Starting /dee2/code/volunteer_pipeline.sh SRR5986242 current disk space = 3088128708608 free memory = 1537184408 SRR5986242 SRAfilesize c2b7ee2aad6f6da6e157b7b343023cb8 SRR5986242.sra SRR5986242.sra file validated SRR5986242 is paired end SRR5986242 is conventional basespace SRR5986242 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0425 32.0 27.0 32.0 2.0 32.0 2 31.325 32.0 32.0 32.0 32.0 32.0 3 33.14375 32.0 32.0 37.0 32.0 37.0 4 35.07 37.0 37.0 37.0 32.0 37.0 5 35.83 37.0 37.0 37.0 32.0 37.0 6 39.1755 41.0 37.0 41.0 37.0 41.0 7 38.921 41.0 37.0 41.0 32.0 41.0 8 39.40375 41.0 41.0 41.0 37.0 41.0 9 39.64075 41.0 41.0 41.0 37.0 41.0 10-14 39.28615 41.0 41.0 41.0 37.0 41.0 15-19 39.4149 41.0 41.0 41.0 36.0 41.0 20-24 39.47155 41.0 41.0 41.0 37.0 41.0 25-29 38.764250000000004 41.0 39.4 41.0 35.0 41.0 30-34 38.7899 41.0 39.4 41.0 35.0 41.0 35-39 38.309349999999995 41.0 38.6 41.0 31.0 41.0 40-44 38.39015 41.0 38.6 41.0 33.0 41.0 45-49 37.4612 41.0 37.0 41.0 29.0 41.0 50-54 36.654250000000005 41.0 37.0 41.0 25.0 41.0 55-59 36.8979 41.0 37.0 41.0 26.0 41.0 60-64 37.02645 41.0 36.0 41.0 26.0 41.0 65-69 35.80015 40.2 35.0 41.0 23.0 41.0 70-74 37.511900000000004 41.0 37.0 41.0 29.0 41.0 75-79 37.2738 41.0 37.0 41.0 28.0 41.0 80-84 34.6668 38.6 31.0 41.0 18.0 41.0 85-89 35.749399999999994 41.0 35.0 41.0 22.0 41.0 90-94 36.676 41.0 37.0 41.0 25.0 41.0 95-99 35.3871 39.4 33.0 41.0 21.0 41.0 100-104 31.719050000000003 35.0 25.0 41.0 14.0 41.0 105-109 33.7821 38.6 30.0 41.0 16.0 41.0 110-114 33.975300000000004 37.8 30.0 41.0 18.0 41.0 115-119 35.406150000000004 40.2 34.0 41.0 22.0 41.0 120-124 32.274350000000005 37.8 26.0 41.0 15.0 41.0 125-129 31.66035 36.0 24.0 40.2 12.0 41.0 130-134 31.1082 36.0 24.0 40.2 12.0 41.0 135-139 32.93025 37.0 28.0 41.0 14.0 41.0 140-144 28.141000000000002 31.0 21.0 37.6 12.0 41.0 145-149 31.299349999999997 35.0 26.0 41.0 12.0 41.0 150 31.5775 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 3.0 21 9.0 22 16.0 23 23.0 24 43.0 25 48.0 26 60.0 27 68.0 28 107.0 29 146.0 30 141.0 31 183.0 32 197.0 33 210.0 34 240.0 35 299.0 36 306.0 37 369.0 38 461.0 39 565.0 40 503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.748992872637125 17.880384257824605 19.11992562751782 33.25069724202046 2 23.400000000000002 27.375 34.300000000000004 14.924999999999999 3 21.255313828457115 30.332583145786447 28.032008002000502 20.38009502375594 4 22.525000000000002 35.225 21.099999999999998 21.15 5 22.275 38.025 22.875 16.825000000000003 6 17.075000000000003 39.425 23.025000000000002 20.474999999999998 7 17.299999999999997 17.1 41.9 23.7 8 19.6 22.225 27.55 30.625000000000004 9 20.325 23.375 28.675 27.625 10-14 20.825 30.285 26.700000000000003 22.189999999999998 15-19 21.38 29.020000000000003 27.625 21.975 20-24 21.65 29.609999999999996 26.435 22.305 25-29 21.475 28.165000000000003 27.800000000000004 22.56 30-34 20.84 28.915000000000003 27.88 22.365 35-39 21.955 28.860000000000003 27.37 21.815 40-44 22.005 28.605000000000004 27.145000000000003 22.245 45-49 21.425 29.23 27.325 22.02 50-54 21.715 28.605000000000004 27.48 22.2 55-59 21.69 28.02 27.589999999999996 22.7 60-64 21.935 27.505000000000003 27.889999999999997 22.67 65-69 21.92 28.355000000000004 27.46 22.264999999999997 70-74 21.965 27.96 27.415 22.66 75-79 21.855 28.74 26.55 22.855 80-84 21.925 29.160000000000004 27.034999999999997 21.88 85-89 21.97 28.305000000000003 27.35 22.375 90-94 21.85 28.555000000000003 27.0 22.595000000000002 95-99 22.314999999999998 28.415000000000003 27.195000000000004 22.075 100-104 22.634999999999998 27.650000000000002 28.060000000000002 21.654999999999998 105-109 22.009999999999998 28.055000000000003 27.355 22.58 110-114 22.485 28.115000000000002 27.589999999999996 21.81 115-119 22.495 27.67 27.855 21.98 120-124 22.175 28.544999999999998 27.935 21.345 125-129 22.02 28.125 27.98 21.875 130-134 22.585 27.994999999999997 28.349999999999998 21.07 135-139 22.375 27.245 28.799999999999997 21.58 140-144 22.415 28.249999999999996 29.134999999999998 20.200000000000003 145-149 21.584999999999997 28.455000000000002 28.485 21.475 150 22.400000000000002 27.950000000000003 27.075 22.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 2.0 24 2.5 25 2.5 26 4.5 27 6.5 28 10.0 29 19.0 30 29.5 31 33.0 32 37.5 33 47.0 34 60.5 35 80.5 36 97.0 37 117.5 38 139.5 39 167.0 40 205.0 41 216.0 42 223.5 43 232.0 44 247.5 45 266.5 46 261.0 47 242.5 48 216.0 49 190.5 50 162.0 51 143.5 52 128.0 53 92.0 54 64.5 55 56.0 56 45.5 57 37.0 58 25.0 59 17.0 60 16.5 61 12.0 62 8.0 63 4.5 64 4.0 65 5.0 66 4.0 67 2.5 68 0.5 69 1.5 70 2.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.325 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.39301772017986 89.225 2 5.421846072467601 10.25 3 0.18513620735255223 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.16249999999999998 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.30000000000000004 0.0 0.0 0.0 0.0 126-127 0.3375 0.0 0.0 0.0 0.0 128-129 0.375 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.475 0.0 0.0 0.0 0.0 136-137 0.625 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATCC 10 0.0069990456 143.82501 3 GTTTCCT 10 0.0069990456 143.82501 6 >>END_MODULE SRR5986242 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986242_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.31875 32.0 12.0 32.0 2.0 32.0 2 30.73625 32.0 32.0 32.0 27.0 32.0 3 31.61 32.0 32.0 37.0 27.0 37.0 4 34.4775 37.0 32.0 37.0 32.0 37.0 5 35.38375 37.0 37.0 37.0 32.0 37.0 6 38.56975 41.0 37.0 41.0 32.0 41.0 7 32.6855 37.0 27.0 41.0 12.0 41.0 8 37.65675 41.0 37.0 41.0 32.0 41.0 9 34.92725 41.0 32.0 41.0 12.0 41.0 10-14 36.31805000000001 41.0 36.0 41.0 23.0 41.0 15-19 33.977199999999996 37.6 28.0 41.0 20.0 41.0 20-24 35.077 39.4 32.0 41.0 21.0 41.0 25-29 34.7439 39.4 32.0 41.0 21.0 41.0 30-34 29.769099999999998 33.0 20.0 40.2 12.0 41.0 35-39 33.67265 37.4 29.0 40.2 18.0 41.0 40-44 28.988799999999998 30.8 22.0 37.6 15.0 40.2 45-49 30.574149999999996 34.0 21.0 40.2 12.0 41.0 50-54 31.74325 35.8 23.0 41.0 16.0 41.0 55-59 29.55095 33.0 17.0 39.4 14.0 41.0 60-64 28.8394 32.0 19.0 39.4 14.0 41.0 65-69 26.7943 27.0 16.0 36.6 12.0 40.2 70-74 27.51775 27.0 18.0 37.6 12.0 40.2 75-79 30.2031 34.0 20.0 40.2 12.0 41.0 80-84 27.79955 31.0 14.0 39.2 12.0 41.0 85-89 29.2625 33.0 20.0 39.4 12.0 41.0 90-94 24.560499999999998 24.0 14.0 35.0 12.0 40.2 95-99 24.275 24.0 12.0 35.0 12.0 39.4 100-104 23.3676 20.0 12.0 35.0 12.0 39.4 105-109 24.452549999999995 24.0 12.0 35.0 12.0 39.4 110-114 25.368850000000002 27.0 12.0 35.0 12.0 40.2 115-119 23.96265 23.0 12.0 35.0 12.0 41.0 120-124 22.8578 22.0 12.0 33.0 12.0 40.2 125-129 21.8066 20.0 12.0 30.0 12.0 37.0 130-134 21.4269 17.0 12.0 30.0 12.0 38.6 135-139 20.983150000000002 18.0 12.0 29.0 12.0 37.0 140-144 21.178 20.0 12.0 29.0 12.0 37.0 145-149 18.8756 16.0 12.0 25.0 10.4 33.0 150 18.67125 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 9.0 16 45.0 17 114.0 18 148.0 19 160.0 20 209.0 21 189.0 22 203.0 23 205.0 24 181.0 25 190.0 26 190.0 27 197.0 28 175.0 29 219.0 30 208.0 31 189.0 32 190.0 33 213.0 34 202.0 35 175.0 36 169.0 37 141.0 38 60.0 39 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.40076824583867 19.49423815620999 21.062740076824586 32.04225352112676 2 24.95 26.325 34.525 14.2 3 22.5 30.875000000000004 27.05 19.575 4 23.75 35.675000000000004 19.475 21.099999999999998 5 22.85 39.574999999999996 20.875 16.7 6 16.1 40.150000000000006 23.525 20.225 7 16.375 16.650000000000002 45.175 21.8 8 18.575 21.775 29.15 30.5 9 22.025 22.05 27.925 28.000000000000004 10-14 20.535 29.7 27.529999999999998 22.235 15-19 22.235 27.200000000000003 29.115000000000002 21.45 20-24 21.92 29.62 27.215 21.245 25-29 21.465 29.134999999999998 27.73 21.67 30-34 23.0 28.765 28.34 19.895 35-39 21.87 28.7 28.625 20.805 40-44 23.47 29.995 28.955 17.580000000000002 45-49 23.415 28.744999999999997 28.67 19.17 50-54 22.595000000000002 28.605000000000004 28.48 20.32 55-59 22.945 29.415000000000003 28.050000000000004 19.59 60-64 22.745 28.83 29.015 19.41 65-69 23.53 28.99 29.785 17.695 70-74 22.915 29.299999999999997 29.459999999999997 18.325 75-79 22.745 28.095 29.125 20.035 80-84 22.125 29.544999999999998 30.635 17.695 85-89 22.035 28.634999999999998 29.244999999999997 20.085 90-94 22.74 29.220000000000002 31.345 16.695 95-99 23.745 29.01 30.11 17.135 100-104 23.445 28.95 30.3 17.305 105-109 22.235 29.175 30.72 17.87 110-114 23.345 28.18 29.175 19.3 115-119 23.025000000000002 28.38 29.99 18.605 120-124 22.515 29.325000000000003 30.115 18.045 125-129 22.435 28.410000000000004 30.375000000000004 18.78 130-134 23.21 28.675 30.79 17.325 135-139 23.35 28.28 31.245 17.125 140-144 23.669999999999998 28.144999999999996 29.134999999999998 19.05 145-149 23.965 28.615000000000002 31.035 16.384999999999998 150 23.599999999999998 28.825 32.225 15.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 1.5 21 0.5 22 4.0 23 7.5 24 7.5 25 9.0 26 16.5 27 17.0 28 17.0 29 33.0 30 45.0 31 60.0 32 78.0 33 94.0 34 107.0 35 104.5 36 125.0 37 169.0 38 192.0 39 190.5 40 193.0 41 215.5 42 229.5 43 226.5 44 228.5 45 237.5 46 227.5 47 196.0 48 165.5 49 153.5 50 143.0 51 120.5 52 98.5 53 71.5 54 49.0 55 35.0 56 28.0 57 23.5 58 18.5 59 14.5 60 8.5 61 5.0 62 5.0 63 4.0 64 4.0 65 3.5 66 1.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.3625 0.0 0.0 0.0 0.0 134-135 0.4 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGACT 10 0.0033930484 182.58731 1 AAATATA 10 0.0070045046 143.7875 4 CAAATAT 10 0.0070045046 143.7875 3 >>END_MODULE Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra Read 1169792 spots for SRR5986242.sra Written 1169792 spots for SRR5986242.sra SRR ids: ['SRR5986242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5qfv5jim SRR5986242.sra spots: 23395840 blocks: [[1, 1169792], [1169793, 2339584], [2339585, 3509376], [3509377, 4679168], [4679169, 5848960], [5848961, 7018752], [7018753, 8188544], [8188545, 9358336], [9358337, 10528128], [10528129, 11697920], [11697921, 12867712], [12867713, 14037504], [14037505, 15207296], [15207297, 16377088], [16377089, 17546880], [17546881, 18716672], [18716673, 19886464], [19886465, 21056256], [21056257, 22226048], [22226049, 23395840]] SRR5986242 file size 7860687 SRR5986242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986242 SRR5986242_1.fastq SRR5986242_2.fastq Input file: SRR5986242_1.fastq Paired file: SRR5986242_2.fastq trimmed: SRR5986242-trimmed-pair1.fastq, SRR5986242-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:26:30 2025 >> started Fri Feb 14 03:26:54 2025 >> done (24.337s) 23395840 read pairs processed; of these: 197 ( 0.00%) short read pairs filtered out after trimming by size control 202 ( 0.00%) empty read pairs filtered out after trimming by size control 23395441 (100.00%) read pairs available; of these: 2166804 ( 9.26%) trimmed read pairs available after processing 21228637 (90.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 14 0.00% 20 25 0.00% 21 30 0.00% 22 36 0.00% 23 51 0.00% 24 51 0.00% 25 42 0.00% 26 52 0.00% 27 81 0.00% 28 83 0.00% 29 77 0.00% 30 80 0.00% 31 60 0.00% 32 76 0.00% 33 75 0.00% 34 71 0.00% 35 78 0.00% 36 79 0.00% 37 87 0.00% 38 83 0.00% 39 67 0.00% 40 82 0.00% 41 84 0.00% 42 93 0.00% 43 88 0.00% 44 88 0.00% 45 71 0.00% 46 90 0.00% 47 101 0.00% 48 117 0.00% 49 119 0.00% 50 118 0.00% 51 117 0.00% 52 118 0.00% 53 124 0.00% 54 112 0.00% 55 136 0.00% 56 132 0.00% 57 136 0.00% 58 119 0.00% 59 147 0.00% 60 133 0.00% 61 162 0.00% 62 139 0.00% 63 140 0.00% 64 166 0.00% 65 154 0.00% 66 138 0.00% 67 157 0.00% 68 174 0.00% 69 178 0.00% 70 219 0.00% 71 182 0.00% 72 260 0.00% 73 243 0.00% 74 239 0.00% 75 234 0.00% 76 226 0.00% 77 315 0.00% 78 303 0.00% 79 317 0.00% 80 354 0.00% 81 331 0.00% 82 408 0.00% 83 494 0.00% 84 502 0.00% 85 478 0.00% 86 530 0.00% 87 589 0.00% 88 626 0.00% 89 654 0.00% 90 715 0.00% 91 871 0.00% 92 900 0.00% 93 1018 0.00% 94 1150 0.00% 95 1116 0.00% 96 1142 0.00% 97 1310 0.01% 98 1452 0.01% 99 1474 0.01% 100 1578 0.01% 101 1729 0.01% 102 1876 0.01% 103 2008 0.01% 104 2207 0.01% 105 2410 0.01% 106 2452 0.01% 107 2563 0.01% 108 2730 0.01% 109 2984 0.01% 110 3074 0.01% 111 3299 0.01% 112 3454 0.01% 113 3823 0.02% 114 4058 0.02% 115 4285 0.02% 116 4516 0.02% 117 4702 0.02% 118 4858 0.02% 119 5235 0.02% 120 5378 0.02% 121 5889 0.03% 122 6294 0.03% 123 6515 0.03% 124 6962 0.03% 125 7456 0.03% 126 7763 0.03% 127 7918 0.03% 128 8309 0.04% 129 8813 0.04% 130 8975 0.04% 131 9420 0.04% 132 10060 0.04% 133 10580 0.05% 134 11368 0.05% 135 11805 0.05% 136 12383 0.05% 137 12953 0.06% 138 13195 0.06% 139 13765 0.06% 140 14229 0.06% 141 14871 0.06% 142 15993 0.07% 143 16886 0.07% 144 18180 0.08% 145 21476 0.09% 146 29663 0.13% 147 60786 0.26% 148 205220 0.88% 149 1496146 6.40% 150 21228637 90.74% 23395441 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.15 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=76.23 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.1 sequence=AGAAAGAAAGAAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=10.89 fanout-score-rank=12 prefix-density=0.37 prefix-fanout=4.4 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=139.94 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=20.3 sequence=GCAGCAGCAGCA SRR5986242 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:27:57 Started mapping on | Feb 14 03:27:58 Finished on | Feb 14 03:34:34 Mapping speed, Million of reads per hour | 212.69 Number of input reads | 23395441 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19156027 Uniquely mapped reads % | 81.88% Average mapped length | 287.70 Number of splices: Total | 17754203 Number of splices: Annotated (sjdb) | 17197455 Number of splices: GT/AG | 17355621 Number of splices: GC/AG | 226242 Number of splices: AT/AC | 17415 Number of splices: Non-canonical | 154925 Mismatch rate per base, % | 2.17% Deletion rate per base | 0.13% Deletion average length | 3.23 Insertion rate per base | 0.08% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1182405 % of reads mapped to multiple loci | 5.05% Number of reads mapped to too many loci | 40459 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.66% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3057009 3057009 3057009 N_multimapping 1182405 1182405 1182405 N_noFeature 459327 9781975 9708115 N_ambiguous 321567 98202 99196 UnstrandedReadsAssigned:18375133 PositiveStrandReadsAssigned:9275850 NegativeStrandReadsAssigned:9348716 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986242 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986242-trimmed-pair1.fastq SRR5986242-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,395,441 reads, 18,970,870 reads pseudoaligned [quant] estimated average fragment length: 240.399 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR5986242.ke.tsv 34699 SRR5986242.se.tsv 87100 total ==> SRR5986242.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.6 1412 33.976 Potri.005G024800.1.v4.1 1035 795.601 582 31.3071 Potri.004G059700.1.v4.1 961 721.601 21 1.24548 Potri.007G009000.2.v4.1 1416 1176.6 0 0 Potri.003G141000.2.v4.1 2943 2703.6 348.188 5.51172 Potri.016G087400.1.v4.1 270 54.7403 845.699 661.187 Potri.015G069301.1.v4.1 564 324.703 0 0 Potri.010G195200.1.v4.1 1773 1533.6 224 6.25102 Potri.012G127500.1.v4.1 977 737.601 4002 232.205 ==> SRR5986242.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 99 SRR5986242 completed mapping pipeline successfully