Starting /dee2/code/volunteer_pipeline.sh SRR5986240 current disk space = 3087954722816 free memory = 1404629556 SRR5986240 SRAfilesize befba77690e3fac184d84eef21eda547 SRR5986240.sra SRR5986240.sra file validated SRR5986240 is paired end SRR5986240 is conventional basespace SRR5986240 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986240_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.91375 32.0 27.0 32.0 2.0 32.0 2 31.33 32.0 32.0 32.0 32.0 32.0 3 33.13375 32.0 32.0 37.0 32.0 37.0 4 35.2175 37.0 37.0 37.0 32.0 37.0 5 35.89625 37.0 37.0 37.0 32.0 37.0 6 39.27425 41.0 37.0 41.0 37.0 41.0 7 39.0115 41.0 37.0 41.0 32.0 41.0 8 39.51525 41.0 41.0 41.0 37.0 41.0 9 39.6365 41.0 41.0 41.0 37.0 41.0 10-14 39.2756 41.0 41.0 41.0 36.0 41.0 15-19 39.3549 41.0 41.0 41.0 36.0 41.0 20-24 39.365449999999996 41.0 41.0 41.0 37.0 41.0 25-29 38.65955 41.0 39.4 41.0 33.0 41.0 30-34 38.7727 41.0 39.4 41.0 35.0 41.0 35-39 38.3282 41.0 38.6 41.0 31.0 41.0 40-44 38.3172 41.0 38.6 41.0 33.0 41.0 45-49 37.3691 41.0 37.0 41.0 28.0 41.0 50-54 36.5524 41.0 37.0 41.0 25.0 41.0 55-59 36.8793 41.0 37.0 41.0 26.0 41.0 60-64 36.88440000000001 41.0 36.0 41.0 24.0 41.0 65-69 35.8279 40.2 35.0 41.0 23.0 41.0 70-74 37.5129 41.0 37.0 41.0 28.0 41.0 75-79 37.255449999999996 41.0 37.0 41.0 28.0 41.0 80-84 34.689 39.4 32.0 41.0 18.0 41.0 85-89 35.736650000000004 40.2 34.0 41.0 22.0 41.0 90-94 36.726800000000004 41.0 37.0 41.0 25.0 41.0 95-99 35.4616 39.4 33.0 41.0 22.0 41.0 100-104 31.689999999999998 35.0 25.0 41.0 14.0 41.0 105-109 33.5572 37.8 30.0 41.0 16.0 41.0 110-114 33.81699999999999 37.8 30.0 41.0 18.0 41.0 115-119 35.3318 40.2 33.0 41.0 22.0 41.0 120-124 31.97385 36.8 26.0 41.0 15.0 41.0 125-129 31.62655 36.0 23.0 40.2 12.0 41.0 130-134 30.933799999999998 35.0 23.0 40.2 12.0 41.0 135-139 32.556 37.0 27.0 41.0 12.0 41.0 140-144 27.940799999999996 31.0 18.0 37.6 12.0 41.0 145-149 30.864150000000002 35.0 25.0 41.0 12.0 41.0 150 31.28675 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 8.0 21 3.0 22 11.0 23 29.0 24 44.0 25 51.0 26 69.0 27 93.0 28 108.0 29 138.0 30 161.0 31 165.0 32 178.0 33 202.0 34 270.0 35 294.0 36 312.0 37 371.0 38 459.0 39 570.0 40 463.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.630346550109273 19.6066187948798 18.54511395566656 34.21792069934437 2 25.15 25.95 34.0 14.899999999999999 3 22.45 30.95 25.95 20.65 4 22.55 36.4 21.875 19.175 5 22.425 38.375 21.325 17.875 6 17.025000000000002 37.974999999999994 24.15 20.849999999999998 7 14.025000000000002 16.675 45.25 24.05 8 18.8 22.275 29.475 29.45 9 20.724999999999998 22.625 29.125 27.525 10-14 20.77 29.615000000000002 27.229999999999997 22.384999999999998 15-19 21.515 28.310000000000002 27.785 22.39 20-24 21.5 29.435 27.0 22.065 25-29 21.15 28.804999999999996 27.93 22.115000000000002 30-34 21.595 28.98 27.644999999999996 21.78 35-39 21.265 28.744999999999997 27.735 22.255 40-44 21.705 28.51 27.675 22.11 45-49 22.035 28.249999999999996 27.944999999999997 21.77 50-54 21.42 28.875 27.755000000000003 21.95 55-59 21.605 28.935 27.115000000000002 22.345000000000002 60-64 21.95 28.165000000000003 27.55 22.335 65-69 21.64 28.854999999999997 27.735 21.77 70-74 21.84 28.055000000000003 27.435 22.67 75-79 21.175 28.389999999999997 28.165000000000003 22.27 80-84 21.515 28.37 28.165000000000003 21.95 85-89 22.02 28.115000000000002 27.775 22.09 90-94 21.985 28.175 27.815 22.025 95-99 21.785 29.049999999999997 27.015 22.15 100-104 22.045 28.325 28.275 21.355 105-109 21.505 28.16 27.805000000000003 22.53 110-114 21.535 28.265 28.7 21.5 115-119 22.509999999999998 28.1 28.215 21.175 120-124 21.560000000000002 27.815 29.555 21.07 125-129 22.205 27.855 28.804999999999996 21.135 130-134 21.75 28.215 28.73 21.305 135-139 21.94 28.849999999999998 27.92 21.29 140-144 22.89 28.26 29.21 19.64 145-149 21.9 28.985 27.555000000000003 21.560000000000002 150 21.875 28.15 27.925 22.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.5 8 1.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 0.5 22 1.5 23 3.5 24 2.5 25 5.0 26 7.0 27 8.0 28 13.5 29 18.5 30 24.5 31 32.0 32 41.0 33 45.5 34 59.5 35 81.0 36 105.0 37 135.0 38 146.5 39 177.0 40 207.0 41 208.0 42 228.5 43 263.0 44 274.5 45 263.0 46 241.5 47 223.5 48 212.0 49 186.5 50 150.0 51 124.0 52 110.5 53 90.5 54 68.5 55 53.5 56 43.5 57 33.0 58 26.0 59 22.0 60 15.0 61 10.0 62 6.0 63 2.5 64 4.5 65 5.0 66 2.0 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 1.0 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.88531505404693 89.97500000000001 2 4.798312681254943 9.1 3 0.29000790930661746 0.8250000000000001 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986240 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986240_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.23125 32.0 12.0 32.0 2.0 32.0 2 30.93125 32.0 32.0 32.0 32.0 32.0 3 31.69875 32.0 32.0 37.0 27.0 37.0 4 34.5025 37.0 32.0 37.0 32.0 37.0 5 35.4275 37.0 37.0 37.0 32.0 37.0 6 38.55725 41.0 37.0 41.0 32.0 41.0 7 33.416 37.0 32.0 41.0 12.0 41.0 8 37.86675 41.0 37.0 41.0 32.0 41.0 9 35.1915 41.0 32.0 41.0 12.0 41.0 10-14 36.56705 41.0 36.0 41.0 24.0 41.0 15-19 34.23875 37.6 31.0 41.0 20.0 41.0 20-24 35.1224 39.4 32.0 41.0 21.0 41.0 25-29 34.90615 39.4 32.0 41.0 21.0 41.0 30-34 29.984500000000004 33.0 21.0 40.2 12.0 41.0 35-39 33.9805 38.4 31.0 40.2 19.0 41.0 40-44 29.231450000000002 30.8 22.0 37.6 15.0 40.2 45-49 30.90005 34.0 22.0 40.2 12.0 41.0 50-54 32.05045 35.8 25.0 41.0 16.0 41.0 55-59 29.713749999999997 32.0 17.0 39.4 14.0 41.0 60-64 29.198699999999995 32.0 19.0 40.2 14.0 41.0 65-69 27.103550000000002 27.0 18.0 38.4 12.0 40.2 70-74 27.520550000000004 27.0 18.0 37.6 12.0 40.2 75-79 30.6187 35.0 21.0 41.0 12.0 41.0 80-84 28.079500000000003 31.0 16.0 39.2 12.0 41.0 85-89 29.5383 34.0 20.0 40.2 12.0 41.0 90-94 24.83425 25.0 14.0 35.0 12.0 40.2 95-99 24.34885 24.0 12.0 35.0 12.0 40.2 100-104 23.72765 20.0 12.0 35.0 12.0 39.4 105-109 24.57345 25.0 12.0 35.0 12.0 39.4 110-114 25.72845 28.0 16.0 35.0 12.0 40.2 115-119 24.27245 23.0 12.0 35.0 12.0 41.0 120-124 22.939799999999998 22.0 12.0 33.0 12.0 40.2 125-129 22.037100000000002 20.0 12.0 30.0 12.0 37.0 130-134 21.571950000000005 19.0 12.0 30.0 12.0 38.6 135-139 21.060400000000005 18.0 12.0 29.0 12.0 37.0 140-144 21.50885 20.0 12.0 30.0 12.0 37.0 145-149 19.15295 16.0 12.0 25.0 11.2 35.0 150 18.716 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 11.0 16 52.0 17 100.0 18 143.0 19 162.0 20 172.0 21 182.0 22 178.0 23 168.0 24 190.0 25 190.0 26 211.0 27 196.0 28 194.0 29 224.0 30 213.0 31 227.0 32 206.0 33 240.0 34 177.0 35 182.0 36 161.0 37 128.0 38 68.0 39 23.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.68687840872634 19.024703240295153 19.53801732435034 33.75040102662817 2 23.325000000000003 26.224999999999998 35.699999999999996 14.75 3 21.525 30.45 27.650000000000002 20.375 4 22.35 35.9 21.525 20.225 5 21.475 38.7 21.875 17.95 6 15.85 40.375 23.45 20.325 7 16.275000000000002 17.175 44.85 21.7 8 18.425 22.075 28.625 30.875000000000004 9 20.5 23.35 29.675 26.474999999999998 10-14 20.830000000000002 30.0 27.6 21.57 15-19 21.675 28.21 28.875 21.240000000000002 20-24 21.435000000000002 28.52 29.145 20.9 25-29 21.84 28.605000000000004 28.4 21.154999999999998 30-34 22.07 29.48 28.98 19.470000000000002 35-39 21.725 29.335 28.285 20.655 40-44 22.935 30.485 29.189999999999998 17.39 45-49 22.7 29.575000000000003 28.215 19.509999999999998 50-54 22.335 29.23 28.265 20.169999999999998 55-59 23.075000000000003 28.515 28.945 19.465 60-64 22.95 29.38 29.189999999999998 18.48 65-69 22.525000000000002 29.435 30.44 17.599999999999998 70-74 24.135 29.195 28.49 18.18 75-79 21.959999999999997 28.835 29.18 20.025000000000002 80-84 22.28 29.4 30.795 17.525 85-89 22.28 27.875 30.11 19.735 90-94 23.025000000000002 29.255 31.005 16.715 95-99 23.325000000000003 28.810000000000002 30.585 17.28 100-104 22.79 29.48 31.04 16.689999999999998 105-109 22.66 28.18 31.169999999999998 17.990000000000002 110-114 23.1 28.235 29.715000000000003 18.95 115-119 22.61 27.779999999999998 30.42 19.189999999999998 120-124 22.945 28.375 30.5 18.18 125-129 23.62 27.855 30.935000000000002 17.59 130-134 23.185 28.720000000000002 30.73 17.365 135-139 23.794999999999998 28.285 31.03 16.89 140-144 22.845 28.634999999999998 30.240000000000002 18.279999999999998 145-149 24.295 27.26 31.979999999999997 16.465 150 24.875 27.975 32.9 14.249999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.5 16 1.0 17 1.0 18 1.0 19 1.0 20 2.5 21 2.5 22 4.5 23 6.5 24 6.5 25 13.0 26 16.5 27 18.0 28 28.5 29 39.0 30 40.0 31 56.0 32 77.5 33 81.0 34 94.5 35 118.0 36 146.0 37 155.0 38 168.0 39 220.5 40 250.5 41 241.5 42 239.5 43 255.5 44 249.0 45 220.5 46 204.0 47 190.0 48 173.5 49 151.5 50 119.0 51 88.0 52 72.5 53 55.0 54 40.5 55 40.0 56 30.5 57 19.0 58 17.5 59 17.0 60 9.0 61 3.0 62 3.0 63 2.5 64 2.5 65 2.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.05 0.0 0.0 0.025 0.0 100-101 0.05 0.0 0.0 0.025 0.0 102-103 0.05 0.0 0.0 0.025 0.0 104-105 0.075 0.0 0.0 0.025 0.0 106-107 0.1 0.0 0.0 0.025 0.0 108-109 0.125 0.0 0.0 0.025 0.0 110-111 0.15 0.0 0.0 0.025 0.0 112-113 0.16249999999999998 0.0 0.0 0.025 0.0 114-115 0.21250000000000002 0.0 0.0 0.025 0.0 116-117 0.225 0.0 0.0 0.025 0.0 118-119 0.225 0.0 0.0 0.025 0.0 120-121 0.225 0.0 0.0 0.025 0.0 122-123 0.2375 0.0 0.0 0.025 0.0 124-125 0.2875 0.0 0.0 0.025 0.0 126-127 0.3375 0.0 0.0 0.025 0.0 128-129 0.3875 0.0 0.0 0.025 0.0 130-131 0.475 0.0 0.0 0.025 0.0 132-133 0.5874999999999999 0.0 0.0 0.025 0.0 134-135 0.6125 0.0 0.0 0.025 0.0 136-137 0.625 0.0 0.0 0.025 0.0 138 0.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258715 spots for SRR5986240.sra Written 1258715 spots for SRR5986240.sra Read 1258724 spots for SRR5986240.sra Written 1258724 spots for SRR5986240.sra SRR ids: ['SRR5986240.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ie5ymef5 SRR5986240.sra spots: 25174309 blocks: [[1, 1258715], [1258716, 2517430], [2517431, 3776145], [3776146, 5034860], [5034861, 6293575], [6293576, 7552290], [7552291, 8811005], [8811006, 10069720], [10069721, 11328435], [11328436, 12587150], [12587151, 13845865], [13845866, 15104580], [15104581, 16363295], [16363296, 17622010], [17622011, 18880725], [18880726, 20139440], [20139441, 21398155], [21398156, 22656870], [22656871, 23915585], [23915586, 25174309]] SRR5986240 file size 8459878 SRR5986240 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986240 SRR5986240_1.fastq SRR5986240_2.fastq Input file: SRR5986240_1.fastq Paired file: SRR5986240_2.fastq trimmed: SRR5986240-trimmed-pair1.fastq, SRR5986240-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:22:30 2025 >> started Fri Feb 14 02:22:57 2025 >> done (26.862s) 25174309 read pairs processed; of these: 230 ( 0.00%) short read pairs filtered out after trimming by size control 328 ( 0.00%) empty read pairs filtered out after trimming by size control 25173751 (100.00%) read pairs available; of these: 2218342 ( 8.81%) trimmed read pairs available after processing 22955409 (91.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 32 0.00% 20 37 0.00% 21 45 0.00% 22 43 0.00% 23 74 0.00% 24 86 0.00% 25 81 0.00% 26 96 0.00% 27 91 0.00% 28 103 0.00% 29 107 0.00% 30 111 0.00% 31 107 0.00% 32 113 0.00% 33 110 0.00% 34 97 0.00% 35 108 0.00% 36 113 0.00% 37 109 0.00% 38 137 0.00% 39 111 0.00% 40 117 0.00% 41 141 0.00% 42 113 0.00% 43 121 0.00% 44 124 0.00% 45 113 0.00% 46 127 0.00% 47 132 0.00% 48 154 0.00% 49 138 0.00% 50 143 0.00% 51 143 0.00% 52 174 0.00% 53 149 0.00% 54 153 0.00% 55 169 0.00% 56 152 0.00% 57 165 0.00% 58 205 0.00% 59 206 0.00% 60 201 0.00% 61 204 0.00% 62 187 0.00% 63 202 0.00% 64 200 0.00% 65 221 0.00% 66 205 0.00% 67 242 0.00% 68 254 0.00% 69 244 0.00% 70 252 0.00% 71 273 0.00% 72 282 0.00% 73 319 0.00% 74 356 0.00% 75 319 0.00% 76 350 0.00% 77 427 0.00% 78 387 0.00% 79 429 0.00% 80 440 0.00% 81 518 0.00% 82 578 0.00% 83 643 0.00% 84 703 0.00% 85 697 0.00% 86 788 0.00% 87 827 0.00% 88 889 0.00% 89 971 0.00% 90 1025 0.00% 91 1216 0.00% 92 1210 0.00% 93 1428 0.01% 94 1527 0.01% 95 1634 0.01% 96 1684 0.01% 97 1885 0.01% 98 2001 0.01% 99 2175 0.01% 100 2323 0.01% 101 2478 0.01% 102 2758 0.01% 103 2919 0.01% 104 3081 0.01% 105 3289 0.01% 106 3613 0.01% 107 3925 0.02% 108 3873 0.02% 109 4270 0.02% 110 4381 0.02% 111 4770 0.02% 112 5127 0.02% 113 5441 0.02% 114 5670 0.02% 115 6102 0.02% 116 6543 0.03% 117 6758 0.03% 118 7210 0.03% 119 7228 0.03% 120 7846 0.03% 121 8415 0.03% 122 8695 0.03% 123 9392 0.04% 124 10070 0.04% 125 10476 0.04% 126 10909 0.04% 127 11228 0.04% 128 11906 0.05% 129 12401 0.05% 130 12973 0.05% 131 13513 0.05% 132 14269 0.06% 133 15031 0.06% 134 16000 0.06% 135 16786 0.07% 136 17443 0.07% 137 18114 0.07% 138 18777 0.07% 139 19687 0.08% 140 20315 0.08% 141 21135 0.08% 142 22504 0.09% 143 23624 0.09% 144 24758 0.10% 145 28488 0.11% 146 35983 0.14% 147 63735 0.25% 148 192612 0.77% 149 1396223 5.55% 150 22955409 91.19% 25173751 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=10.40 fanout-score-rank=10 prefix-density=0.38 prefix-fanout=4.2 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=85.29 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.2 sequence=AAAGCAGCAGGAAACACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGCGGCCATGGCTAGCTAACTGTACTCTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.83 fanout-score-rank=10 prefix-density=0.35 prefix-fanout=4.3 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=92.64 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.4 sequence=GGTGGTGGTGGAG SRR5986240 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:24:32 Started mapping on | Feb 14 02:24:32 Finished on | Feb 14 02:30:37 Mapping speed, Million of reads per hour | 248.29 Number of input reads | 25173751 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 20414397 Uniquely mapped reads % | 81.09% Average mapped length | 276.64 Number of splices: Total | 17330516 Number of splices: Annotated (sjdb) | 16745441 Number of splices: GT/AG | 16922226 Number of splices: GC/AG | 220495 Number of splices: AT/AC | 18219 Number of splices: Non-canonical | 169576 Mismatch rate per base, % | 2.18% Deletion rate per base | 0.14% Deletion average length | 3.20 Insertion rate per base | 0.09% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1287331 % of reads mapped to multiple loci | 5.11% Number of reads mapped to too many loci | 59358 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.33% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3472223 3472223 3472223 N_multimapping 1287331 1287331 1287331 N_noFeature 573077 10458161 10406265 N_ambiguous 370589 124248 124507 UnstrandedReadsAssigned:19470731 PositiveStrandReadsAssigned:9831988 NegativeStrandReadsAssigned:9883625 Dataset is classified unstranded MeadianReadLen=138 20thPercentileLength=138 echo kmer=133 SRR5986240 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986240-trimmed-pair1.fastq SRR5986240-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,173,751 reads, 20,405,122 reads pseudoaligned [quant] estimated average fragment length: 220.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR5986240.ke.tsv 34699 SRR5986240.se.tsv 87100 total ==> SRR5986240.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.1 2119 49.0398 Potri.005G024800.1.v4.1 1035 815.099 1839 93.8865 Potri.004G059700.1.v4.1 961 741.099 60 3.36904 Potri.007G009000.2.v4.1 1416 1196.1 0 0 Potri.003G141000.2.v4.1 2943 2723.1 401.414 6.13423 Potri.016G087400.1.v4.1 270 65.1293 947 605.069 Potri.015G069301.1.v4.1 564 344.192 0 0 Potri.010G195200.1.v4.1 1773 1553.1 142 3.8047 Potri.012G127500.1.v4.1 977 757.099 3548 195.013 ==> SRR5986240.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 98 SRR5986240 completed mapping pipeline successfully