 15916 0.06% 137 16586 0.06% 138 17285 0.06% 139 17760 0.06% 140 18320 0.07% 141 18982 0.07% 142 20083 0.07% 143 20991 0.08% 144 22347 0.08% 145 24473 0.09% 146 28340 0.10% 147 43520 0.16% 148 134945 0.49% 149 1235963 4.48% 150 25630472 92.96% 27571872 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.3 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=366.13 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=31.4 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=2.3 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=311.23 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=29.5 sequence=AAGAAGAAGAAA SRR5986234 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:20:54 Started mapping on | Feb 14 02:20:54 Finished on | Feb 14 02:28:42 Mapping speed, Million of reads per hour | 212.09 Number of input reads | 27571872 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23036952 Uniquely mapped reads % | 83.55% Average mapped length | 289.04 Number of splices: Total | 20351793 Number of splices: Annotated (sjdb) | 19688642 Number of splices: GT/AG | 19856026 Number of splices: GC/AG | 282658 Number of splices: AT/AC | 20963 Number of splices: Non-canonical | 192146 Mismatch rate per base, % | 2.12% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1363410 % of reads mapped to multiple loci | 4.94% Number of reads mapped to too many loci | 34015 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.18% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3171510 3171510 3171510 N_multimapping 1363410 1363410 1363410 N_noFeature 790731 11810303 11806701 N_ambiguous 454404 122293 122710 UnstrandedReadsAssigned:21791817 PositiveStrandReadsAssigned:11104356 NegativeStrandReadsAssigned:11107541 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986234-trimmed-pair1.fastq SRR5986234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,571,872 reads, 22,052,488 reads pseudoaligned [quant] estimated average fragment length: 242.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR5986234.ke.tsv 34699 SRR5986234.se.tsv 87100 total ==> SRR5986234.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.44 1878 36.0731 Potri.005G024800.1.v4.1 1035 793.441 2355 101.278 Potri.004G059700.1.v4.1 961 719.457 18 0.853702 Potri.007G009000.2.v4.1 1416 1174.44 0 0 Potri.003G141000.2.v4.1 2943 2701.44 313.347 3.95793 Potri.016G087400.1.v4.1 270 54.5959 764 477.498 Potri.015G069301.1.v4.1 564 322.651 0 0 Potri.010G195200.1.v4.1 1773 1531.44 4 0.0891248 Potri.012G127500.1.v4.1 977 735.452 3653 169.486 ==> SRR5986234.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR5986234 completed mapping pipeline successfully