Starting /dee2/code/volunteer_pipeline.sh SRR5986238 current disk space = 3088089948160 free memory = 1582024396 SRR5986238 SRAfilesize b2def4ab99d5d23e0827b043e5e524f7 SRR5986238.sra SRR5986238.sra file validated SRR5986238 is paired end SRR5986238 is conventional basespace SRR5986238 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986238_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.5875 32.0 12.0 32.0 2.0 32.0 2 31.395 32.0 32.0 32.0 32.0 32.0 3 32.88625 32.0 32.0 37.0 27.0 37.0 4 35.095 37.0 37.0 37.0 32.0 37.0 5 35.8975 37.0 37.0 37.0 32.0 37.0 6 39.1575 41.0 37.0 41.0 37.0 41.0 7 38.937 41.0 37.0 41.0 32.0 41.0 8 39.46475 41.0 41.0 41.0 37.0 41.0 9 39.496 41.0 41.0 41.0 37.0 41.0 10-14 39.2257 41.0 41.0 41.0 36.0 41.0 15-19 39.266200000000005 41.0 40.2 41.0 36.0 41.0 20-24 39.381049999999995 41.0 41.0 41.0 37.0 41.0 25-29 38.61355 41.0 39.4 41.0 33.0 41.0 30-34 38.6595 41.0 39.4 41.0 34.0 41.0 35-39 38.25815 41.0 38.6 41.0 31.0 41.0 40-44 38.16125 41.0 37.8 41.0 31.0 41.0 45-49 37.26275 41.0 37.0 41.0 27.0 41.0 50-54 36.39845 41.0 37.0 41.0 23.0 41.0 55-59 36.666199999999996 41.0 36.0 41.0 26.0 41.0 60-64 36.832649999999994 41.0 36.0 41.0 24.0 41.0 65-69 35.74665 40.2 35.0 41.0 23.0 41.0 70-74 37.35915000000001 41.0 37.0 41.0 28.0 41.0 75-79 37.0463 41.0 37.0 41.0 28.0 41.0 80-84 34.3223 37.8 30.0 41.0 16.0 41.0 85-89 35.449799999999996 40.2 32.0 41.0 20.0 41.0 90-94 36.6042 41.0 37.0 41.0 25.0 41.0 95-99 35.1882 39.4 32.0 41.0 21.0 41.0 100-104 31.44615 34.0 25.0 41.0 14.0 41.0 105-109 33.45085 37.8 29.0 41.0 16.0 41.0 110-114 33.57675 37.8 29.0 41.0 18.0 41.0 115-119 35.09745 39.4 33.0 41.0 20.0 41.0 120-124 31.783549999999998 35.8 26.0 41.0 14.0 41.0 125-129 31.405949999999997 36.0 25.0 40.2 12.0 41.0 130-134 30.865000000000002 35.0 22.0 40.2 12.0 41.0 135-139 32.415049999999994 37.0 27.0 41.0 12.0 41.0 140-144 27.964149999999997 31.0 18.0 37.6 12.0 41.0 145-149 30.939950000000003 35.0 25.0 41.0 12.0 41.0 150 30.91025 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 5.0 21 10.0 22 15.0 23 24.0 24 35.0 25 59.0 26 80.0 27 97.0 28 113.0 29 143.0 30 152.0 31 180.0 32 195.0 33 198.0 34 239.0 35 299.0 36 346.0 37 384.0 38 417.0 39 567.0 40 439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.214059531348955 19.316022799240027 17.669411019632676 34.80050664977834 2 25.45 28.275 32.5 13.775 3 22.511255627813906 31.86593296648324 26.738369184592298 18.884442221110557 4 22.625 36.4 21.95 19.025 5 22.0 37.425000000000004 22.625 17.95 6 15.375 40.0 23.925 20.7 7 15.65 16.175 45.35 22.825 8 18.45 22.35 29.049999999999997 30.15 9 19.3 23.9 31.125000000000004 25.674999999999997 10-14 20.775 29.975 27.515 21.735 15-19 21.48 27.63 28.349999999999998 22.54 20-24 21.515 29.755 27.065 21.665 25-29 21.709999999999997 28.425 28.065 21.8 30-34 20.865000000000002 29.285 27.83 22.02 35-39 21.36 29.285 27.500000000000004 21.855 40-44 21.165 28.84 28.335 21.66 45-49 20.919999999999998 28.77 27.575 22.735 50-54 21.905 28.849999999999998 27.605 21.64 55-59 21.475 28.299999999999997 28.415000000000003 21.81 60-64 21.4 28.705000000000002 27.72 22.175 65-69 21.41 29.304999999999996 27.584999999999997 21.7 70-74 21.279999999999998 28.305000000000003 28.060000000000002 22.355 75-79 21.26 28.155 28.04 22.545 80-84 21.584999999999997 28.225 28.01 22.18 85-89 21.63 28.615000000000002 27.62 22.134999999999998 90-94 21.48 28.27 27.87 22.38 95-99 21.75 28.115000000000002 28.185 21.95 100-104 21.975 28.095 28.095 21.834999999999997 105-109 21.584999999999997 28.46 28.535 21.42 110-114 21.709999999999997 28.42 28.32 21.55 115-119 21.945 28.475 28.225 21.355 120-124 22.055 27.92 28.815 21.21 125-129 21.834999999999997 28.249999999999996 28.655 21.26 130-134 21.77 28.17 28.9 21.16 135-139 22.145 28.544999999999998 28.09 21.22 140-144 22.384999999999998 28.64 29.235 19.74 145-149 22.17 28.23 27.98 21.62 150 21.925 28.249999999999996 27.6 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 0.5 21 0.0 22 1.5 23 3.5 24 4.5 25 5.0 26 9.0 27 14.5 28 16.5 29 19.5 30 25.5 31 38.5 32 46.0 33 46.0 34 66.0 35 92.0 36 103.0 37 110.5 38 137.5 39 176.5 40 220.0 41 240.5 42 247.5 43 257.5 44 258.0 45 276.5 46 265.5 47 229.5 48 196.0 49 172.5 50 155.0 51 128.0 52 105.5 53 77.0 54 54.5 55 46.5 56 38.0 57 27.0 58 22.5 59 18.5 60 9.5 61 5.5 62 6.5 63 5.5 64 4.0 65 1.5 66 0.0 67 0.5 68 1.5 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.05 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6452123450277 89.7 2 5.196518069111052 9.85 3 0.1582695858612503 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.325 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986238 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986238_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.74625 32.0 12.0 32.0 2.0 32.0 2 30.62375 32.0 32.0 32.0 27.0 32.0 3 31.66 32.0 32.0 37.0 27.0 37.0 4 34.43 37.0 32.0 37.0 32.0 37.0 5 35.3725 37.0 37.0 37.0 32.0 37.0 6 38.66625 41.0 37.0 41.0 32.0 41.0 7 32.94475 37.0 27.0 41.0 12.0 41.0 8 37.42975 41.0 37.0 41.0 32.0 41.0 9 35.00675 41.0 32.0 41.0 12.0 41.0 10-14 36.4704 41.0 36.0 41.0 24.0 41.0 15-19 34.02545 37.6 28.0 41.0 20.0 41.0 20-24 35.1558 39.4 32.0 41.0 21.0 41.0 25-29 34.863800000000005 39.4 33.0 41.0 20.0 41.0 30-34 29.873649999999998 33.0 20.0 40.2 12.0 41.0 35-39 33.8417 38.4 30.0 41.0 18.0 41.0 40-44 29.207100000000004 32.8 22.0 37.6 15.0 40.2 45-49 30.703749999999996 34.0 21.0 40.2 12.0 41.0 50-54 31.867399999999996 36.8 26.0 41.0 16.0 41.0 55-59 29.5642 32.0 17.0 39.4 14.0 41.0 60-64 28.8791 32.0 19.0 39.4 14.0 41.0 65-69 26.723599999999998 27.0 16.0 38.4 12.0 40.2 70-74 27.47475 27.0 18.0 37.6 12.0 40.2 75-79 30.356450000000002 35.0 21.0 41.0 12.0 41.0 80-84 27.95885 31.0 16.0 39.2 12.0 41.0 85-89 29.3488 33.0 20.0 40.2 12.0 41.0 90-94 24.62395 24.0 14.0 35.0 12.0 40.2 95-99 24.269399999999997 24.0 14.0 35.0 12.0 39.4 100-104 23.51245 20.0 12.0 35.0 12.0 39.4 105-109 24.5049 24.0 12.0 35.0 12.0 39.4 110-114 25.545099999999998 27.0 14.0 35.0 12.0 41.0 115-119 24.1721 23.0 12.0 35.0 12.0 41.0 120-124 22.963749999999997 22.0 12.0 33.0 12.0 40.2 125-129 21.874299999999998 20.0 12.0 30.0 12.0 37.0 130-134 21.4472 17.0 12.0 31.0 12.0 38.6 135-139 20.978550000000002 18.0 12.0 29.0 12.0 37.0 140-144 21.3022 20.0 12.0 30.0 12.0 37.0 145-149 19.0255 16.0 12.0 25.0 11.2 33.0 150 18.788 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 11.0 16 60.0 17 118.0 18 147.0 19 148.0 20 182.0 21 184.0 22 186.0 23 198.0 24 197.0 25 180.0 26 186.0 27 207.0 28 198.0 29 213.0 30 216.0 31 202.0 32 197.0 33 195.0 34 201.0 35 178.0 36 170.0 37 136.0 38 59.0 39 26.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.1403738930797 19.64578550344375 20.137750081994096 32.076090521482456 2 23.825 27.825 33.4 14.95 3 22.325 31.4 25.95 20.325 4 22.400000000000002 36.25 20.275000000000002 21.075 5 22.25 39.25 22.975 15.525 6 17.275 37.9 23.974999999999998 20.849999999999998 7 17.075000000000003 18.2 43.225 21.5 8 19.275000000000002 22.8 29.15 28.775000000000002 9 21.025 24.25 30.225 24.5 10-14 21.165 29.709999999999997 27.365000000000002 21.759999999999998 15-19 22.005 27.725 28.560000000000002 21.709999999999997 20-24 21.5 29.12 28.389999999999997 20.990000000000002 25-29 21.805 29.080000000000002 27.96 21.154999999999998 30-34 22.825 29.244999999999997 28.275 19.655 35-39 22.225 28.970000000000002 28.025 20.78 40-44 23.11 30.305 28.935 17.65 45-49 23.34 29.32 28.175 19.165 50-54 22.06 29.304999999999996 28.615000000000002 20.02 55-59 22.575 28.88 29.654999999999998 18.89 60-64 23.265 28.660000000000004 28.999999999999996 19.075 65-69 23.365 29.005 29.925 17.705000000000002 70-74 23.605 29.630000000000003 29.459999999999997 17.305 75-79 22.869999999999997 28.67 28.615000000000002 19.845 80-84 22.31 29.720000000000002 30.764999999999997 17.205000000000002 85-89 22.384999999999998 29.044999999999998 28.955 19.615 90-94 22.82 29.470000000000002 31.345 16.365 95-99 23.189999999999998 29.95 29.81 17.05 100-104 22.745 29.965000000000003 29.89 17.4 105-109 22.63 28.765 31.525 17.080000000000002 110-114 23.064999999999998 28.685 29.465000000000003 18.785 115-119 23.44 29.075 29.12 18.365000000000002 120-124 23.415 28.22 30.19 18.175 125-129 23.494999999999997 28.470000000000002 30.395 17.64 130-134 23.645 28.849999999999998 30.835 16.669999999999998 135-139 23.35 28.17 31.455 17.025000000000002 140-144 23.65 28.58 29.935000000000002 17.835 145-149 24.490000000000002 28.315 31.1 16.095000000000002 150 24.2 27.900000000000002 33.25 14.649999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 3.0 22 3.5 23 3.0 24 6.0 25 10.0 26 15.5 27 19.0 28 25.0 29 36.0 30 45.5 31 53.5 32 68.5 33 88.5 34 108.5 35 123.0 36 131.5 37 163.0 38 202.5 39 213.0 40 218.5 41 241.0 42 240.0 43 237.0 44 237.5 45 221.0 46 210.5 47 194.0 48 174.0 49 151.5 50 135.5 51 110.5 52 72.5 53 52.5 54 43.0 55 35.5 56 28.0 57 21.0 58 15.0 59 10.0 60 7.0 61 5.0 62 4.5 63 2.0 64 0.5 65 2.0 66 2.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98989898989899 98.0 2 1.0101010101010102 2.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8375 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 0.9874999999999999 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAAGT 10 0.0030775159 188.54099 1 TCGATTT 10 0.0070081474 143.7625 2 >>END_MODULE Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194994 spots for SRR5986238.sra Written 1194994 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra Read 1194976 spots for SRR5986238.sra Written 1194976 spots for SRR5986238.sra SRR ids: ['SRR5986238.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_146o6uy2 SRR5986238.sra spots: 23899538 blocks: [[1, 1194976], [1194977, 2389952], [2389953, 3584928], [3584929, 4779904], [4779905, 5974880], [5974881, 7169856], [7169857, 8364832], [8364833, 9559808], [9559809, 10754784], [10754785, 11949760], [11949761, 13144736], [13144737, 14339712], [14339713, 15534688], [15534689, 16729664], [16729665, 17924640], [17924641, 19119616], [19119617, 20314592], [20314593, 21509568], [21509569, 22704544], [22704545, 23899538]] SRR5986238 file size 8030390 SRR5986238 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986238 SRR5986238_1.fastq SRR5986238_2.fastq Input file: SRR5986238_1.fastq Paired file: SRR5986238_2.fastq trimmed: SRR5986238-trimmed-pair1.fastq, SRR5986238-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:11:09 2025 >> started Fri Feb 14 03:11:38 2025 >> done (29.225s) 23899538 read pairs processed; of these: 224 ( 0.00%) short read pairs filtered out after trimming by size control 505 ( 0.00%) empty read pairs filtered out after trimming by size control 23898809 (100.00%) read pairs available; of these: 2279861 ( 9.54%) trimmed read pairs available after processing 21618948 (90.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 33 0.00% 19 20 0.00% 20 33 0.00% 21 11 0.00% 22 37 0.00% 23 36 0.00% 24 55 0.00% 25 59 0.00% 26 58 0.00% 27 54 0.00% 28 63 0.00% 29 86 0.00% 30 63 0.00% 31 79 0.00% 32 71 0.00% 33 69 0.00% 34 84 0.00% 35 83 0.00% 36 70 0.00% 37 60 0.00% 38 59 0.00% 39 89 0.00% 40 97 0.00% 41 81 0.00% 42 77 0.00% 43 85 0.00% 44 99 0.00% 45 64 0.00% 46 96 0.00% 47 80 0.00% 48 109 0.00% 49 96 0.00% 50 98 0.00% 51 117 0.00% 52 103 0.00% 53 127 0.00% 54 100 0.00% 55 105 0.00% 56 120 0.00% 57 153 0.00% 58 134 0.00% 59 156 0.00% 60 150 0.00% 61 174 0.00% 62 189 0.00% 63 188 0.00% 64 174 0.00% 65 194 0.00% 66 188 0.00% 67 194 0.00% 68 226 0.00% 69 247 0.00% 70 255 0.00% 71 296 0.00% 72 333 0.00% 73 299 0.00% 74 334 0.00% 75 378 0.00% 76 422 0.00% 77 420 0.00% 78 516 0.00% 79 528 0.00% 80 558 0.00% 81 684 0.00% 82 706 0.00% 83 769 0.00% 84 881 0.00% 85 887 0.00% 86 1024 0.00% 87 1103 0.00% 88 1172 0.00% 89 1296 0.01% 90 1485 0.01% 91 1516 0.01% 92 1766 0.01% 93 1900 0.01% 94 2113 0.01% 95 2108 0.01% 96 2396 0.01% 97 2510 0.01% 98 2757 0.01% 99 2982 0.01% 100 3160 0.01% 101 3363 0.01% 102 3549 0.01% 103 3920 0.02% 104 4227 0.02% 105 4323 0.02% 106 4620 0.02% 107 4877 0.02% 108 5148 0.02% 109 5314 0.02% 110 5747 0.02% 111 6051 0.03% 112 6664 0.03% 113 6828 0.03% 114 7294 0.03% 115 7892 0.03% 116 8022 0.03% 117 8428 0.04% 118 8938 0.04% 119 9109 0.04% 120 9480 0.04% 121 10165 0.04% 122 10834 0.05% 123 11151 0.05% 124 11931 0.05% 125 12181 0.05% 126 12805 0.05% 127 13264 0.06% 128 14137 0.06% 129 14321 0.06% 130 14827 0.06% 131 15576 0.07% 132 16182 0.07% 133 16907 0.07% 134 17983 0.08% 135 18705 0.08% 136 19471 0.08% 137 20055 0.08% 138 20675 0.09% 139 21627 0.09% 140 21943 0.09% 141 23235 0.10% 142 24173 0.10% 143 25532 0.11% 144 26672 0.11% 145 29913 0.13% 146 37076 0.16% 147 63621 0.27% 148 190805 0.80% 149 1377453 5.76% 150 21618948 90.46% 23898809 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.40 fanout-score-rank=7 prefix-density=0.36 prefix-fanout=3.3 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=22.71 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.9 sequence=AAGGCCAAGATCCAGGACAAGGAAGG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.96 fanout-score-rank=7 prefix-density=0.32 prefix-fanout=3.2 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=15.42 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.0 sequence=AAGGCCAAGATCCAGGACAAGGAAGG SRR5986238 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:12:45 Started mapping on | Feb 14 03:12:45 Finished on | Feb 14 03:19:19 Mapping speed, Million of reads per hour | 218.36 Number of input reads | 23898809 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19877421 Uniquely mapped reads % | 83.17% Average mapped length | 287.76 Number of splices: Total | 18219922 Number of splices: Annotated (sjdb) | 17676415 Number of splices: GT/AG | 17801957 Number of splices: GC/AG | 239800 Number of splices: AT/AC | 19315 Number of splices: Non-canonical | 158850 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.14% Deletion average length | 3.25 Insertion rate per base | 0.09% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1119529 % of reads mapped to multiple loci | 4.68% Number of reads mapped to too many loci | 43204 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.72% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2901859 2901859 2901859 N_multimapping 1119529 1119529 1119529 N_noFeature 551422 10166643 10108969 N_ambiguous 346669 97117 97288 UnstrandedReadsAssigned:18979330 PositiveStrandReadsAssigned:9613661 NegativeStrandReadsAssigned:9671164 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986238 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986238-trimmed-pair1.fastq SRR5986238-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,898,809 reads, 19,333,962 reads pseudoaligned [quant] estimated average fragment length: 235.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR5986238.ke.tsv 34699 SRR5986238.se.tsv 87100 total ==> SRR5986238.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.79 983 22.359 Potri.005G024800.1.v4.1 1035 800.79 980 49.6535 Potri.004G059700.1.v4.1 961 726.796 12 0.669902 Potri.007G009000.2.v4.1 1416 1181.79 0 0 Potri.003G141000.2.v4.1 2943 2708.79 333.267 4.99183 Potri.016G087400.1.v4.1 270 58.572 878 608.201 Potri.015G069301.1.v4.1 564 329.928 0 0 Potri.010G195200.1.v4.1 1773 1538.79 235 6.19628 Potri.012G127500.1.v4.1 977 742.796 12053 658.367 ==> SRR5986238.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 78 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 36 SRR5986238 completed mapping pipeline successfully