Starting /dee2/code/volunteer_pipeline.sh SRR5986237 current disk space = 3088059633664 free memory = 1490993860 SRR5986237 SRAfilesize 154621bedd08ec67db29fcab0db37164 SRR5986237.sra SRR5986237.sra file validated SRR5986237 is paired end SRR5986237 is conventional basespace SRR5986237 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.27625 32.0 12.0 32.0 2.0 32.0 2 31.35 32.0 32.0 32.0 32.0 32.0 3 33.1275 32.0 32.0 37.0 32.0 37.0 4 35.1875 37.0 37.0 37.0 32.0 37.0 5 35.87125 37.0 37.0 37.0 32.0 37.0 6 39.258 41.0 37.0 41.0 37.0 41.0 7 39.06475 41.0 37.0 41.0 37.0 41.0 8 39.49625 41.0 41.0 41.0 37.0 41.0 9 39.693 41.0 41.0 41.0 37.0 41.0 10-14 39.36215 41.0 41.0 41.0 37.0 41.0 15-19 39.33725 41.0 41.0 41.0 36.0 41.0 20-24 39.502250000000004 41.0 41.0 41.0 37.0 41.0 25-29 38.7984 41.0 39.4 41.0 35.0 41.0 30-34 38.85455 41.0 39.4 41.0 35.0 41.0 35-39 38.4035 41.0 38.6 41.0 32.0 41.0 40-44 38.3231 41.0 38.6 41.0 33.0 41.0 45-49 37.5098 41.0 37.0 41.0 29.0 41.0 50-54 36.56535 41.0 37.0 41.0 25.0 41.0 55-59 36.8429 41.0 37.0 41.0 26.0 41.0 60-64 37.15650000000001 41.0 36.0 41.0 28.0 41.0 65-69 35.88484999999999 40.2 35.0 41.0 23.0 41.0 70-74 37.7053 41.0 37.0 41.0 31.0 41.0 75-79 37.3631 41.0 37.0 41.0 28.0 41.0 80-84 34.7254 39.4 33.0 41.0 18.0 41.0 85-89 35.67555 41.0 34.0 41.0 22.0 41.0 90-94 36.70785 41.0 37.0 41.0 26.0 41.0 95-99 35.35935 39.4 33.0 41.0 21.0 41.0 100-104 31.750050000000005 36.0 25.0 41.0 14.0 41.0 105-109 33.745549999999994 38.6 30.0 41.0 16.0 41.0 110-114 34.0604 37.8 30.0 41.0 18.0 41.0 115-119 35.485299999999995 39.4 34.0 41.0 23.0 41.0 120-124 32.19725 36.8 26.0 41.0 15.0 41.0 125-129 31.85525 36.0 25.0 40.2 12.0 41.0 130-134 31.10465 35.0 23.0 40.2 12.0 41.0 135-139 32.721000000000004 37.0 27.0 41.0 12.0 41.0 140-144 28.296249999999997 31.0 20.0 37.6 12.0 41.0 145-149 31.34495 36.0 26.0 41.0 12.0 41.0 150 31.88175 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 10.0 22 13.0 23 32.0 24 35.0 25 45.0 26 76.0 27 89.0 28 100.0 29 112.0 30 150.0 31 154.0 32 187.0 33 226.0 34 265.0 35 262.0 36 357.0 37 371.0 38 446.0 39 594.0 40 474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.554915145693244 18.603906500160104 19.30835734870317 32.53282100544349 2 24.375 26.55 34.0 15.075 3 20.925 32.074999999999996 26.575 20.424999999999997 4 23.875 34.300000000000004 21.375 20.45 5 22.675 38.675 21.575 17.075000000000003 6 16.225 39.625 22.775000000000002 21.375 7 15.15 16.175 46.2 22.475 8 19.575 22.75 28.449999999999996 29.225 9 20.275000000000002 23.549999999999997 29.525000000000002 26.650000000000002 10-14 20.849999999999998 29.854999999999997 27.185 22.11 15-19 21.055 28.360000000000003 28.435 22.15 20-24 21.07 29.235 27.48 22.215 25-29 21.4 29.24 27.389999999999997 21.97 30-34 21.060000000000002 29.15 27.689999999999998 22.1 35-39 21.735 28.99 27.189999999999998 22.085 40-44 21.08 29.520000000000003 26.935 22.465 45-49 21.085 28.98 27.98 21.955 50-54 21.875 28.99 27.339999999999996 21.795 55-59 22.085 28.285 27.555000000000003 22.075 60-64 21.65 28.665000000000003 27.35 22.335 65-69 21.48 28.694999999999997 27.900000000000002 21.925 70-74 22.220000000000002 28.060000000000002 27.439999999999998 22.28 75-79 21.625 28.07 28.095 22.21 80-84 22.145 28.449999999999996 27.37 22.035 85-89 21.8 28.305000000000003 27.900000000000002 21.995 90-94 21.66 28.265 27.85 22.225 95-99 22.08 28.9 27.905 21.115000000000002 100-104 22.355 28.705000000000002 27.925 21.015 105-109 22.67 28.389999999999997 27.565 21.375 110-114 21.875 28.349999999999998 28.349999999999998 21.425 115-119 21.94 28.1 28.139999999999997 21.82 120-124 21.455 28.21 29.375 20.96 125-129 21.83 28.4 28.465 21.305 130-134 21.94 28.189999999999998 28.915000000000003 20.955 135-139 21.855 27.365000000000002 28.310000000000002 22.470000000000002 140-144 22.46 28.925 28.975 19.64 145-149 22.33 28.615000000000002 27.85 21.205 150 21.9 28.549999999999997 28.499999999999996 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.5 24 3.5 25 4.5 26 9.0 27 11.0 28 18.0 29 23.0 30 27.0 31 43.0 32 52.0 33 53.0 34 67.0 35 92.5 36 114.0 37 126.5 38 155.0 39 174.5 40 189.0 41 210.5 42 223.5 43 241.0 44 261.0 45 256.5 46 235.0 47 219.5 48 199.5 49 173.0 50 148.0 51 140.0 52 112.5 53 85.0 54 78.5 55 60.5 56 43.5 57 33.5 58 26.0 59 23.0 60 17.5 61 10.5 62 6.5 63 5.5 64 3.0 65 2.5 66 3.0 67 2.0 68 1.5 69 1.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.82576557550159 89.8 2 4.778247096092925 9.049999999999999 3 0.36958817317845827 1.05 4 0.026399155227032733 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5875 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.075 0.0 0.0 0.0 0.0 138 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCTA 10 0.0070045046 143.7875 4 GGTCTAG 10 0.0070045046 143.7875 5 GTCTAGC 10 0.0070045046 143.7875 6 >>END_MODULE SRR5986237 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.305 32.0 12.0 32.0 2.0 32.0 2 30.785 32.0 32.0 32.0 32.0 32.0 3 31.56625 32.0 32.0 37.0 27.0 37.0 4 34.3725 37.0 32.0 37.0 32.0 37.0 5 35.44 37.0 37.0 37.0 32.0 37.0 6 38.4525 41.0 37.0 41.0 32.0 41.0 7 33.1155 37.0 27.0 41.0 12.0 41.0 8 37.3 41.0 37.0 41.0 32.0 41.0 9 35.089 41.0 32.0 41.0 12.0 41.0 10-14 36.5741 41.0 36.0 41.0 24.0 41.0 15-19 34.2493 38.4 30.0 41.0 20.0 41.0 20-24 35.210899999999995 39.4 32.0 41.0 21.0 41.0 25-29 35.0303 40.2 33.0 41.0 20.0 41.0 30-34 30.116300000000003 33.0 21.0 40.2 12.0 41.0 35-39 33.982299999999995 39.2 30.0 41.0 18.0 41.0 40-44 29.3425 30.8 22.0 37.6 14.0 40.2 45-49 30.75745 34.0 21.0 40.2 12.0 41.0 50-54 32.04015 36.8 25.0 41.0 16.0 41.0 55-59 29.78805 32.0 17.0 39.4 14.0 41.0 60-64 29.15455 32.0 19.0 40.2 14.0 41.0 65-69 27.033500000000004 27.0 18.0 37.4 12.0 40.2 70-74 27.595499999999998 27.0 18.0 37.6 12.0 40.2 75-79 30.54815 34.0 21.0 41.0 12.0 41.0 80-84 28.033949999999997 32.0 16.0 39.2 12.0 41.0 85-89 29.38485 33.0 20.0 40.2 12.0 41.0 90-94 24.8714 25.0 14.0 35.0 12.0 40.2 95-99 24.46395 24.0 12.0 36.0 12.0 40.2 100-104 23.831899999999997 21.0 12.0 35.0 12.0 40.2 105-109 24.69335 25.0 12.0 35.0 12.0 39.4 110-114 25.703250000000004 27.0 14.0 35.0 12.0 41.0 115-119 24.382050000000003 24.0 12.0 35.0 12.0 41.0 120-124 23.081850000000003 22.0 12.0 33.0 12.0 40.2 125-129 22.209899999999998 20.0 12.0 30.0 12.0 37.8 130-134 21.5666 17.0 12.0 31.0 12.0 38.6 135-139 21.156599999999997 18.0 12.0 29.0 12.0 37.8 140-144 21.4271 20.0 12.0 29.0 12.0 37.0 145-149 19.18945 16.0 12.0 25.0 11.2 35.0 150 18.98975 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 18.0 16 55.0 17 106.0 18 129.0 19 187.0 20 172.0 21 174.0 22 175.0 23 172.0 24 197.0 25 183.0 26 170.0 27 219.0 28 199.0 29 215.0 30 192.0 31 212.0 32 227.0 33 202.0 34 190.0 35 174.0 36 190.0 37 138.0 38 79.0 39 22.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.22872165626027 19.421623397962538 20.768977982254356 31.58067696352284 2 24.675 26.3 34.150000000000006 14.875 3 21.725 31.3 26.3 20.674999999999997 4 22.575 36.975 20.3 20.150000000000002 5 23.425 37.724999999999994 20.974999999999998 17.875 6 16.175 39.825 23.7 20.3 7 16.75 16.525000000000002 44.324999999999996 22.400000000000002 8 18.275 23.275000000000002 27.875 30.575000000000003 9 21.55 23.65 28.7 26.1 10-14 20.925 29.659999999999997 27.315 22.1 15-19 21.475 28.299999999999997 28.28 21.945 20-24 22.075 29.115000000000002 28.015 20.794999999999998 25-29 21.93 29.720000000000002 27.99 20.36 30-34 22.395 29.110000000000003 28.694999999999997 19.8 35-39 21.715 28.775000000000002 28.854999999999997 20.655 40-44 22.7 31.369999999999997 28.384999999999998 17.544999999999998 45-49 22.425 29.275000000000002 29.065 19.235 50-54 22.5 28.349999999999998 29.085 20.064999999999998 55-59 22.955000000000002 29.28 28.435 19.33 60-64 22.535 29.575000000000003 28.875 19.015 65-69 22.29 29.45 29.770000000000003 18.490000000000002 70-74 24.02 29.315 28.77 17.895 75-79 21.654999999999998 28.515 29.360000000000003 20.47 80-84 22.045 29.775000000000002 30.625000000000004 17.555 85-89 21.38 29.235 29.630000000000003 19.755 90-94 23.105 29.110000000000003 31.045 16.74 95-99 22.314999999999998 29.759999999999998 30.42 17.505000000000003 100-104 22.31 30.185000000000002 30.404999999999998 17.1 105-109 22.475 29.03 31.185000000000002 17.31 110-114 22.939999999999998 28.73 29.310000000000002 19.02 115-119 22.615 28.33 29.815 19.24 120-124 21.865000000000002 29.235 30.625000000000004 18.275 125-129 22.645 28.535 30.84 17.98 130-134 23.125 28.875 30.764999999999997 17.235 135-139 22.88 28.73 31.205 17.185 140-144 23.06 28.425 30.259999999999998 18.255 145-149 23.695 29.299999999999997 31.009999999999998 15.995000000000001 150 23.9 28.15 32.550000000000004 15.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 3.0 19 3.0 20 1.5 21 3.0 22 4.5 23 8.5 24 13.5 25 13.0 26 14.5 27 20.5 28 33.5 29 40.5 30 41.5 31 52.0 32 72.0 33 95.5 34 109.5 35 119.0 36 144.0 37 166.5 38 178.0 39 208.0 40 217.5 41 214.0 42 234.5 43 250.5 44 242.5 45 225.0 46 202.5 47 186.5 48 175.0 49 144.0 50 120.5 51 102.0 52 74.5 53 64.5 54 56.5 55 36.0 56 25.5 57 21.0 58 16.0 59 13.0 60 10.0 61 6.0 62 3.5 63 2.0 64 2.0 65 1.0 66 3.0 67 3.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01465386558868 97.975 2 0.9095502779181406 1.7999999999999998 3 0.07579585649317837 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.45 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6625000000000001 0.0 0.0 0.0 0.0 136-137 0.7875000000000001 0.0 0.0 0.0 0.0 138 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAACAT 10 0.0030775159 188.54099 1 CAAAGAT 10 0.0030775159 188.54099 1 >>END_MODULE Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240579 spots for SRR5986237.sra Written 1240579 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra Read 1240571 spots for SRR5986237.sra Written 1240571 spots for SRR5986237.sra SRR ids: ['SRR5986237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wh9ghlbe SRR5986237.sra spots: 24811428 blocks: [[1, 1240571], [1240572, 2481142], [2481143, 3721713], [3721714, 4962284], [4962285, 6202855], [6202856, 7443426], [7443427, 8683997], [8683998, 9924568], [9924569, 11165139], [11165140, 12405710], [12405711, 13646281], [13646282, 14886852], [14886853, 16127423], [16127424, 17367994], [17367995, 18608565], [18608566, 19849136], [19849137, 21089707], [21089708, 22330278], [22330279, 23570849], [23570850, 24811428]] SRR5986237 file size 8337618 SRR5986237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986237 SRR5986237_1.fastq SRR5986237_2.fastq Input file: SRR5986237_1.fastq Paired file: SRR5986237_2.fastq trimmed: SRR5986237-trimmed-pair1.fastq, SRR5986237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:47:59 2025 >> started Fri Feb 14 02:48:27 2025 >> done (27.335s) 24811428 read pairs processed; of these: 242 ( 0.00%) short read pairs filtered out after trimming by size control 361 ( 0.00%) empty read pairs filtered out after trimming by size control 24810825 (100.00%) read pairs available; of these: 2238291 ( 9.02%) trimmed read pairs available after processing 22572534 (90.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 39 0.00% 19 27 0.00% 20 32 0.00% 21 33 0.00% 22 50 0.00% 23 48 0.00% 24 77 0.00% 25 77 0.00% 26 57 0.00% 27 73 0.00% 28 71 0.00% 29 83 0.00% 30 91 0.00% 31 74 0.00% 32 84 0.00% 33 94 0.00% 34 86 0.00% 35 83 0.00% 36 92 0.00% 37 98 0.00% 38 95 0.00% 39 76 0.00% 40 112 0.00% 41 89 0.00% 42 75 0.00% 43 103 0.00% 44 94 0.00% 45 89 0.00% 46 105 0.00% 47 115 0.00% 48 120 0.00% 49 117 0.00% 50 123 0.00% 51 104 0.00% 52 107 0.00% 53 121 0.00% 54 131 0.00% 55 149 0.00% 56 127 0.00% 57 142 0.00% 58 147 0.00% 59 137 0.00% 60 139 0.00% 61 215 0.00% 62 193 0.00% 63 178 0.00% 64 167 0.00% 65 191 0.00% 66 208 0.00% 67 202 0.00% 68 230 0.00% 69 231 0.00% 70 242 0.00% 71 279 0.00% 72 295 0.00% 73 298 0.00% 74 290 0.00% 75 340 0.00% 76 302 0.00% 77 384 0.00% 78 419 0.00% 79 437 0.00% 80 473 0.00% 81 552 0.00% 82 548 0.00% 83 651 0.00% 84 733 0.00% 85 739 0.00% 86 806 0.00% 87 807 0.00% 88 846 0.00% 89 984 0.00% 90 1112 0.00% 91 1134 0.00% 92 1310 0.01% 93 1431 0.01% 94 1547 0.01% 95 1755 0.01% 96 1791 0.01% 97 2000 0.01% 98 2054 0.01% 99 2191 0.01% 100 2272 0.01% 101 2591 0.01% 102 2757 0.01% 103 3177 0.01% 104 3406 0.01% 105 3505 0.01% 106 3942 0.02% 107 3787 0.02% 108 4015 0.02% 109 4339 0.02% 110 4555 0.02% 111 5038 0.02% 112 5250 0.02% 113 5728 0.02% 114 6133 0.02% 115 6510 0.03% 116 6844 0.03% 117 7063 0.03% 118 7296 0.03% 119 7592 0.03% 120 8045 0.03% 121 8634 0.03% 122 8982 0.04% 123 9857 0.04% 124 10521 0.04% 125 10923 0.04% 126 11395 0.05% 127 11924 0.05% 128 12557 0.05% 129 13061 0.05% 130 13482 0.05% 131 14042 0.06% 132 14758 0.06% 133 15805 0.06% 134 16783 0.07% 135 17365 0.07% 136 18450 0.07% 137 19157 0.08% 138 19631 0.08% 139 20352 0.08% 140 21207 0.09% 141 21931 0.09% 142 23347 0.09% 143 24823 0.10% 144 26368 0.11% 145 30111 0.12% 146 37489 0.15% 147 64520 0.26% 148 191255 0.77% 149 1393165 5.62% 150 22572534 90.98% 24810825 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=11 prefix-density=0.37 prefix-fanout=3.2 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=31.09 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.5 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=6 prefix-density=0.34 prefix-fanout=3.3 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=14.89 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.4 sequence=AAAGAAATCCCTTAAT SRR5986237 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:49:29 Started mapping on | Feb 14 02:49:29 Finished on | Feb 14 02:56:47 Mapping speed, Million of reads per hour | 203.92 Number of input reads | 24810825 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20497697 Uniquely mapped reads % | 82.62% Average mapped length | 287.80 Number of splices: Total | 18086475 Number of splices: Annotated (sjdb) | 17520873 Number of splices: GT/AG | 17655158 Number of splices: GC/AG | 237249 Number of splices: AT/AC | 22044 Number of splices: Non-canonical | 172024 Mismatch rate per base, % | 2.16% Deletion rate per base | 0.15% Deletion average length | 3.22 Insertion rate per base | 0.09% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1204719 % of reads mapped to multiple loci | 4.86% Number of reads mapped to too many loci | 59529 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.01% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3108409 3108409 3108409 N_multimapping 1204719 1204719 1204719 N_noFeature 623403 10482597 10483362 N_ambiguous 360218 102776 103330 UnstrandedReadsAssigned:19514076 PositiveStrandReadsAssigned:9912324 NegativeStrandReadsAssigned:9911005 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986237-trimmed-pair1.fastq SRR5986237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,810,825 reads, 20,064,657 reads pseudoaligned [quant] estimated average fragment length: 229.671 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR5986237.ke.tsv 34699 SRR5986237.se.tsv 87100 total ==> SRR5986237.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.33 1584 31.6186 Potri.005G024800.1.v4.1 1035 806.329 2690 119.157 Potri.004G059700.1.v4.1 961 732.329 12 0.585266 Potri.007G009000.2.v4.1 1416 1187.33 2 0.0601641 Potri.003G141000.2.v4.1 2943 2714.33 326.302 4.29374 Potri.016G087400.1.v4.1 270 58.651 937.783 571.091 Potri.015G069301.1.v4.1 564 335.4 0 0 Potri.010G195200.1.v4.1 1773 1544.33 169 3.90863 Potri.012G127500.1.v4.1 977 748.329 12821 611.938 ==> SRR5986237.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR5986237 completed mapping pipeline successfully