Starting /dee2/code/volunteer_pipeline.sh SRR5986239 current disk space = 3088126578688 free memory = 1579854856 SRR5986239 SRAfilesize 93a75583549a2265f6aab26a44545836 SRR5986239.sra SRR5986239.sra file validated SRR5986239 is paired end SRR5986239 is conventional basespace SRR5986239 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.46875 32.0 27.0 32.0 2.0 32.0 2 31.4 32.0 32.0 32.0 32.0 32.0 3 33.09625 32.0 32.0 37.0 27.0 37.0 4 35.30875 37.0 37.0 37.0 32.0 37.0 5 35.84625 37.0 37.0 37.0 32.0 37.0 6 39.3625 41.0 41.0 41.0 37.0 41.0 7 39.122 41.0 37.0 41.0 37.0 41.0 8 39.50375 41.0 41.0 41.0 37.0 41.0 9 39.68875 41.0 41.0 41.0 37.0 41.0 10-14 39.4559 41.0 41.0 41.0 37.0 41.0 15-19 39.36905 41.0 41.0 41.0 36.0 41.0 20-24 39.487049999999996 41.0 41.0 41.0 37.0 41.0 25-29 38.903949999999995 41.0 40.2 41.0 35.0 41.0 30-34 38.939350000000005 41.0 40.2 41.0 35.0 41.0 35-39 38.462599999999995 41.0 38.6 41.0 32.0 41.0 40-44 38.35935 41.0 38.6 41.0 32.0 41.0 45-49 37.56570000000001 41.0 37.0 41.0 29.0 41.0 50-54 36.75555 41.0 37.0 41.0 25.0 41.0 55-59 37.05475 41.0 37.0 41.0 26.0 41.0 60-64 37.146300000000004 41.0 36.0 41.0 26.0 41.0 65-69 36.167500000000004 40.2 35.0 41.0 23.0 41.0 70-74 37.77385 41.0 37.0 41.0 31.0 41.0 75-79 37.48775 41.0 37.0 41.0 28.0 41.0 80-84 34.855900000000005 39.4 33.0 41.0 18.0 41.0 85-89 35.95735 41.0 35.0 41.0 22.0 41.0 90-94 36.85305 41.0 37.0 41.0 26.0 41.0 95-99 35.56765 40.2 33.0 41.0 21.0 41.0 100-104 31.87975 36.8 25.0 41.0 14.0 41.0 105-109 33.91555 38.6 30.0 41.0 16.0 41.0 110-114 34.09325 38.6 30.0 41.0 18.0 41.0 115-119 35.5861 40.2 34.0 41.0 23.0 41.0 120-124 32.41865 37.8 26.0 41.0 15.0 41.0 125-129 31.99705 36.0 26.0 41.0 12.0 41.0 130-134 31.466700000000003 36.0 25.0 40.2 12.0 41.0 135-139 32.9867 37.0 29.0 41.0 12.0 41.0 140-144 28.45335 31.0 21.0 37.6 12.0 41.0 145-149 31.537899999999997 36.0 26.0 41.0 12.0 41.0 150 31.8115 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 8.0 22 16.0 23 27.0 24 34.0 25 47.0 26 53.0 27 98.0 28 104.0 29 110.0 30 139.0 31 152.0 32 186.0 33 206.0 34 246.0 35 264.0 36 325.0 37 387.0 38 433.0 39 597.0 40 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.896341463414636 20.823170731707314 18.20121951219512 33.079268292682926 2 25.3 26.85 33.4 14.45 3 21.391043282461847 31.273455091318485 27.420565424068048 19.914936202151615 4 20.474999999999998 37.45 20.474999999999998 21.6 5 22.975 38.75 21.825 16.45 6 16.775000000000002 39.525 24.425 19.275000000000002 7 15.075 15.425 45.425 24.075 8 19.875 21.875 28.975 29.275000000000002 9 20.075000000000003 22.7 29.25 27.975 10-14 20.630000000000003 29.630000000000003 27.83 21.91 15-19 21.38 27.845 28.194999999999997 22.58 20-24 21.285 29.404999999999998 27.51 21.8 25-29 21.83 29.7 27.315 21.154999999999998 30-34 21.13 29.225 27.765 21.88 35-39 21.52 29.525000000000002 27.04 21.915000000000003 40-44 21.485000000000003 28.49 28.16 21.865000000000002 45-49 21.26 28.449999999999996 27.884999999999998 22.405 50-54 21.165 28.765 27.794999999999998 22.275 55-59 22.28 28.425 28.03 21.265 60-64 21.560000000000002 28.560000000000002 28.02 21.86 65-69 22.42 28.09 27.644999999999996 21.845 70-74 21.855 27.975 28.060000000000002 22.11 75-79 21.805 28.470000000000002 27.810000000000002 21.915000000000003 80-84 21.395 28.249999999999996 28.26 22.095000000000002 85-89 22.175 28.26 27.725 21.84 90-94 22.12 28.025 27.905 21.95 95-99 21.86 28.244999999999997 28.455000000000002 21.44 100-104 22.295 28.275 28.035 21.395 105-109 21.9 27.555000000000003 28.58 21.965 110-114 21.385 28.585 27.935 22.095000000000002 115-119 21.8 28.494999999999997 28.09 21.615000000000002 120-124 22.145 27.87 28.715000000000003 21.27 125-129 21.8 28.084999999999997 28.744999999999997 21.37 130-134 22.689999999999998 28.115000000000002 28.299999999999997 20.895 135-139 21.805 28.7 27.72 21.775 140-144 22.17 29.189999999999998 28.71 19.93 145-149 21.745 28.605000000000004 27.77 21.88 150 21.8 28.775000000000002 27.425 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 4.0 22 4.0 23 2.0 24 4.0 25 7.0 26 9.5 27 9.0 28 13.0 29 16.0 30 22.0 31 36.0 32 48.0 33 56.5 34 64.0 35 82.5 36 102.0 37 121.0 38 159.5 39 186.0 40 207.5 41 242.5 42 250.0 43 253.0 44 255.5 45 245.0 46 237.5 47 227.0 48 199.5 49 174.5 50 151.5 51 122.0 52 109.0 53 90.5 54 65.0 55 48.5 56 35.0 57 28.5 58 27.5 59 20.0 60 12.0 61 11.5 62 8.5 63 4.5 64 5.5 65 5.5 66 2.5 67 0.5 68 1.0 69 1.5 70 3.0 71 2.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05204460966543 88.55 2 5.682421667551779 10.7 3 0.2655337227827934 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAATCG 10 0.00390532 174.33333 1 ACACCTG 10 0.0069990456 143.82501 6 GACACCT 10 0.0069990456 143.82501 5 ACCTGAG 10 0.0069990456 143.82501 8 CACCTGA 10 0.0069990456 143.82501 7 >>END_MODULE SRR5986239 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.79125 32.0 12.0 32.0 2.0 32.0 2 30.77625 32.0 32.0 32.0 32.0 32.0 3 31.90875 32.0 32.0 37.0 27.0 37.0 4 34.6575 37.0 32.0 37.0 32.0 37.0 5 35.67 37.0 37.0 37.0 32.0 37.0 6 38.9985 41.0 37.0 41.0 37.0 41.0 7 33.1995 37.0 27.0 41.0 12.0 41.0 8 37.8485 41.0 37.0 41.0 32.0 41.0 9 35.30425 41.0 32.0 41.0 22.0 41.0 10-14 36.762100000000004 41.0 36.0 41.0 25.0 41.0 15-19 34.313900000000004 38.4 29.0 41.0 20.0 41.0 20-24 35.44735 39.4 32.0 41.0 22.0 41.0 25-29 35.31545 39.4 33.0 41.0 21.0 41.0 30-34 30.34565 34.0 22.0 40.2 14.0 41.0 35-39 34.28829999999999 39.2 31.0 41.0 20.0 41.0 40-44 29.630000000000003 32.8 23.0 37.6 15.0 40.2 45-49 31.197250000000004 34.8 24.0 40.2 12.0 41.0 50-54 32.3752 36.8 26.0 41.0 16.0 41.0 55-59 30.2327 33.0 19.0 41.0 14.0 41.0 60-64 29.670499999999997 33.0 19.0 40.2 14.0 41.0 65-69 27.386699999999998 27.0 18.0 38.4 12.0 40.2 70-74 28.07285 30.0 18.0 37.6 12.0 41.0 75-79 31.096049999999998 35.0 22.0 41.0 12.0 41.0 80-84 28.58745 32.0 18.0 39.2 12.0 41.0 85-89 29.964099999999995 34.0 20.0 40.2 12.0 41.0 90-94 25.2116 25.0 14.0 35.0 12.0 40.2 95-99 24.840750000000003 24.0 14.0 36.0 12.0 41.0 100-104 24.101950000000002 23.0 12.0 36.0 12.0 40.2 105-109 25.016699999999997 26.0 14.0 35.0 12.0 39.4 110-114 26.094450000000002 28.0 16.0 35.0 12.0 41.0 115-119 24.949949999999998 25.0 12.0 36.0 12.0 41.0 120-124 23.53765 22.0 12.0 33.0 12.0 40.2 125-129 22.47165 21.0 12.0 31.0 12.0 37.8 130-134 22.09695 20.0 12.0 31.0 12.0 38.6 135-139 21.5145 20.0 12.0 29.0 12.0 37.0 140-144 21.8375 20.0 12.0 31.0 12.0 37.0 145-149 19.293650000000003 16.0 12.0 25.0 12.0 35.0 150 18.956 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 13.0 16 49.0 17 76.0 18 135.0 19 132.0 20 194.0 21 162.0 22 190.0 23 178.0 24 180.0 25 174.0 26 188.0 27 187.0 28 190.0 29 169.0 30 249.0 31 240.0 32 222.0 33 205.0 34 203.0 35 203.0 36 202.0 37 145.0 38 92.0 39 19.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.789769182782283 20.118527760449158 18.90205864004991 32.18964441671866 2 23.7 27.250000000000004 34.8 14.249999999999998 3 20.875 31.175000000000004 27.250000000000004 20.7 4 22.675 36.85 20.974999999999998 19.5 5 21.45 37.475 22.525000000000002 18.55 6 17.125 38.675 23.875 20.325 7 16.75 17.299999999999997 42.8 23.150000000000002 8 19.425 21.975 27.900000000000002 30.7 9 20.5 22.650000000000002 30.425 26.424999999999997 10-14 20.985 29.93 27.27 21.815 15-19 21.75 27.455000000000002 28.9 21.895 20-24 21.495 29.005 28.325 21.175 25-29 21.759999999999998 29.134999999999998 28.345 20.76 30-34 22.365 29.275000000000002 28.48 19.88 35-39 21.615000000000002 29.18 27.93 21.275 40-44 22.415 30.135 29.25 18.2 45-49 22.439999999999998 29.38 28.13 20.05 50-54 22.185 28.785 28.46 20.57 55-59 22.695 30.005 28.38 18.92 60-64 23.14 28.925 28.910000000000004 19.025 65-69 23.255 29.705 29.099999999999998 17.94 70-74 23.69 28.565 29.134999999999998 18.61 75-79 21.825 28.525 29.215000000000003 20.435 80-84 22.015 29.64 30.320000000000004 18.025 85-89 21.895 28.23 29.975 19.900000000000002 90-94 22.97 28.955 31.22 16.855 95-99 23.285 29.23 29.68 17.805 100-104 23.3 29.565 29.87 17.265 105-109 22.7 29.154999999999998 30.320000000000004 17.825 110-114 22.93 28.63 29.69 18.75 115-119 23.630000000000003 28.535 29.255 18.58 120-124 22.685 28.810000000000002 30.455 18.05 125-129 23.330000000000002 28.315 30.464999999999996 17.89 130-134 23.365 28.505000000000003 30.535 17.595 135-139 23.21 28.595 31.15 17.044999999999998 140-144 22.689999999999998 28.384999999999998 30.53 18.395 145-149 23.98 27.98 31.59 16.45 150 22.425 28.175 33.900000000000006 15.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 3.5 23 7.0 24 8.0 25 8.5 26 13.5 27 23.0 28 29.0 29 35.5 30 41.5 31 54.0 32 63.5 33 76.0 34 101.0 35 116.5 36 137.0 37 164.0 38 196.5 39 212.0 40 207.5 41 221.0 42 232.5 43 255.5 44 258.0 45 228.0 46 220.5 47 194.0 48 153.5 49 134.5 50 121.5 51 106.0 52 92.0 53 73.0 54 57.0 55 40.0 56 26.0 57 22.5 58 14.0 59 8.5 60 10.0 61 7.5 62 3.5 63 5.0 64 4.0 65 1.0 66 1.0 67 1.0 68 1.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91331817033105 97.85000000000001 2 1.0866818296689411 2.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.5375 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.8625 0.0 0.0 0.0 0.0 138 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAA 10 0.007002685 143.8 9 GGTTAGA 10 0.007002685 143.8 7 GTTAGAA 10 0.007002685 143.8 8 AGGTTAG 10 0.007002685 143.8 6 >>END_MODULE Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076008 spots for SRR5986239.sra Written 1076008 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra Read 1076002 spots for SRR5986239.sra Written 1076002 spots for SRR5986239.sra SRR ids: ['SRR5986239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86quib5d SRR5986239.sra spots: 21520046 blocks: [[1, 1076002], [1076003, 2152004], [2152005, 3228006], [3228007, 4304008], [4304009, 5380010], [5380011, 6456012], [6456013, 7532014], [7532015, 8608016], [8608017, 9684018], [9684019, 10760020], [10760021, 11836022], [11836023, 12912024], [12912025, 13988026], [13988027, 15064028], [15064029, 16140030], [16140031, 17216032], [17216033, 18292034], [18292035, 19368036], [19368037, 20444038], [20444039, 21520046]] SRR5986239 file size 7228705 SRR5986239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986239 SRR5986239_1.fastq SRR5986239_2.fastq Input file: SRR5986239_1.fastq Paired file: SRR5986239_2.fastq trimmed: SRR5986239-trimmed-pair1.fastq, SRR5986239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:26:21 2025 >> started Fri Feb 14 03:26:45 2025 >> done (24.153s) 21520046 read pairs processed; of these: 250 ( 0.00%) short read pairs filtered out after trimming by size control 194 ( 0.00%) empty read pairs filtered out after trimming by size control 21519602 (100.00%) read pairs available; of these: 1938307 ( 9.01%) trimmed read pairs available after processing 19581295 (90.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 22 0.00% 20 27 0.00% 21 20 0.00% 22 35 0.00% 23 47 0.00% 24 45 0.00% 25 55 0.00% 26 42 0.00% 27 53 0.00% 28 64 0.00% 29 57 0.00% 30 74 0.00% 31 55 0.00% 32 50 0.00% 33 66 0.00% 34 60 0.00% 35 86 0.00% 36 75 0.00% 37 74 0.00% 38 63 0.00% 39 64 0.00% 40 73 0.00% 41 68 0.00% 42 69 0.00% 43 66 0.00% 44 71 0.00% 45 77 0.00% 46 61 0.00% 47 59 0.00% 48 65 0.00% 49 72 0.00% 50 80 0.00% 51 87 0.00% 52 81 0.00% 53 83 0.00% 54 104 0.00% 55 95 0.00% 56 91 0.00% 57 112 0.00% 58 89 0.00% 59 105 0.00% 60 111 0.00% 61 137 0.00% 62 121 0.00% 63 132 0.00% 64 133 0.00% 65 133 0.00% 66 163 0.00% 67 143 0.00% 68 152 0.00% 69 147 0.00% 70 170 0.00% 71 201 0.00% 72 174 0.00% 73 250 0.00% 74 244 0.00% 75 256 0.00% 76 240 0.00% 77 285 0.00% 78 345 0.00% 79 320 0.00% 80 391 0.00% 81 417 0.00% 82 514 0.00% 83 521 0.00% 84 588 0.00% 85 565 0.00% 86 624 0.00% 87 639 0.00% 88 769 0.00% 89 808 0.00% 90 878 0.00% 91 1020 0.00% 92 1121 0.01% 93 1279 0.01% 94 1359 0.01% 95 1412 0.01% 96 1585 0.01% 97 1693 0.01% 98 1734 0.01% 99 2053 0.01% 100 2185 0.01% 101 2366 0.01% 102 2571 0.01% 103 2696 0.01% 104 2974 0.01% 105 3106 0.01% 106 3430 0.02% 107 3628 0.02% 108 3791 0.02% 109 3906 0.02% 110 4288 0.02% 111 4646 0.02% 112 4936 0.02% 113 5438 0.03% 114 5762 0.03% 115 6028 0.03% 116 6277 0.03% 117 6543 0.03% 118 6983 0.03% 119 7288 0.03% 120 7809 0.04% 121 8178 0.04% 122 8760 0.04% 123 9018 0.04% 124 9748 0.05% 125 10510 0.05% 126 10706 0.05% 127 11100 0.05% 128 11652 0.05% 129 12241 0.06% 130 12653 0.06% 131 13491 0.06% 132 14195 0.07% 133 14959 0.07% 134 15941 0.07% 135 16534 0.08% 136 17365 0.08% 137 18126 0.08% 138 18830 0.09% 139 19481 0.09% 140 20544 0.10% 141 21005 0.10% 142 22390 0.10% 143 23725 0.11% 144 24923 0.12% 145 27702 0.13% 146 34292 0.16% 147 56009 0.26% 148 160396 0.75% 149 1170585 5.44% 150 19581295 90.99% 21519602 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.81 fanout-score-rank=6 prefix-density=0.42 prefix-fanout=3.1 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=28.38 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.0 sequence=AAGGCCAAGATCCAGGACAAGGAAGG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.80 fanout-score-rank=8 prefix-density=0.39 prefix-fanout=3.1 sequence=CTGCTGGCATCGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=12.09 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=2.9 sequence=CCGCACTTGCAGCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATT SRR5986239 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:27:47 Started mapping on | Feb 14 03:27:47 Finished on | Feb 14 03:33:39 Mapping speed, Million of reads per hour | 220.09 Number of input reads | 21519602 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18011772 Uniquely mapped reads % | 83.70% Average mapped length | 288.28 Number of splices: Total | 16702539 Number of splices: Annotated (sjdb) | 16204262 Number of splices: GT/AG | 16318714 Number of splices: GC/AG | 221539 Number of splices: AT/AC | 18017 Number of splices: Non-canonical | 144269 Mismatch rate per base, % | 2.12% Deletion rate per base | 0.14% Deletion average length | 3.25 Insertion rate per base | 0.09% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 986529 % of reads mapped to multiple loci | 4.58% Number of reads mapped to too many loci | 48774 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.21% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2521301 2521301 2521301 N_multimapping 986529 986529 986529 N_noFeature 545940 9233179 9185808 N_ambiguous 309190 84958 86333 UnstrandedReadsAssigned:17156642 PositiveStrandReadsAssigned:8693635 NegativeStrandReadsAssigned:8739631 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986239-trimmed-pair1.fastq SRR5986239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,519,602 reads, 17,448,973 reads pseudoaligned [quant] estimated average fragment length: 227.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR5986239.ke.tsv 34699 SRR5986239.se.tsv 87100 total ==> SRR5986239.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.02 901 21.9752 Potri.005G024800.1.v4.1 1035 808.023 679 36.7075 Potri.004G059700.1.v4.1 961 734.023 7 0.416579 Potri.007G009000.2.v4.1 1416 1189.02 1 0.0367383 Potri.003G141000.2.v4.1 2943 2716.02 280 4.50333 Potri.016G087400.1.v4.1 270 59.3878 684 503.116 Potri.015G069301.1.v4.1 564 337.143 0 0 Potri.010G195200.1.v4.1 1773 1546.02 130 3.67313 Potri.012G127500.1.v4.1 977 750.023 9272 540.018 ==> SRR5986239.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR5986239 completed mapping pipeline successfully