Starting /dee2/code/volunteer_pipeline.sh SRR5986235 current disk space = 3088054464512 free memory = 1510867352 SRR5986235 SRAfilesize 1b0ba46dfe912f698c90486526a2f006 SRR5986235.sra SRR5986235.sra file validated SRR5986235 is paired end SRR5986235 is conventional basespace SRR5986235 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3 32.0 27.0 32.0 12.0 32.0 2 29.2775 32.0 32.0 32.0 12.0 32.0 3 33.6375 32.0 32.0 37.0 32.0 37.0 4 26.18625 32.0 12.0 37.0 12.0 37.0 5 36.44 37.0 37.0 37.0 37.0 37.0 6 38.92925 41.0 37.0 41.0 37.0 41.0 7 36.74875 41.0 37.0 41.0 27.0 41.0 8 38.51325 41.0 37.0 41.0 32.0 41.0 9 39.7445 41.0 41.0 41.0 37.0 41.0 10-14 38.6715 41.0 38.6 41.0 34.0 41.0 15-19 39.3 41.0 39.4 41.0 34.0 41.0 20-24 37.9392 40.2 35.8 41.0 30.0 41.0 25-29 32.87215 35.6 27.8 40.2 20.0 41.0 30-34 32.503 36.8 25.0 41.0 19.0 41.0 35-39 35.0879 39.2 33.0 41.0 23.0 41.0 40-44 32.865750000000006 36.6 24.0 40.2 19.0 41.0 45-49 36.501400000000004 39.2 34.0 41.0 28.0 41.0 50-54 35.8301 40.2 35.0 41.0 21.0 41.0 55-59 36.268899999999995 39.4 33.8 41.0 25.0 41.0 60-64 37.0166 41.0 36.8 41.0 28.0 41.0 65-69 38.1081 41.0 38.6 41.0 31.0 41.0 70-74 33.607 36.6 28.8 40.2 21.0 41.0 75-79 37.796749999999996 40.2 37.6 41.0 31.0 41.0 80-84 38.988099999999996 41.0 40.2 41.0 36.0 41.0 85-89 36.1178 40.2 34.0 41.0 25.0 41.0 90-94 38.7799 41.0 39.4 41.0 33.0 41.0 95-99 37.008900000000004 41.0 36.0 41.0 27.0 41.0 100-104 34.2136 37.8 30.0 41.0 20.0 41.0 105-109 36.02305 39.4 34.0 41.0 25.0 41.0 110-114 31.29135 32.0 26.0 39.4 18.0 41.0 115-119 29.49785 32.0 21.0 37.6 14.0 40.2 120-124 28.3452 27.0 23.0 35.6 17.0 39.4 125-129 26.314 25.0 19.0 34.0 12.0 39.4 130-134 19.317249999999998 15.0 14.0 27.0 10.4 34.0 135-139 25.636899999999997 27.0 18.0 34.0 12.0 39.4 140-144 28.300349999999998 30.0 19.0 36.6 16.0 41.0 145-149 25.4326 27.0 16.0 35.0 12.0 39.4 150 31.0325 32.0 27.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 4.0 21 6.0 22 18.0 23 18.0 24 39.0 25 46.0 26 74.0 27 99.0 28 133.0 29 182.0 30 250.0 31 278.0 32 346.0 33 458.0 34 440.0 35 516.0 36 447.0 37 387.0 38 203.0 39 52.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.919220055710305 19.06811851101545 17.295517852620918 32.71714358065333 2 25.312656328164078 26.713356678339167 33.1415707853927 14.832416208104052 3 21.45 30.75 26.575 21.224999999999998 4 27.775 38.5 17.474999999999998 16.25 5 22.325 39.175 21.425 17.075000000000003 6 15.825 39.95 24.025 20.200000000000003 7 17.05 15.75 43.125 24.075 8 18.575 22.425 27.224999999999998 31.775 9 19.8 22.900000000000002 30.175 27.125 10-14 21.035 29.880000000000003 27.275 21.81 15-19 21.445 27.725 28.18 22.650000000000002 20-24 21.975 29.439999999999998 27.46 21.125 25-29 24.16120806040302 28.41142057102855 26.55132756637832 20.876043802190107 30-34 22.90114505725286 28.356417820891046 27.83639181959098 20.906045302265113 35-39 22.720000000000002 29.225 26.540000000000003 21.515 40-44 23.74 28.43 26.6 21.23 45-49 22.41 28.52 27.255000000000003 21.815 50-54 22.08 28.475 27.6 21.845 55-59 22.505 28.244999999999997 27.889999999999997 21.36 60-64 21.825 28.035 28.08 22.06 65-69 21.87 28.470000000000002 27.375 22.285 70-74 23.64 28.255000000000003 26.640000000000004 21.465 75-79 22.115000000000002 28.43 28.265 21.19 80-84 21.605 28.435 27.88 22.08 85-89 22.526126306315316 27.966398319915996 27.92139606980349 21.586079303965196 90-94 22.045 28.444999999999997 27.66 21.85 95-99 21.995 28.235 28.410000000000004 21.36 100-104 22.11 28.255000000000003 27.82 21.815 105-109 22.065 28.09 28.04 21.805 110-114 23.365 27.99 27.855 20.79 115-119 24.6 27.735 27.105 20.560000000000002 120-124 24.755 28.685 27.975 18.584999999999997 125-129 24.2 28.189999999999998 27.41 20.200000000000003 130-134 26.615 30.625000000000004 26.82 15.939999999999998 135-139 23.01 27.779999999999998 28.07 21.14 140-144 24.27 27.495000000000005 27.500000000000004 20.735 145-149 23.53 28.33 27.79 20.349999999999998 150 22.025 28.249999999999996 28.025 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 3.5 22 2.5 23 3.5 24 6.0 25 5.5 26 5.0 27 10.0 28 11.0 29 11.5 30 21.0 31 35.0 32 41.5 33 43.0 34 63.0 35 76.5 36 86.5 37 119.0 38 138.0 39 165.0 40 202.0 41 205.5 42 215.5 43 247.5 44 263.5 45 263.0 46 249.0 47 223.5 48 214.0 49 194.5 50 161.5 51 138.5 52 123.5 53 101.5 54 76.0 55 62.5 56 55.5 57 42.5 58 26.0 59 18.5 60 13.5 61 10.5 62 8.5 63 7.5 64 5.0 65 3.5 66 4.0 67 3.0 68 1.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 97.72320286518291 95.5 2 2.225633154259401 4.35 3 0.051163980557687394 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.11249999999999999 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6375 0.0 0.0 0.0 0.0 136-137 0.8 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCCC 10 0.0069754543 143.9875 7 CTCTGTA 10 0.0069754543 143.9875 6 >>END_MODULE SRR5986235 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.07 32.0 32.0 32.0 27.0 32.0 2 27.8075 32.0 27.0 32.0 12.0 32.0 3 29.8125 32.0 32.0 32.0 12.0 37.0 4 33.29375 37.0 32.0 37.0 22.0 37.0 5 35.90625 37.0 37.0 37.0 32.0 37.0 6 31.55875 37.0 27.0 41.0 12.0 41.0 7 38.2385 41.0 37.0 41.0 32.0 41.0 8 38.8965 41.0 41.0 41.0 37.0 41.0 9 38.84475 41.0 41.0 41.0 32.0 41.0 10-14 38.6985 41.0 39.4 41.0 33.0 41.0 15-19 36.7489 40.2 34.8 41.0 26.0 41.0 20-24 38.7645 41.0 40.2 41.0 34.0 41.0 25-29 36.45345 40.2 34.0 41.0 25.0 41.0 30-34 38.1101 41.0 39.4 41.0 32.0 41.0 35-39 36.47225 40.2 35.8 41.0 25.0 41.0 40-44 38.514250000000004 41.0 38.6 41.0 32.0 41.0 45-49 38.4431 41.0 38.6 41.0 32.0 41.0 50-54 35.788850000000004 40.2 33.0 41.0 24.0 41.0 55-59 38.134049999999995 41.0 38.6 41.0 32.0 41.0 60-64 34.75835 39.4 31.8 41.0 21.0 41.0 65-69 38.142999999999994 41.0 37.8 41.0 31.0 41.0 70-74 38.13035000000001 41.0 38.6 41.0 31.0 41.0 75-79 38.13575 40.2 39.4 41.0 31.0 41.0 80-84 38.170100000000005 41.0 37.8 41.0 31.0 41.0 85-89 36.15825 39.4 34.8 41.0 26.0 41.0 90-94 36.3701 40.2 36.0 41.0 23.0 41.0 95-99 34.1849 37.8 31.0 41.0 18.0 41.0 100-104 35.851749999999996 40.2 34.0 41.0 23.0 41.0 105-109 33.72555 37.8 30.0 41.0 16.0 41.0 110-114 32.00295 34.8 25.0 40.2 17.0 41.0 115-119 32.31745 36.0 26.0 40.2 18.0 41.0 120-124 34.81245 38.6 32.0 41.0 21.0 41.0 125-129 31.156150000000004 34.0 25.0 39.4 16.0 41.0 130-134 30.467049999999993 34.0 24.0 39.4 14.0 41.0 135-139 26.7796 27.0 18.0 37.0 12.0 41.0 140-144 29.78345 32.0 22.0 37.8 12.0 41.0 145-149 28.0536 28.0 21.0 35.8 11.2 40.2 150 24.03325 27.0 12.0 32.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 4.0 18 6.0 19 2.0 20 14.0 21 15.0 22 34.0 23 28.0 24 29.0 25 39.0 26 61.0 27 79.0 28 102.0 29 123.0 30 128.0 31 150.0 32 189.0 33 221.0 34 289.0 35 369.0 36 452.0 37 582.0 38 591.0 39 392.0 40 98.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.95 18.525 19.25 33.275 2 26.244683512634477 26.069552164123095 34.17563172379284 13.510132599449587 3 22.175 29.625 28.050000000000004 20.150000000000002 4 22.775000000000002 34.325 21.9 21.0 5 23.067300475356518 37.97848386289717 22.641981486114584 16.312234175631723 6 18.45 37.45 24.474999999999998 19.625 7 16.887997995489854 16.862941618641944 44.97619644199449 21.272863943873716 8 17.675 21.625 30.275000000000002 30.425 9 20.375 23.1 29.5 27.025 10-14 20.389077815563112 29.520904180836165 27.880576115223043 22.209441888377675 15-19 22.052205220522055 27.83278327832783 28.17781778177818 21.937193719371937 20-24 20.474094818963792 28.985797159431886 27.975595119023804 22.564512902580518 25-29 21.43 28.98 27.965 21.625 30-34 21.224999999999998 29.270000000000003 27.575 21.93 35-39 21.755 29.115000000000002 27.57 21.560000000000002 40-44 21.12 29.160000000000004 27.41 22.31 45-49 22.15110755537777 28.596429821491075 27.296364818240914 21.956097804890245 50-54 21.67608380419021 29.091454572728637 27.27636381819091 21.956097804890245 55-59 21.37 28.64 28.139999999999997 21.85 60-64 22.855 28.895 27.155 21.095 65-69 21.645 29.37 27.334999999999997 21.65 70-74 21.5910795539777 28.436421821091056 28.201410070503524 21.771088554427724 75-79 21.711085554277716 28.30641532076604 27.66638331916596 22.31611580579029 80-84 21.66216621662166 29.3979397939794 27.652765276527653 21.287128712871286 85-89 22.126106305315265 28.826441322066103 27.391369568478424 21.656082804140205 90-94 21.46143843152946 28.88366509952986 27.683304991497447 21.971591477443233 95-99 22.06720672067207 28.44784478447845 27.732773277327734 21.752175217521753 100-104 21.657165716571658 28.02280228022802 28.997899789978998 21.322132213221323 105-109 22.31611580579029 27.896394819740987 27.961398069903492 21.826091304565228 110-114 22.96 27.975 27.87 21.195 115-119 23.011150557527877 28.25641282064103 27.861393069653484 20.87104355217761 120-124 21.68108405420271 28.296414820741038 28.21641082054103 21.806090304515227 125-129 23.549999999999997 27.935 27.650000000000002 20.865000000000002 130-134 22.895 27.855 28.03 21.22 135-139 24.251212560628034 27.881394069703486 27.29136456822841 20.57602880144007 140-144 23.04115205760288 27.031351567578376 27.966398319915996 21.961098054902745 145-149 24.055 28.725 26.96 20.26 150 23.599999999999998 27.875 27.525 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 3.5 25 6.5 26 6.0 27 10.5 28 16.5 29 23.5 30 30.0 31 30.5 32 37.0 33 48.5 34 64.5 35 86.0 36 97.5 37 118.5 38 156.0 39 182.0 40 202.0 41 234.5 42 247.5 43 258.5 44 247.0 45 244.0 46 249.0 47 230.0 48 209.0 49 181.5 50 158.5 51 129.0 52 106.5 53 84.5 54 71.0 55 59.0 56 42.0 57 31.0 58 22.5 59 17.0 60 15.0 61 8.0 62 4.0 63 4.5 64 5.0 65 3.5 66 1.5 67 0.0 68 1.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.075 6 0.0 7 0.22499999999999998 8 0.0 9 0.0 10-14 0.02 15-19 0.01 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.005 80-84 0.01 85-89 0.005 90-94 0.03 95-99 0.01 100-104 0.01 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.25974025974025 92.65 2 3.5844155844155843 6.9 3 0.15584415584415584 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.11249999999999999 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTG 10 0.006973645 144.0 3 TTGCTTC 10 0.006973645 144.0 3 >>END_MODULE Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219212 spots for SRR5986235.sra Written 1219212 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra Read 1219207 spots for SRR5986235.sra Written 1219207 spots for SRR5986235.sra SRR ids: ['SRR5986235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mn2fycmu SRR5986235.sra spots: 24384145 blocks: [[1, 1219207], [1219208, 2438414], [2438415, 3657621], [3657622, 4876828], [4876829, 6096035], [6096036, 7315242], [7315243, 8534449], [8534450, 9753656], [9753657, 10972863], [10972864, 12192070], [12192071, 13411277], [13411278, 14630484], [14630485, 15849691], [15849692, 17068898], [17068899, 18288105], [18288106, 19507312], [19507313, 20726519], [20726520, 21945726], [21945727, 23164933], [23164934, 24384145]] SRR5986235 file size 8193660 SRR5986235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986235 SRR5986235_1.fastq SRR5986235_2.fastq Input file: SRR5986235_1.fastq Paired file: SRR5986235_2.fastq trimmed: SRR5986235-trimmed-pair1.fastq, SRR5986235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:46:35 2025 >> started Fri Feb 14 02:47:00 2025 >> done (24.591s) 24384145 read pairs processed; of these: 233 ( 0.00%) short read pairs filtered out after trimming by size control 345 ( 0.00%) empty read pairs filtered out after trimming by size control 24383567 (100.00%) read pairs available; of these: 1526436 ( 6.26%) trimmed read pairs available after processing 22857131 (93.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 33 0.00% 19 27 0.00% 20 62 0.00% 21 66 0.00% 22 79 0.00% 23 71 0.00% 24 102 0.00% 25 104 0.00% 26 103 0.00% 27 120 0.00% 28 147 0.00% 29 127 0.00% 30 123 0.00% 31 149 0.00% 32 151 0.00% 33 167 0.00% 34 153 0.00% 35 154 0.00% 36 169 0.00% 37 154 0.00% 38 191 0.00% 39 200 0.00% 40 171 0.00% 41 180 0.00% 42 177 0.00% 43 182 0.00% 44 185 0.00% 45 181 0.00% 46 237 0.00% 47 194 0.00% 48 201 0.00% 49 197 0.00% 50 239 0.00% 51 221 0.00% 52 216 0.00% 53 229 0.00% 54 241 0.00% 55 267 0.00% 56 240 0.00% 57 257 0.00% 58 290 0.00% 59 273 0.00% 60 282 0.00% 61 293 0.00% 62 315 0.00% 63 301 0.00% 64 315 0.00% 65 290 0.00% 66 290 0.00% 67 331 0.00% 68 329 0.00% 69 323 0.00% 70 380 0.00% 71 384 0.00% 72 395 0.00% 73 410 0.00% 74 435 0.00% 75 417 0.00% 76 478 0.00% 77 488 0.00% 78 520 0.00% 79 576 0.00% 80 638 0.00% 81 554 0.00% 82 639 0.00% 83 725 0.00% 84 804 0.00% 85 762 0.00% 86 827 0.00% 87 889 0.00% 88 959 0.00% 89 954 0.00% 90 1032 0.00% 91 1175 0.00% 92 1255 0.01% 93 1319 0.01% 94 1516 0.01% 95 1627 0.01% 96 1741 0.01% 97 1765 0.01% 98 1921 0.01% 99 2084 0.01% 100 2230 0.01% 101 2391 0.01% 102 2604 0.01% 103 2861 0.01% 104 2956 0.01% 105 3244 0.01% 106 3458 0.01% 107 3545 0.01% 108 3700 0.02% 109 3962 0.02% 110 4249 0.02% 111 4586 0.02% 112 4869 0.02% 113 5313 0.02% 114 5518 0.02% 115 6098 0.03% 116 6196 0.03% 117 6540 0.03% 118 6785 0.03% 119 7177 0.03% 120 7426 0.03% 121 7814 0.03% 122 8493 0.03% 123 9068 0.04% 124 9376 0.04% 125 10090 0.04% 126 10647 0.04% 127 11058 0.05% 128 11468 0.05% 129 12029 0.05% 130 12423 0.05% 131 13166 0.05% 132 13581 0.06% 133 14566 0.06% 134 15476 0.06% 135 15891 0.07% 136 16722 0.07% 137 17764 0.07% 138 18046 0.07% 139 18998 0.08% 140 19568 0.08% 141 20444 0.08% 142 21401 0.09% 143 22699 0.09% 144 24026 0.10% 145 25549 0.10% 146 28811 0.12% 147 39545 0.16% 148 99681 0.41% 149 844560 3.46% 150 22857131 93.74% 24383567 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=26 prefix-density=0.14 prefix-fanout=2.4 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=355.51 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=31.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.3 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=367.76 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=30.9 sequence=AAGAAGAAGAAA SRR5986235 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:47:59 Started mapping on | Feb 14 02:47:59 Finished on | Feb 14 02:54:32 Mapping speed, Million of reads per hour | 223.36 Number of input reads | 24383567 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20657630 Uniquely mapped reads % | 84.72% Average mapped length | 289.65 Number of splices: Total | 19017711 Number of splices: Annotated (sjdb) | 18430522 Number of splices: GT/AG | 18569741 Number of splices: GC/AG | 265983 Number of splices: AT/AC | 18273 Number of splices: Non-canonical | 163714 Mismatch rate per base, % | 2.04% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1138327 % of reads mapped to multiple loci | 4.67% Number of reads mapped to too many loci | 27050 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.29% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2587610 2587610 2587610 N_multimapping 1138327 1138327 1138327 N_noFeature 690371 10590484 10584269 N_ambiguous 368188 98049 98092 UnstrandedReadsAssigned:19599071 PositiveStrandReadsAssigned:9969097 NegativeStrandReadsAssigned:9975269 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986235-trimmed-pair1.fastq SRR5986235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,383,567 reads, 19,630,409 reads pseudoaligned [quant] estimated average fragment length: 232.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR5986235.ke.tsv 34699 SRR5986235.se.tsv 87100 total ==> SRR5986235.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.1 1275 29.2618 Potri.005G024800.1.v4.1 1035 803.104 813 41.4969 Potri.004G059700.1.v4.1 961 729.104 12 0.674666 Potri.007G009000.2.v4.1 1416 1184.1 1 0.0346184 Potri.003G141000.2.v4.1 2943 2711.1 296.107 4.47712 Potri.016G087400.1.v4.1 270 57.7666 677 480.406 Potri.015G069301.1.v4.1 564 332.177 0 0 Potri.010G195200.1.v4.1 1773 1541.1 20 0.53198 Potri.012G127500.1.v4.1 977 745.104 3699 203.5 ==> SRR5986235.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR5986235 completed mapping pipeline successfully