Starting /dee2/code/volunteer_pipeline.sh SRR5986241 current disk space = 3088262369280 free memory = 1581321868 SRR5986241 SRAfilesize d73a076c8b500773f0797cb08bdc0659 SRR5986241.sra SRR5986241.sra file validated SRR5986241 is paired end SRR5986241 is conventional basespace SRR5986241 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.57 32.0 12.0 32.0 2.0 32.0 2 31.30875 32.0 32.0 32.0 32.0 32.0 3 33.01 32.0 32.0 37.0 32.0 37.0 4 35.135 37.0 37.0 37.0 32.0 37.0 5 35.87 37.0 37.0 37.0 32.0 37.0 6 39.2675 41.0 37.0 41.0 37.0 41.0 7 38.91925 41.0 37.0 41.0 37.0 41.0 8 39.3935 41.0 41.0 41.0 37.0 41.0 9 39.62725 41.0 41.0 41.0 37.0 41.0 10-14 39.277699999999996 41.0 41.0 41.0 36.0 41.0 15-19 39.3313 41.0 41.0 41.0 36.0 41.0 20-24 39.3789 41.0 41.0 41.0 37.0 41.0 25-29 38.73434999999999 41.0 39.4 41.0 35.0 41.0 30-34 38.76705 41.0 39.4 41.0 35.0 41.0 35-39 38.3655 41.0 38.6 41.0 32.0 41.0 40-44 38.25065 41.0 38.6 41.0 31.0 41.0 45-49 37.34795 41.0 37.0 41.0 28.0 41.0 50-54 36.54125 41.0 37.0 41.0 25.0 41.0 55-59 36.75170000000001 41.0 37.0 41.0 26.0 41.0 60-64 37.031150000000004 41.0 36.0 41.0 26.0 41.0 65-69 35.8281 40.2 35.0 41.0 22.0 41.0 70-74 37.59605 41.0 37.0 41.0 29.0 41.0 75-79 37.329449999999994 41.0 37.0 41.0 28.0 41.0 80-84 34.5495 38.6 31.0 41.0 18.0 41.0 85-89 35.66575 41.0 34.0 41.0 22.0 41.0 90-94 36.66585 41.0 36.0 41.0 25.0 41.0 95-99 35.37670000000001 39.4 33.0 41.0 22.0 41.0 100-104 31.64015 35.8 25.0 41.0 14.0 41.0 105-109 33.65175000000001 38.6 30.0 41.0 16.0 41.0 110-114 33.89285 37.8 29.0 41.0 18.0 41.0 115-119 35.40135 40.2 34.0 41.0 22.0 41.0 120-124 32.167 37.8 26.0 41.0 15.0 41.0 125-129 31.859249999999996 36.0 25.0 40.2 12.0 41.0 130-134 31.179700000000004 36.0 25.0 40.2 12.0 41.0 135-139 32.7496 37.0 28.0 41.0 12.0 41.0 140-144 28.171750000000003 31.0 20.0 37.6 12.0 41.0 145-149 31.249299999999998 35.0 25.0 41.0 12.0 41.0 150 31.39525 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 5.0 20 5.0 21 7.0 22 24.0 23 30.0 24 38.0 25 46.0 26 71.0 27 88.0 28 99.0 29 130.0 30 135.0 31 172.0 32 177.0 33 219.0 34 246.0 35 294.0 36 318.0 37 379.0 38 469.0 39 576.0 40 471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.0570703868104 18.389346861128725 18.516169942929615 33.03741280913126 2 24.925 26.924999999999997 34.65 13.5 3 22.27227227227227 29.77977977977978 27.627627627627625 20.32032032032032 4 21.625 35.85 21.175 21.349999999999998 5 21.925 37.85 21.675 18.55 6 16.925 39.074999999999996 23.775 20.225 7 16.125 17.599999999999998 43.824999999999996 22.45 8 20.075000000000003 22.3 27.825 29.799999999999997 9 19.925 23.05 29.225 27.800000000000004 10-14 20.635 29.785 27.02 22.56 15-19 21.12 28.175 27.71 22.994999999999997 20-24 21.195 29.715000000000003 27.435 21.654999999999998 25-29 21.195 28.904999999999998 27.29 22.61 30-34 21.029999999999998 28.935 27.955000000000002 22.08 35-39 21.63 28.720000000000002 27.589999999999996 22.06 40-44 21.165 28.785 28.16 21.89 45-49 22.245 28.64 27.694999999999997 21.42 50-54 21.759999999999998 28.060000000000002 27.825 22.355 55-59 22.33 28.67 27.54 21.46 60-64 21.560000000000002 28.4 27.79 22.25 65-69 22.08 28.34 28.22 21.36 70-74 22.125 28.765 27.175 21.935 75-79 21.52 28.005000000000003 27.74 22.735 80-84 22.165000000000003 28.845 27.905 21.085 85-89 21.8 28.29 27.900000000000002 22.009999999999998 90-94 21.84 28.044999999999998 27.91 22.205 95-99 21.52 28.349999999999998 28.105000000000004 22.025 100-104 21.675 28.694999999999997 28.29 21.34 105-109 21.875 28.79 27.35 21.985 110-114 21.985 28.27 27.825 21.92 115-119 21.975 28.315 27.634999999999998 22.075 120-124 22.41 27.51 28.865000000000002 21.215 125-129 21.965 28.895 27.705000000000002 21.435000000000002 130-134 22.36 28.110000000000003 28.24 21.29 135-139 22.34 27.47 28.285 21.905 140-144 22.395 29.17 28.139999999999997 20.294999999999998 145-149 21.365000000000002 28.444999999999997 28.194999999999997 21.995 150 22.05 27.675 27.750000000000004 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 2.0 15 1.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 3.0 22 4.0 23 3.5 24 3.0 25 4.0 26 9.0 27 11.0 28 16.5 29 24.5 30 21.0 31 28.5 32 45.5 33 57.5 34 70.0 35 74.0 36 87.0 37 119.5 38 148.0 39 161.0 40 194.0 41 226.0 42 243.5 43 252.0 44 263.0 45 268.5 46 253.5 47 239.5 48 210.5 49 180.0 50 152.5 51 134.5 52 116.5 53 84.0 54 64.5 55 55.5 56 41.0 57 32.0 58 24.0 59 14.0 60 9.0 61 8.0 62 6.5 63 5.0 64 4.0 65 3.5 66 2.5 67 2.5 68 4.0 69 3.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.15 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16298633017875 90.5 2 4.52155625657203 8.6 3 0.31545741324921134 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8500000000000001 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGTA 10 0.0070099696 143.75 4 >>END_MODULE SRR5986241 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986241_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.83125 32.0 12.0 32.0 2.0 32.0 2 30.745 32.0 32.0 32.0 27.0 32.0 3 31.73 32.0 32.0 37.0 27.0 37.0 4 34.6075 37.0 32.0 37.0 32.0 37.0 5 35.235 37.0 37.0 37.0 32.0 37.0 6 38.5345 41.0 37.0 41.0 32.0 41.0 7 33.0025 37.0 27.0 41.0 12.0 41.0 8 37.758 41.0 37.0 41.0 32.0 41.0 9 34.91525 41.0 32.0 41.0 12.0 41.0 10-14 36.58105 41.0 36.0 41.0 24.0 41.0 15-19 34.370799999999996 38.4 30.0 41.0 20.0 41.0 20-24 35.2834 39.4 32.0 41.0 21.0 41.0 25-29 34.969849999999994 39.4 33.0 41.0 21.0 41.0 30-34 30.121550000000003 33.0 21.0 40.2 12.0 41.0 35-39 34.0416 38.4 31.0 41.0 19.0 41.0 40-44 29.4835 32.8 22.0 37.6 15.0 40.2 45-49 30.731350000000003 34.0 21.0 40.2 12.0 41.0 50-54 32.010450000000006 35.8 25.0 41.0 16.0 41.0 55-59 29.6873 33.0 18.0 39.4 14.0 41.0 60-64 29.1704 32.0 19.0 40.2 14.0 41.0 65-69 27.1044 27.0 18.0 38.4 12.0 40.2 70-74 27.69565 28.0 18.0 37.6 12.0 40.2 75-79 30.582000000000004 35.0 21.0 41.0 12.0 41.0 80-84 28.0551 31.0 14.0 39.2 12.0 41.0 85-89 29.34175 33.0 20.0 40.2 12.0 41.0 90-94 24.7246 24.0 14.0 35.0 12.0 40.2 95-99 24.2739 24.0 12.0 35.0 12.0 39.4 100-104 23.7075 21.0 12.0 35.0 12.0 39.4 105-109 24.499599999999997 24.0 12.0 35.0 12.0 39.4 110-114 25.760699999999996 27.0 14.0 35.0 12.0 41.0 115-119 24.304399999999998 23.0 12.0 36.0 12.0 41.0 120-124 23.08545 22.0 12.0 33.0 12.0 40.2 125-129 22.092899999999997 20.0 12.0 30.0 12.0 37.0 130-134 21.47065 17.0 12.0 30.0 11.2 38.6 135-139 21.07065 18.0 12.0 29.0 12.0 37.0 140-144 21.313899999999997 20.0 12.0 30.0 12.0 37.0 145-149 18.972900000000003 16.0 12.0 25.0 11.2 34.0 150 18.73325 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 13 1.0 14 4.0 15 16.0 16 51.0 17 102.0 18 147.0 19 165.0 20 181.0 21 174.0 22 182.0 23 158.0 24 183.0 25 228.0 26 211.0 27 180.0 28 194.0 29 189.0 30 213.0 31 209.0 32 199.0 33 204.0 34 225.0 35 181.0 36 159.0 37 149.0 38 69.0 39 24.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.0065445026178 18.848167539267017 17.73560209424084 33.409685863874344 2 23.7 25.974999999999998 35.075 15.25 3 21.4 30.049999999999997 27.775 20.775 4 22.35 34.25 21.375 22.025 5 22.75 37.6 22.475 17.175 6 16.275000000000002 38.85 24.349999999999998 20.525 7 16.575 16.55 45.550000000000004 21.325 8 19.575 21.375 28.975 30.075000000000003 9 21.65 22.525000000000002 30.225 25.6 10-14 20.965 29.725 27.6 21.709999999999997 15-19 21.905 27.505000000000003 28.92 21.67 20-24 21.46 29.330000000000002 27.845 21.365000000000002 25-29 21.915000000000003 29.285 27.41 21.39 30-34 21.865000000000002 29.165000000000003 28.794999999999998 20.175 35-39 21.805 29.555 27.58 21.060000000000002 40-44 22.384999999999998 30.28 29.92 17.415 45-49 22.945 28.775000000000002 28.375 19.905 50-54 22.145 29.14 28.315 20.4 55-59 22.915 29.049999999999997 28.749999999999996 19.285 60-64 22.62 28.87 29.535 18.975 65-69 22.770000000000003 29.335 29.785 18.11 70-74 24.36 29.43 28.46 17.75 75-79 22.29 27.525 29.744999999999997 20.44 80-84 22.485 29.104999999999997 30.94 17.47 85-89 22.155 28.775000000000002 29.5 19.57 90-94 23.544999999999998 29.2 30.935000000000002 16.32 95-99 22.86 29.67 29.875 17.595 100-104 22.689999999999998 29.160000000000004 31.14 17.01 105-109 22.264999999999997 29.285 30.28 18.17 110-114 22.805 28.689999999999998 29.75 18.755 115-119 22.81 28.449999999999996 29.975 18.765 120-124 23.05 28.7 30.65 17.599999999999998 125-129 23.31 27.87 31.045 17.775 130-134 23.635 29.205 30.125 17.035 135-139 23.02 28.73 31.745 16.505 140-144 23.41 27.860000000000003 30.154999999999998 18.575 145-149 24.91 28.110000000000003 31.1 15.879999999999999 150 24.075 27.474999999999998 34.125 14.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 3.5 22 4.5 23 5.5 24 8.5 25 11.5 26 13.5 27 16.0 28 26.5 29 38.5 30 51.0 31 57.0 32 57.5 33 76.5 34 99.5 35 116.0 36 128.5 37 156.5 38 189.0 39 196.0 40 224.0 41 246.5 42 236.5 43 242.5 44 238.5 45 244.0 46 233.0 47 189.0 48 174.0 49 169.5 50 127.5 51 83.5 52 73.0 53 65.5 54 54.5 55 40.5 56 26.5 57 16.5 58 12.0 59 11.0 60 8.5 61 5.0 62 5.5 63 4.0 64 2.5 65 1.0 66 1.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.599999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208999 spots for SRR5986241.sra Written 1208999 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra Read 1208996 spots for SRR5986241.sra Written 1208996 spots for SRR5986241.sra SRR ids: ['SRR5986241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ap6ja_2r SRR5986241.sra spots: 24179923 blocks: [[1, 1208996], [1208997, 2417992], [2417993, 3626988], [3626989, 4835984], [4835985, 6044980], [6044981, 7253976], [7253977, 8462972], [8462973, 9671968], [9671969, 10880964], [10880965, 12089960], [12089961, 13298956], [13298957, 14507952], [14507953, 15716948], [15716949, 16925944], [16925945, 18134940], [18134941, 19343936], [19343937, 20552932], [20552933, 21761928], [21761929, 22970924], [22970925, 24179923]] SRR5986241 file size 8124855 SRR5986241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986241 SRR5986241_1.fastq SRR5986241_2.fastq Input file: SRR5986241_1.fastq Paired file: SRR5986241_2.fastq trimmed: SRR5986241-trimmed-pair1.fastq, SRR5986241-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:33:18 2025 >> started Fri Feb 14 03:33:45 2025 >> done (27.139s) 24179923 read pairs processed; of these: 268 ( 0.00%) short read pairs filtered out after trimming by size control 415 ( 0.00%) empty read pairs filtered out after trimming by size control 24179240 (100.00%) read pairs available; of these: 2369742 ( 9.80%) trimmed read pairs available after processing 21809498 (90.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 28 0.00% 20 29 0.00% 21 26 0.00% 22 43 0.00% 23 43 0.00% 24 52 0.00% 25 69 0.00% 26 86 0.00% 27 79 0.00% 28 99 0.00% 29 114 0.00% 30 78 0.00% 31 96 0.00% 32 91 0.00% 33 92 0.00% 34 94 0.00% 35 113 0.00% 36 92 0.00% 37 94 0.00% 38 94 0.00% 39 90 0.00% 40 96 0.00% 41 87 0.00% 42 107 0.00% 43 122 0.00% 44 122 0.00% 45 112 0.00% 46 111 0.00% 47 121 0.00% 48 129 0.00% 49 146 0.00% 50 118 0.00% 51 136 0.00% 52 145 0.00% 53 127 0.00% 54 136 0.00% 55 139 0.00% 56 166 0.00% 57 160 0.00% 58 163 0.00% 59 183 0.00% 60 205 0.00% 61 187 0.00% 62 185 0.00% 63 199 0.00% 64 211 0.00% 65 228 0.00% 66 220 0.00% 67 247 0.00% 68 288 0.00% 69 271 0.00% 70 316 0.00% 71 329 0.00% 72 328 0.00% 73 366 0.00% 74 391 0.00% 75 366 0.00% 76 396 0.00% 77 433 0.00% 78 510 0.00% 79 585 0.00% 80 592 0.00% 81 648 0.00% 82 713 0.00% 83 790 0.00% 84 826 0.00% 85 929 0.00% 86 962 0.00% 87 1093 0.00% 88 1204 0.00% 89 1281 0.01% 90 1375 0.01% 91 1555 0.01% 92 1765 0.01% 93 1842 0.01% 94 2151 0.01% 95 2242 0.01% 96 2337 0.01% 97 2581 0.01% 98 2725 0.01% 99 2841 0.01% 100 3223 0.01% 101 3468 0.01% 102 3694 0.02% 103 4059 0.02% 104 4415 0.02% 105 4805 0.02% 106 4960 0.02% 107 5188 0.02% 108 5482 0.02% 109 5900 0.02% 110 6213 0.03% 111 6587 0.03% 112 7089 0.03% 113 7579 0.03% 114 8060 0.03% 115 8677 0.04% 116 8983 0.04% 117 9395 0.04% 118 9894 0.04% 119 10122 0.04% 120 10783 0.04% 121 11166 0.05% 122 12055 0.05% 123 12796 0.05% 124 13744 0.06% 125 14245 0.06% 126 14845 0.06% 127 15499 0.06% 128 16038 0.07% 129 16411 0.07% 130 17316 0.07% 131 18098 0.07% 132 18735 0.08% 133 19616 0.08% 134 20758 0.09% 135 21842 0.09% 136 23013 0.10% 137 23925 0.10% 138 24335 0.10% 139 25474 0.11% 140 26448 0.11% 141 27144 0.11% 142 28552 0.12% 143 30192 0.12% 144 32230 0.13% 145 35856 0.15% 146 42972 0.18% 147 70314 0.29% 148 195198 0.81% 149 1361376 5.63% 150 21809498 90.20% 24179240 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=11.43 fanout-score-rank=13 prefix-density=0.34 prefix-fanout=4.4 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=105.36 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=13.8 sequence=AAAGCAGCAGGAAACACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGCGGCCATGGCTAGCTAACTGTACTCTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCA criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=90.39 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.4 sequence=GGTGGTGGTGGAG SRR5986241 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:35:11 Started mapping on | Feb 14 03:35:11 Finished on | Feb 14 03:40:54 Mapping speed, Million of reads per hour | 253.78 Number of input reads | 24179240 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 19702382 Uniquely mapped reads % | 81.48% Average mapped length | 280.20 Number of splices: Total | 17568813 Number of splices: Annotated (sjdb) | 17002621 Number of splices: GT/AG | 17169593 Number of splices: GC/AG | 224197 Number of splices: AT/AC | 17028 Number of splices: Non-canonical | 157995 Mismatch rate per base, % | 2.15% Deletion rate per base | 0.13% Deletion average length | 3.18 Insertion rate per base | 0.08% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1170452 % of reads mapped to multiple loci | 4.84% Number of reads mapped to too many loci | 45791 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.28% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3306408 3306408 3306408 N_multimapping 1170452 1170452 1170452 N_noFeature 497429 10070999 10011605 N_ambiguous 334975 109243 109701 UnstrandedReadsAssigned:18869978 PositiveStrandReadsAssigned:9522140 NegativeStrandReadsAssigned:9581076 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5986241 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986241-trimmed-pair1.fastq SRR5986241-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,179,240 reads, 19,741,864 reads pseudoaligned [quant] estimated average fragment length: 218.3 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR5986241.ke.tsv 34699 SRR5986241.se.tsv 87100 total ==> SRR5986241.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.7 1410.54 34.7415 Potri.005G024800.1.v4.1 1035 817.7 684 37.0993 Potri.004G059700.1.v4.1 961 743.7 38 2.26615 Potri.007G009000.2.v4.1 1416 1198.7 0 0 Potri.003G141000.2.v4.1 2943 2725.7 365.185 5.94207 Potri.016G087400.1.v4.1 270 66.5729 1005 669.532 Potri.015G069301.1.v4.1 564 346.793 0 0 Potri.010G195200.1.v4.1 1773 1555.7 190.848 5.44083 Potri.012G127500.1.v4.1 977 759.7 4666 272.399 ==> SRR5986241.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 185 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 120 SRR5986241 completed mapping pipeline successfully