Starting /dee2/code/volunteer_pipeline.sh SRR5986236 current disk space = 3088094339072 free memory = 1580221488 SRR5986236 SRAfilesize 0279a680d47a64cc0d8d8c352ca7e046 SRR5986236.sra SRR5986236.sra file validated SRR5986236 is paired end SRR5986236 is conventional basespace SRR5986236 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.165 32.0 27.0 32.0 2.0 32.0 2 31.45375 32.0 32.0 32.0 32.0 32.0 3 33.125 32.0 32.0 37.0 32.0 37.0 4 35.17125 37.0 37.0 37.0 32.0 37.0 5 35.91 37.0 37.0 37.0 32.0 37.0 6 39.26825 41.0 41.0 41.0 37.0 41.0 7 39.1305 41.0 37.0 41.0 37.0 41.0 8 39.501 41.0 41.0 41.0 37.0 41.0 9 39.583 41.0 41.0 41.0 37.0 41.0 10-14 39.2954 41.0 41.0 41.0 36.0 41.0 15-19 39.268550000000005 41.0 40.2 41.0 36.0 41.0 20-24 39.42985 41.0 41.0 41.0 37.0 41.0 25-29 38.679899999999996 41.0 39.4 41.0 34.0 41.0 30-34 38.7585 41.0 39.4 41.0 35.0 41.0 35-39 38.327999999999996 41.0 38.6 41.0 32.0 41.0 40-44 38.20595 41.0 38.6 41.0 31.0 41.0 45-49 37.3336 41.0 37.0 41.0 27.0 41.0 50-54 36.53895 41.0 37.0 41.0 25.0 41.0 55-59 36.80745 41.0 36.0 41.0 26.0 41.0 60-64 37.0059 41.0 36.0 41.0 26.0 41.0 65-69 35.742200000000004 40.2 35.0 41.0 23.0 41.0 70-74 37.5356 41.0 37.0 41.0 28.0 41.0 75-79 37.35935 41.0 37.0 41.0 28.0 41.0 80-84 34.403800000000004 38.6 31.0 41.0 16.0 41.0 85-89 35.674549999999996 41.0 34.0 41.0 20.0 41.0 90-94 36.66465 41.0 37.0 41.0 25.0 41.0 95-99 35.4057 39.4 33.0 41.0 21.0 41.0 100-104 31.574600000000004 35.0 25.0 41.0 14.0 41.0 105-109 33.735400000000006 38.6 30.0 41.0 16.0 41.0 110-114 33.72275 37.8 29.0 41.0 18.0 41.0 115-119 35.286249999999995 39.4 33.0 41.0 23.0 41.0 120-124 32.09075 37.8 26.0 41.0 15.0 41.0 125-129 31.618100000000005 36.0 25.0 40.2 12.0 41.0 130-134 31.176800000000004 36.0 25.0 40.2 12.0 41.0 135-139 32.84085 37.0 29.0 41.0 12.0 41.0 140-144 28.09345 31.0 18.0 37.6 12.0 41.0 145-149 31.174300000000006 35.0 26.0 41.0 12.0 41.0 150 31.35825 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 5.0 21 13.0 22 13.0 23 29.0 24 44.0 25 46.0 26 80.0 27 89.0 28 123.0 29 101.0 30 149.0 31 175.0 32 187.0 33 215.0 34 254.0 35 279.0 36 328.0 37 394.0 38 380.0 39 582.0 40 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.686539643515676 18.00860479409957 18.71542716656423 33.58942839582053 2 23.825 25.974999999999998 36.175000000000004 14.025000000000002 3 22.55563890972743 30.582645661415352 27.7569392348087 19.10477619404851 4 22.45 35.925000000000004 20.7 20.925 5 22.25 38.975 21.15 17.625 6 16.45 37.724999999999994 24.45 21.375 7 15.85 15.675 44.975 23.5 8 19.650000000000002 23.9 28.4 28.050000000000004 9 21.15 23.724999999999998 29.225 25.900000000000002 10-14 20.69 30.220000000000002 26.985 22.105 15-19 20.43 28.299999999999997 28.43 22.84 20-24 21.205 29.09 27.62 22.085 25-29 21.465 28.515 27.26 22.759999999999998 30-34 20.585 29.075 28.13 22.21 35-39 21.525 29.12 27.6 21.755 40-44 21.375 28.98 27.560000000000002 22.085 45-49 21.605 28.785 27.245 22.365 50-54 21.315 28.42 28.075 22.189999999999998 55-59 21.33 28.720000000000002 28.189999999999998 21.759999999999998 60-64 21.455 27.800000000000004 27.939999999999998 22.805 65-69 21.75 28.689999999999998 28.015 21.545 70-74 21.925 28.055000000000003 27.589999999999996 22.43 75-79 21.29 28.46 27.894999999999996 22.355 80-84 21.82 28.610000000000003 27.92 21.65 85-89 21.55 29.32 27.189999999999998 21.94 90-94 21.9 28.255000000000003 28.03 21.815 95-99 21.86 28.115000000000002 28.544999999999998 21.48 100-104 21.884999999999998 27.91 28.560000000000002 21.645 105-109 21.25 28.28 28.134999999999998 22.335 110-114 22.155 27.32 29.270000000000003 21.255 115-119 22.055 28.23 27.85 21.865000000000002 120-124 21.755 28.689999999999998 28.18 21.375 125-129 21.66 28.345 28.915000000000003 21.08 130-134 22.175 28.205000000000002 28.665000000000003 20.955 135-139 21.529999999999998 28.395 28.165000000000003 21.91 140-144 22.005 28.060000000000002 28.93 21.005 145-149 22.625 27.705000000000002 27.839999999999996 21.83 150 21.8 28.925 28.1 21.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 1.0 21 2.0 22 4.5 23 4.0 24 2.0 25 3.0 26 7.5 27 12.0 28 16.5 29 23.5 30 27.5 31 31.0 32 38.0 33 54.5 34 70.0 35 75.5 36 89.5 37 119.0 38 147.0 39 176.0 40 203.0 41 238.5 42 260.5 43 249.5 44 253.0 45 266.0 46 247.0 47 227.0 48 220.5 49 179.0 50 146.0 51 128.0 52 109.5 53 89.5 54 68.0 55 53.5 56 38.0 57 30.5 58 20.0 59 14.5 60 13.0 61 10.0 62 6.0 63 2.5 64 4.0 65 4.0 66 3.0 67 1.5 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.65 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16933578367025 90.625 2 4.646888947230244 8.85 3 0.18377526909950118 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.875 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTAAG 10 0.0070008645 143.8125 6 GTCTTCA 10 0.0070008645 143.8125 4 AAAAAAA 35 0.003709262 20.544643 50-54 >>END_MODULE SRR5986236 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.2875 32.0 12.0 32.0 2.0 32.0 2 30.7475 32.0 32.0 32.0 32.0 32.0 3 31.81125 32.0 32.0 37.0 27.0 37.0 4 34.685 37.0 32.0 37.0 32.0 37.0 5 35.6275 37.0 37.0 37.0 32.0 37.0 6 38.7125 41.0 37.0 41.0 32.0 41.0 7 33.06475 37.0 27.0 41.0 12.0 41.0 8 37.515 41.0 37.0 41.0 32.0 41.0 9 35.02425 41.0 32.0 41.0 12.0 41.0 10-14 36.49785000000001 41.0 36.0 41.0 24.0 41.0 15-19 34.179199999999994 37.6 30.0 41.0 20.0 41.0 20-24 35.081 39.4 32.0 41.0 21.0 41.0 25-29 34.8212 39.4 32.0 41.0 21.0 41.0 30-34 30.063200000000002 33.0 21.0 40.2 14.0 41.0 35-39 33.9397 38.4 30.0 41.0 18.0 41.0 40-44 29.27355 30.8 22.0 37.6 15.0 40.2 45-49 30.708999999999996 34.0 21.0 40.2 12.0 41.0 50-54 31.92455 35.8 23.0 41.0 16.0 41.0 55-59 29.8635 33.0 18.0 39.4 14.0 41.0 60-64 29.1579 32.0 19.0 40.2 14.0 41.0 65-69 26.9002 27.0 18.0 38.4 12.0 40.2 70-74 27.529199999999996 27.0 18.0 37.6 12.0 40.2 75-79 30.58405 35.0 21.0 41.0 12.0 41.0 80-84 28.17115 32.0 16.0 39.2 12.0 41.0 85-89 29.444350000000004 34.0 20.0 40.2 12.0 41.0 90-94 24.7078 24.0 14.0 35.0 12.0 40.2 95-99 24.5043 24.0 14.0 36.0 12.0 40.2 100-104 23.691700000000004 20.0 12.0 35.0 12.0 40.2 105-109 24.5607 24.0 12.0 35.0 12.0 39.4 110-114 25.72015 27.0 14.0 35.0 12.0 41.0 115-119 24.44515 24.0 12.0 36.0 12.0 41.0 120-124 23.10385 22.0 12.0 33.0 12.0 40.2 125-129 22.077749999999998 20.0 12.0 30.0 12.0 37.0 130-134 21.794449999999998 19.0 12.0 31.0 12.0 38.6 135-139 21.23025 20.0 12.0 29.0 12.0 37.0 140-144 21.5352 20.0 12.0 30.0 12.0 37.0 145-149 19.1352 16.0 12.0 25.0 11.2 34.0 150 19.03725 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 15.0 16 47.0 17 105.0 18 140.0 19 176.0 20 185.0 21 178.0 22 196.0 23 179.0 24 196.0 25 174.0 26 171.0 27 200.0 28 182.0 29 221.0 30 216.0 31 194.0 32 217.0 33 200.0 34 199.0 35 184.0 36 186.0 37 127.0 38 87.0 39 22.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.893738140417458 19.512966476913345 19.291587602783046 33.301707779886144 2 23.1 26.1 35.725 15.075 3 20.525 30.349999999999998 28.449999999999996 20.674999999999997 4 22.625 36.449999999999996 21.025 19.900000000000002 5 22.0 38.475 22.2 17.325 6 16.05 38.35 24.349999999999998 21.25 7 15.775 17.05 43.325 23.849999999999998 8 18.3 22.775000000000002 29.25 29.675 9 20.025000000000002 21.6 31.175000000000004 27.200000000000003 10-14 20.755000000000003 29.549999999999997 27.584999999999997 22.11 15-19 21.8 27.584999999999997 28.999999999999996 21.615000000000002 20-24 21.044999999999998 28.505000000000003 28.375 22.075 25-29 21.465 28.884999999999998 28.685 20.965 30-34 22.535 28.955 29.080000000000002 19.43 35-39 22.415 29.134999999999998 28.175 20.275000000000002 40-44 23.095 30.064999999999998 29.34 17.5 45-49 22.895 29.104999999999997 29.099999999999998 18.9 50-54 22.89 28.689999999999998 28.37 20.05 55-59 22.205 28.994999999999997 29.580000000000002 19.220000000000002 60-64 22.715 28.485 29.785 19.015 65-69 23.355 29.080000000000002 29.595 17.97 70-74 23.86 28.67 29.134999999999998 18.335 75-79 22.27 28.51 29.14 20.080000000000002 80-84 21.715 29.189999999999998 30.97 18.125 85-89 22.220000000000002 28.494999999999997 29.465000000000003 19.82 90-94 23.1 29.12 31.72 16.06 95-99 23.22 29.64 30.294999999999998 16.845 100-104 22.88 29.335 30.625000000000004 17.16 105-109 22.18 29.04 31.285 17.495 110-114 23.36 28.144999999999996 29.92 18.575 115-119 22.85 28.49 29.86 18.8 120-124 22.6 29.14 30.39 17.87 125-129 23.200000000000003 28.03 31.075000000000003 17.695 130-134 23.275000000000002 28.910000000000004 31.075000000000003 16.74 135-139 23.03 28.389999999999997 31.56 17.02 140-144 22.97 28.18 30.75 18.099999999999998 145-149 24.07 28.77 31.28 15.879999999999999 150 23.025000000000002 26.724999999999998 34.300000000000004 15.950000000000001 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 2.0 18 3.0 19 2.0 20 1.0 21 2.5 22 7.0 23 11.0 24 8.0 25 8.0 26 15.0 27 18.0 28 23.5 29 36.0 30 44.5 31 52.5 32 66.0 33 73.0 34 87.5 35 116.5 36 149.5 37 162.5 38 172.5 39 203.5 40 236.0 41 248.5 42 254.0 43 263.0 44 260.0 45 227.0 46 194.5 47 189.5 48 170.5 49 148.5 50 122.5 51 91.5 52 69.5 53 57.5 54 48.5 55 36.5 56 28.0 57 18.5 58 13.0 59 14.0 60 13.0 61 7.0 62 2.0 63 3.0 64 4.5 65 3.0 66 1.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.025 0.0 0.0 0.025 0.0 106-107 0.0625 0.0 0.0 0.025 0.0 108-109 0.075 0.0 0.0 0.025 0.0 110-111 0.1125 0.0 0.0 0.025 0.0 112-113 0.15 0.0 0.0 0.025 0.0 114-115 0.175 0.0 0.0 0.025 0.0 116-117 0.175 0.0 0.0 0.025 0.0 118-119 0.21250000000000002 0.0 0.0 0.025 0.0 120-121 0.225 0.0 0.0 0.025 0.0 122-123 0.2625 0.0 0.0 0.025 0.0 124-125 0.325 0.0 0.0 0.025 0.0 126-127 0.325 0.0 0.0 0.025 0.0 128-129 0.35 0.0 0.0 0.025 0.0 130-131 0.55 0.0 0.0 0.025 0.0 132-133 0.5874999999999999 0.0 0.0 0.025 0.0 134-135 0.625 0.0 0.0 0.025 0.0 136-137 0.6375 0.0 0.0 0.025 0.0 138 0.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAT 10 0.0037292608 177.0 1 AACTCAG 10 0.0070008645 143.8125 5 AAAGAGC 10 0.0070008645 143.8125 4 GCCCTTT 10 0.0070008645 143.8125 9 >>END_MODULE Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101034 spots for SRR5986236.sra Written 1101034 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra Read 1101026 spots for SRR5986236.sra Written 1101026 spots for SRR5986236.sra SRR ids: ['SRR5986236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8eh3fhib SRR5986236.sra spots: 22020528 blocks: [[1, 1101026], [1101027, 2202052], [2202053, 3303078], [3303079, 4404104], [4404105, 5505130], [5505131, 6606156], [6606157, 7707182], [7707183, 8808208], [8808209, 9909234], [9909235, 11010260], [11010261, 12111286], [12111287, 13212312], [13212313, 14313338], [14313339, 15414364], [15414365, 16515390], [16515391, 17616416], [17616417, 18717442], [18717443, 19818468], [19818469, 20919494], [20919495, 22020528]] SRR5986236 file size 7397325 SRR5986236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986236 SRR5986236_1.fastq SRR5986236_2.fastq Input file: SRR5986236_1.fastq Paired file: SRR5986236_2.fastq trimmed: SRR5986236-trimmed-pair1.fastq, SRR5986236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:10:46 2025 >> started Fri Feb 14 03:11:09 2025 >> done (22.441s) 22020528 read pairs processed; of these: 191 ( 0.00%) short read pairs filtered out after trimming by size control 332 ( 0.00%) empty read pairs filtered out after trimming by size control 22020005 (100.00%) read pairs available; of these: 1841859 ( 8.36%) trimmed read pairs available after processing 20178146 (91.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 27 0.00% 20 25 0.00% 21 22 0.00% 22 35 0.00% 23 41 0.00% 24 37 0.00% 25 54 0.00% 26 44 0.00% 27 41 0.00% 28 59 0.00% 29 43 0.00% 30 57 0.00% 31 59 0.00% 32 62 0.00% 33 58 0.00% 34 68 0.00% 35 58 0.00% 36 63 0.00% 37 74 0.00% 38 64 0.00% 39 72 0.00% 40 81 0.00% 41 74 0.00% 42 68 0.00% 43 75 0.00% 44 78 0.00% 45 84 0.00% 46 71 0.00% 47 77 0.00% 48 79 0.00% 49 90 0.00% 50 81 0.00% 51 75 0.00% 52 103 0.00% 53 76 0.00% 54 107 0.00% 55 96 0.00% 56 93 0.00% 57 101 0.00% 58 132 0.00% 59 108 0.00% 60 125 0.00% 61 125 0.00% 62 143 0.00% 63 140 0.00% 64 131 0.00% 65 160 0.00% 66 146 0.00% 67 151 0.00% 68 184 0.00% 69 187 0.00% 70 166 0.00% 71 203 0.00% 72 185 0.00% 73 193 0.00% 74 228 0.00% 75 233 0.00% 76 264 0.00% 77 273 0.00% 78 258 0.00% 79 329 0.00% 80 371 0.00% 81 404 0.00% 82 427 0.00% 83 454 0.00% 84 479 0.00% 85 518 0.00% 86 552 0.00% 87 590 0.00% 88 649 0.00% 89 678 0.00% 90 754 0.00% 91 853 0.00% 92 905 0.00% 93 1034 0.00% 94 1163 0.01% 95 1161 0.01% 96 1224 0.01% 97 1319 0.01% 98 1391 0.01% 99 1529 0.01% 100 1631 0.01% 101 1710 0.01% 102 1963 0.01% 103 2109 0.01% 104 2362 0.01% 105 2395 0.01% 106 2583 0.01% 107 2722 0.01% 108 2942 0.01% 109 3041 0.01% 110 3269 0.01% 111 3458 0.02% 112 3602 0.02% 113 4055 0.02% 114 4247 0.02% 115 4525 0.02% 116 4569 0.02% 117 4981 0.02% 118 5204 0.02% 119 5458 0.02% 120 5653 0.03% 121 6158 0.03% 122 6530 0.03% 123 6962 0.03% 124 7335 0.03% 125 7679 0.03% 126 8137 0.04% 127 8466 0.04% 128 8851 0.04% 129 9062 0.04% 130 9395 0.04% 131 10098 0.05% 132 10454 0.05% 133 11355 0.05% 134 11654 0.05% 135 12267 0.06% 136 13034 0.06% 137 13439 0.06% 138 14191 0.06% 139 14673 0.07% 140 15151 0.07% 141 15836 0.07% 142 16782 0.08% 143 17650 0.08% 144 19127 0.09% 145 21813 0.10% 146 28084 0.13% 147 50809 0.23% 148 159235 0.72% 149 1212036 5.50% 150 20178146 91.64% 22020005 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=2.3 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=335.24 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=29.6 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.3 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=364.19 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=31.1 sequence=AAGAAGAAGAAA SRR5986236 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:12:12 Started mapping on | Feb 14 03:12:12 Finished on | Feb 14 03:18:13 Mapping speed, Million of reads per hour | 219.59 Number of input reads | 22020005 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18493133 Uniquely mapped reads % | 83.98% Average mapped length | 288.51 Number of splices: Total | 16888601 Number of splices: Annotated (sjdb) | 16377835 Number of splices: GT/AG | 16487668 Number of splices: GC/AG | 238656 Number of splices: AT/AC | 15930 Number of splices: Non-canonical | 146347 Mismatch rate per base, % | 2.13% Deletion rate per base | 0.13% Deletion average length | 3.22 Insertion rate per base | 0.09% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1011425 % of reads mapped to multiple loci | 4.59% Number of reads mapped to too many loci | 22171 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.13% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2515447 2515447 2515447 N_multimapping 1011425 1011425 1011425 N_noFeature 591078 9476460 9441656 N_ambiguous 346203 90016 91136 UnstrandedReadsAssigned:17555852 PositiveStrandReadsAssigned:8926657 NegativeStrandReadsAssigned:8960341 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986236-trimmed-pair1.fastq SRR5986236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,020,005 reads, 17,785,955 reads pseudoaligned [quant] estimated average fragment length: 236.281 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR5986236.ke.tsv 34699 SRR5986236.se.tsv 87100 total ==> SRR5986236.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.72 1113 27.0451 Potri.005G024800.1.v4.1 1035 799.719 675 36.5631 Potri.004G059700.1.v4.1 961 725.729 20 1.1938 Potri.007G009000.2.v4.1 1416 1180.72 2 0.073377 Potri.003G141000.2.v4.1 2943 2707.72 235 3.75959 Potri.016G087400.1.v4.1 270 55.7749 629 488.526 Potri.015G069301.1.v4.1 564 328.887 0 0 Potri.010G195200.1.v4.1 1773 1537.72 11 0.309879 Potri.012G127500.1.v4.1 977 741.719 3242 189.343 ==> SRR5986236.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR5986236 completed mapping pipeline successfully