Starting /dee2/code/volunteer_pipeline.sh SRR5986243 current disk space = 3088176025600 free memory = 1579609744 SRR5986243 SRAfilesize 3486fb66ff745f1eb8c672fbf83ef351 SRR5986243.sra SRR5986243.sra file validated SRR5986243 is paired end SRR5986243 is conventional basespace SRR5986243 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.455 32.0 27.0 32.0 2.0 32.0 2 31.37875 32.0 32.0 32.0 32.0 32.0 3 33.23375 32.0 32.0 37.0 32.0 37.0 4 35.19125 37.0 37.0 37.0 32.0 37.0 5 35.94 37.0 37.0 37.0 32.0 37.0 6 39.3035 41.0 41.0 41.0 37.0 41.0 7 39.11725 41.0 37.0 41.0 37.0 41.0 8 39.49 41.0 41.0 41.0 37.0 41.0 9 39.72275 41.0 41.0 41.0 37.0 41.0 10-14 39.306650000000005 41.0 41.0 41.0 37.0 41.0 15-19 39.367000000000004 41.0 41.0 41.0 36.0 41.0 20-24 39.465250000000005 41.0 41.0 41.0 37.0 41.0 25-29 38.8691 41.0 39.4 41.0 35.0 41.0 30-34 38.88525 41.0 40.2 41.0 35.0 41.0 35-39 38.49375 41.0 39.4 41.0 33.0 41.0 40-44 38.3631 41.0 39.4 41.0 32.0 41.0 45-49 37.591150000000006 41.0 37.0 41.0 28.0 41.0 50-54 36.8673 41.0 37.0 41.0 26.0 41.0 55-59 37.105450000000005 41.0 37.0 41.0 26.0 41.0 60-64 37.2042 41.0 36.0 41.0 28.0 41.0 65-69 36.08175 40.2 35.0 41.0 23.0 41.0 70-74 37.77284999999999 41.0 37.0 41.0 30.0 41.0 75-79 37.4424 41.0 37.0 41.0 29.0 41.0 80-84 34.826 39.4 33.0 41.0 18.0 41.0 85-89 35.9245 41.0 35.0 41.0 22.0 41.0 90-94 36.85535 41.0 37.0 41.0 26.0 41.0 95-99 35.54415 39.4 33.0 41.0 22.0 41.0 100-104 32.05535 36.8 25.0 41.0 14.0 41.0 105-109 33.98545 38.6 30.0 41.0 16.0 41.0 110-114 34.1447 38.6 30.0 41.0 18.0 41.0 115-119 35.52485 40.2 34.0 41.0 22.0 41.0 120-124 32.6773 37.8 26.0 41.0 15.0 41.0 125-129 32.00555 36.0 26.0 41.0 12.0 41.0 130-134 31.3375 36.0 25.0 40.2 12.0 41.0 135-139 33.092749999999995 37.0 30.0 41.0 12.0 41.0 140-144 28.529449999999997 31.0 21.0 38.6 12.0 41.0 145-149 31.836000000000002 36.0 26.0 41.0 12.0 41.0 150 32.07025 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 8.0 22 16.0 23 23.0 24 35.0 25 61.0 26 59.0 27 86.0 28 91.0 29 108.0 30 138.0 31 140.0 32 188.0 33 221.0 34 253.0 35 268.0 36 335.0 37 381.0 38 408.0 39 647.0 40 530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.640036730945823 19.06948270584634 20.4468931741659 32.843587389041936 2 24.349999999999998 25.2 35.925000000000004 14.524999999999999 3 20.810405202601302 30.365182591295646 28.264132066033014 20.560280140070038 4 21.075 37.275000000000006 22.025 19.625 5 22.825 38.925 21.775 16.475 6 15.9 38.3 23.599999999999998 22.2 7 15.35 16.650000000000002 45.9 22.1 8 19.975 22.475 27.650000000000002 29.9 9 20.275000000000002 22.7 29.375 27.650000000000002 10-14 20.925 29.49 27.58 22.005 15-19 20.96 28.455000000000002 28.505000000000003 22.08 20-24 21.255 29.13 27.82 21.795 25-29 21.790000000000003 29.09 27.435 21.685 30-34 20.72 30.095 27.955000000000002 21.23 35-39 21.42 28.79 28.444999999999997 21.345 40-44 21.26 28.799999999999997 28.065 21.875 45-49 21.01 28.785 28.1 22.105 50-54 21.73 28.105000000000004 27.74 22.425 55-59 21.41 28.83 28.175 21.584999999999997 60-64 21.595 28.544999999999998 28.065 21.795 65-69 21.525 28.505000000000003 27.860000000000003 22.11 70-74 21.575 28.405 27.855 22.165000000000003 75-79 21.595 28.52 27.565 22.32 80-84 21.2 28.175 28.405 22.220000000000002 85-89 21.255 28.095 28.17 22.48 90-94 21.195 28.42 28.08 22.305 95-99 21.605 28.799999999999997 27.6 21.995 100-104 21.965 28.335 28.194999999999997 21.505 105-109 22.134999999999998 28.084999999999997 28.665000000000003 21.115000000000002 110-114 21.884999999999998 28.04 28.110000000000003 21.965 115-119 21.845 28.555000000000003 28.305000000000003 21.295 120-124 21.68 28.565 28.82 20.935000000000002 125-129 22.35 27.83 28.475 21.345 130-134 21.795 28.345 28.749999999999996 21.11 135-139 21.709999999999997 28.265 28.610000000000003 21.415 140-144 22.18 29.244999999999997 28.82 19.755 145-149 22.235 29.2 27.779999999999998 20.785 150 22.375 28.050000000000004 28.349999999999998 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 2.0 19 2.0 20 0.5 21 0.0 22 1.5 23 4.5 24 4.5 25 2.5 26 9.0 27 11.0 28 13.5 29 20.5 30 27.5 31 40.0 32 50.5 33 59.5 34 68.5 35 92.0 36 115.0 37 131.5 38 167.0 39 196.5 40 205.0 41 226.5 42 250.0 43 254.0 44 245.5 45 237.5 46 225.5 47 203.5 48 183.0 49 163.0 50 146.0 51 128.0 52 125.0 53 106.0 54 67.0 55 48.5 56 43.0 57 31.0 58 15.0 59 13.5 60 15.0 61 10.0 62 6.0 63 9.0 64 7.5 65 3.0 66 2.0 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.325 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.09186351706037 90.575 2 4.829396325459317 9.2 3 0.07874015748031496 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3625 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.4875 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.6 0.0 0.0 0.0 0.0 136-137 0.625 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCTC 10 0.0069990456 143.82501 9 TAATGGT 10 0.0069990456 143.82501 9 >>END_MODULE SRR5986243 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986243_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.83625 32.0 12.0 32.0 2.0 32.0 2 30.6125 32.0 32.0 32.0 27.0 32.0 3 32.0525 32.0 32.0 37.0 27.0 37.0 4 34.5425 37.0 32.0 37.0 32.0 37.0 5 35.17 37.0 37.0 37.0 32.0 37.0 6 38.51175 41.0 37.0 41.0 32.0 41.0 7 33.23575 37.0 32.0 41.0 12.0 41.0 8 37.75675 41.0 37.0 41.0 32.0 41.0 9 35.159 41.0 32.0 41.0 12.0 41.0 10-14 36.57455 41.0 36.0 41.0 24.0 41.0 15-19 34.211 37.6 28.0 41.0 20.0 41.0 20-24 35.17405000000001 39.4 32.0 41.0 21.0 41.0 25-29 35.00064999999999 39.4 33.0 41.0 21.0 41.0 30-34 30.0229 33.0 21.0 40.2 14.0 41.0 35-39 34.0215 38.4 31.0 40.2 18.0 41.0 40-44 29.40145 30.8 22.0 37.6 15.0 40.2 45-49 30.906799999999997 34.0 21.0 40.2 12.0 41.0 50-54 32.09925 36.8 25.0 41.0 16.0 41.0 55-59 29.801599999999997 32.0 17.0 40.2 14.0 41.0 60-64 29.37915 32.0 19.0 40.2 14.0 41.0 65-69 27.219000000000005 27.0 18.0 38.4 12.0 40.2 70-74 27.6944 27.0 18.0 37.6 12.0 40.2 75-79 30.81485 35.0 21.0 41.0 12.0 41.0 80-84 28.343799999999998 32.0 16.0 39.2 12.0 41.0 85-89 29.72955 34.0 20.0 40.2 12.0 41.0 90-94 24.8852 25.0 14.0 35.0 12.0 40.2 95-99 24.75015 24.0 14.0 36.0 12.0 40.2 100-104 23.907950000000003 23.0 12.0 35.0 12.0 39.4 105-109 24.746950000000002 26.0 12.0 35.0 12.0 39.4 110-114 25.97905 28.0 16.0 35.0 12.0 41.0 115-119 24.6632 25.0 12.0 36.0 12.0 41.0 120-124 23.37405 22.0 12.0 33.0 12.0 40.2 125-129 22.23625 20.0 12.0 31.0 12.0 37.0 130-134 21.740199999999998 19.0 12.0 31.0 12.0 38.6 135-139 21.29435 18.0 12.0 29.0 12.0 37.0 140-144 21.79495 20.0 12.0 31.0 12.0 37.0 145-149 19.2832 16.0 12.0 25.0 12.0 35.0 150 19.05625 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 14.0 16 48.0 17 114.0 18 125.0 19 169.0 20 192.0 21 182.0 22 165.0 23 175.0 24 158.0 25 193.0 26 174.0 27 201.0 28 177.0 29 212.0 30 189.0 31 250.0 32 209.0 33 221.0 34 209.0 35 205.0 36 193.0 37 130.0 38 76.0 39 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.93910860012555 19.962335216572505 19.491525423728813 31.607030759573135 2 24.6 26.25 33.95 15.2 3 19.425 31.674999999999997 28.599999999999998 20.3 4 22.775000000000002 34.699999999999996 21.625 20.9 5 22.5 38.35 22.625 16.525000000000002 6 15.5 38.525 24.4 21.575 7 16.150000000000002 16.8 44.9 22.15 8 19.025 21.8 30.45 28.725 9 20.424999999999997 22.95 28.7 27.925 10-14 20.72 30.445 27.57 21.265 15-19 21.48 28.435 28.28 21.805 20-24 21.645 29.075 28.21 21.07 25-29 21.815 29.215000000000003 27.99 20.979999999999997 30-34 22.05 28.689999999999998 29.615000000000002 19.645000000000003 35-39 22.025 28.754999999999995 28.835 20.385 40-44 22.605 30.214999999999996 29.79 17.39 45-49 22.695 28.74 29.110000000000003 19.455 50-54 22.02 28.785 28.71 20.485 55-59 22.28 28.925 29.26 19.535 60-64 22.075 29.425 29.659999999999997 18.84 65-69 23.25 29.459999999999997 29.415000000000003 17.875 70-74 23.705000000000002 29.56 28.910000000000004 17.825 75-79 21.395 28.549999999999997 29.360000000000003 20.695 80-84 21.78 29.665000000000003 30.795 17.76 85-89 21.215 28.485 30.270000000000003 20.03 90-94 22.61 29.385 31.685000000000002 16.32 95-99 22.53 29.175 30.814999999999998 17.48 100-104 22.425 29.270000000000003 30.97 17.335 105-109 21.935 29.494999999999997 30.595 17.974999999999998 110-114 23.11 28.49 29.73 18.67 115-119 22.42 29.335 29.354999999999997 18.89 120-124 22.29 29.134999999999998 30.745 17.83 125-129 22.5 28.660000000000004 31.075000000000003 17.765 130-134 22.869999999999997 28.499999999999996 30.904999999999998 17.724999999999998 135-139 22.925 29.54 30.570000000000004 16.965 140-144 23.455000000000002 28.410000000000004 30.669999999999998 17.465 145-149 23.54 28.4 31.985000000000003 16.075 150 22.6 28.075 34.35 14.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 3.0 20 3.0 21 3.0 22 3.0 23 6.5 24 10.0 25 13.0 26 18.5 27 25.0 28 33.5 29 34.5 30 41.5 31 56.5 32 71.0 33 99.0 34 120.5 35 121.0 36 134.0 37 169.5 38 197.5 39 201.0 40 220.0 41 240.5 42 243.5 43 243.5 44 222.5 45 224.0 46 229.0 47 197.0 48 164.0 49 137.0 50 113.0 51 86.5 52 63.5 53 52.0 54 44.0 55 39.5 56 29.5 57 16.5 58 15.0 59 12.5 60 11.5 61 10.5 62 4.0 63 3.0 64 2.5 65 2.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.349999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14271306101867 98.3 2 0.8572869389813415 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.3875 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.425 0.0 0.0 0.0 0.0 134-135 0.4625 0.0 0.0 0.0 0.0 136-137 0.5 0.0 0.0 0.0 0.0 138 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAT 10 0.0035585305 179.75 1 TCATCCA 10 0.007002685 143.8 4 >>END_MODULE Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra Read 1090451 spots for SRR5986243.sra Written 1090451 spots for SRR5986243.sra Read 1090444 spots for SRR5986243.sra Written 1090444 spots for SRR5986243.sra SRR ids: ['SRR5986243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yzp52t9z SRR5986243.sra spots: 21808887 blocks: [[1, 1090444], [1090445, 2180888], [2180889, 3271332], [3271333, 4361776], [4361777, 5452220], [5452221, 6542664], [6542665, 7633108], [7633109, 8723552], [8723553, 9813996], [9813997, 10904440], [10904441, 11994884], [11994885, 13085328], [13085329, 14175772], [14175773, 15266216], [15266217, 16356660], [16356661, 17447104], [17447105, 18537548], [18537549, 19627992], [19627993, 20718436], [20718437, 21808887]] SRR5986243 file size 7326020 SRR5986243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986243 SRR5986243_1.fastq SRR5986243_2.fastq Input file: SRR5986243_1.fastq Paired file: SRR5986243_2.fastq trimmed: SRR5986243-trimmed-pair1.fastq, SRR5986243-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:45:28 2025 >> started Fri Feb 14 03:45:51 2025 >> done (23.727s) 21808887 read pairs processed; of these: 204 ( 0.00%) short read pairs filtered out after trimming by size control 327 ( 0.00%) empty read pairs filtered out after trimming by size control 21808356 (100.00%) read pairs available; of these: 1737749 ( 7.97%) trimmed read pairs available after processing 20070607 (92.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 25 0.00% 20 27 0.00% 21 30 0.00% 22 36 0.00% 23 40 0.00% 24 62 0.00% 25 61 0.00% 26 55 0.00% 27 58 0.00% 28 71 0.00% 29 54 0.00% 30 61 0.00% 31 63 0.00% 32 78 0.00% 33 61 0.00% 34 83 0.00% 35 72 0.00% 36 76 0.00% 37 66 0.00% 38 83 0.00% 39 60 0.00% 40 69 0.00% 41 71 0.00% 42 84 0.00% 43 91 0.00% 44 94 0.00% 45 87 0.00% 46 106 0.00% 47 88 0.00% 48 102 0.00% 49 111 0.00% 50 96 0.00% 51 101 0.00% 52 82 0.00% 53 109 0.00% 54 108 0.00% 55 92 0.00% 56 120 0.00% 57 104 0.00% 58 106 0.00% 59 124 0.00% 60 114 0.00% 61 165 0.00% 62 155 0.00% 63 104 0.00% 64 131 0.00% 65 136 0.00% 66 156 0.00% 67 137 0.00% 68 171 0.00% 69 169 0.00% 70 188 0.00% 71 199 0.00% 72 215 0.00% 73 248 0.00% 74 216 0.00% 75 229 0.00% 76 264 0.00% 77 266 0.00% 78 244 0.00% 79 311 0.00% 80 298 0.00% 81 341 0.00% 82 360 0.00% 83 398 0.00% 84 467 0.00% 85 442 0.00% 86 441 0.00% 87 492 0.00% 88 559 0.00% 89 588 0.00% 90 635 0.00% 91 703 0.00% 92 787 0.00% 93 848 0.00% 94 885 0.00% 95 969 0.00% 96 1062 0.00% 97 1100 0.01% 98 1171 0.01% 99 1303 0.01% 100 1343 0.01% 101 1472 0.01% 102 1626 0.01% 103 1719 0.01% 104 1992 0.01% 105 2041 0.01% 106 2148 0.01% 107 2258 0.01% 108 2455 0.01% 109 2477 0.01% 110 2690 0.01% 111 2940 0.01% 112 3040 0.01% 113 3285 0.02% 114 3555 0.02% 115 3812 0.02% 116 3996 0.02% 117 4327 0.02% 118 4385 0.02% 119 4529 0.02% 120 4830 0.02% 121 5239 0.02% 122 5540 0.03% 123 5792 0.03% 124 6212 0.03% 125 6603 0.03% 126 6718 0.03% 127 7126 0.03% 128 7518 0.03% 129 7872 0.04% 130 8106 0.04% 131 8613 0.04% 132 8904 0.04% 133 9512 0.04% 134 10154 0.05% 135 10617 0.05% 136 10954 0.05% 137 11592 0.05% 138 11846 0.05% 139 12388 0.06% 140 12948 0.06% 141 13493 0.06% 142 14278 0.07% 143 14858 0.07% 144 16298 0.07% 145 18632 0.09% 146 24526 0.11% 147 46789 0.21% 148 152209 0.70% 149 1180643 5.41% 150 20070607 92.03% 21808356 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.1 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=368.77 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=31.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=2.2 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=362.96 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=31.4 sequence=AAGAAGAAGAAA SRR5986243 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:46:50 Started mapping on | Feb 14 03:46:51 Finished on | Feb 14 03:52:50 Mapping speed, Million of reads per hour | 218.69 Number of input reads | 21808356 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18153249 Uniquely mapped reads % | 83.24% Average mapped length | 288.39 Number of splices: Total | 16436188 Number of splices: Annotated (sjdb) | 15917578 Number of splices: GT/AG | 16044325 Number of splices: GC/AG | 229654 Number of splices: AT/AC | 15785 Number of splices: Non-canonical | 146424 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1052303 % of reads mapped to multiple loci | 4.83% Number of reads mapped to too many loci | 32517 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.53% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2602804 2602804 2602804 N_multimapping 1052303 1052303 1052303 N_noFeature 619772 9326120 9275574 N_ambiguous 355646 92407 93102 UnstrandedReadsAssigned:17177831 PositiveStrandReadsAssigned:8734722 NegativeStrandReadsAssigned:8784573 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986243 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986243-trimmed-pair1.fastq SRR5986243-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,808,356 reads, 17,447,031 reads pseudoaligned [quant] estimated average fragment length: 240.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR5986243.ke.tsv 34699 SRR5986243.se.tsv 87100 total ==> SRR5986243.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.21 1143 29.0061 Potri.005G024800.1.v4.1 1035 795.212 673 38.1908 Potri.004G059700.1.v4.1 961 721.218 26 1.6268 Potri.007G009000.2.v4.1 1416 1176.21 0 0 Potri.003G141000.2.v4.1 2943 2703.21 298.124 4.97672 Potri.016G087400.1.v4.1 270 53.8356 625 523.887 Potri.015G069301.1.v4.1 564 324.324 0 0 Potri.010G195200.1.v4.1 1773 1533.21 43 1.26559 Potri.012G127500.1.v4.1 977 737.218 1888 115.567 ==> SRR5986243.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5986243 completed mapping pipeline successfully